CN107119077B

CN107119077B - New application of CtIP inhibitor and accurate genomic DNA fragment editing method

Info

Publication number: CN107119077B
Application number: CN201710345545.XA
Authority: CN
Inventors: 吴强; 李金环; 寿佳
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2017-05-16
Filing date: 2017-05-16
Publication date: 2021-09-21
Anticipated expiration: 2037-05-16
Also published as: CN107119077A

Abstract

The invention belongs to the field of biotechnology, and particularly relates toCtIPNovel use of inhibitors and a precise method for editing genomic DNA fragments. The invention has been extensively and deeply researched and found to inhibitCtIPThe accurate connection efficiency of the connection joint after the genome DNA fragments are edited can be improved, the accurate connection proportion of the connection joint after the genome DNA fragments are edited is improved, and therefore accurate genome DNA fragment editing is achieved.

Description

New application of CtIP inhibitor and accurate genomic DNA fragment editing method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a new application of a CtIP inhibitor and an accurate genome DNA fragment editing method.

Background

Since the completion of the Human Genome Project (Human Genome Project) and DNA element Encyclopedia (Encyclopedia of DNA Elements) projects, scientists have analyzed and identified a large number of genes and DNA regulatory Elements in the Genome [1,2 ]. DNA regulatory elements that play an important role in gene expression regulation include promoters, enhancers, silencers, insulators, and the like. However, the function of most regulatory elements has not been experimentally verified and elucidated [2-8 ]. The function of genes and DNA regulatory elements can be explored by editing DNA fragments in genetics.

Early gene editing and gene functional modification was achieved by gene transposition and transgenesis [9-14 ]. With the development of sequencing technologies, reverse genetics has been applied to make specific mutations in genomes [15,16 ]. In particular, gene-targeted mice that rely on homologous recombination are rapidly being used in scientific research [15,17,18 ]. In addition, inversion and duplication of DNA fragments in mice and zebrafish was applied to study specific genomic structural changes [19-24 ].

In recent years, the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated nucleic acid 9(Cas9), CRISPR/Cas 9) derived from bacteria and archaea is an emerging genome editing technology [25-27], and is rapidly applied to eukaryotic genome editing due to its simple design and convenient operation. We achieved DNA fragment genetic editing (deletion, inversion and duplication) in human cell lines and mice using the CRISPR/Cas9 system [28 ]. By means of two site-targeted cleavage in the genome by Cas 9and two sgRNAs, deletion, inversion (inversion), duplication, translocation and insertion (if donor is provided) of DNA fragments can be realized under the action of a repair system in which proteins such as CtIP participate [29-32 ]. The genetic manipulation of this DNA fragment editing can be used to study the regulation of gene expression and three-dimensional genomic structure of tropocadherins and globin [28,31-33 ].

Specifically, two sgRNAs (Single-guide rnas, sgRNAs) are designed for the target DNA fragment, and SpCas9 (from Streptococcus genes) can cut a DNA double strand upstream of a pam (protospacer adjacent motif) site under the mediation of the sgRNAs to form a DNA double strand break, thereby realizing genetic editing of the DNA fragment under a cell self-repair system. At the DNA fragment editing linker junction, we found that there was a certain proportion of accurate ligation of DNA fragments (i.e. direct ligation of DNA linkers cleaved 3bp upstream of PAM at the site where two sgRNAs are located) and also inaccurate ligation (deletion and insertion of bases at the junction). Editing of DNA fragments can now be achieved by the CRISPR/Cas9 system, but methods to effectively achieve precise genetic editing of DNA fragments, including deletions, inversions (inversions), duplications, translocations, and insertions, have yet to be discovered for in-depth study of the precise function of a particular DNA segment.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims to provide a new application of a CtIP inhibitor and a precise genomic DNA fragment editing method.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

in a first aspect of the invention, there is provided the use of a CtIP inhibitor in the editing of genomic DNA fragments.

Preferably, the CtIP inhibitor is used for improving the precision rate of editing of genomic DNA fragments.

Preferably, the CtIP inhibitor is used for improving the direct ligation rate of the junction adaptor after editing of the genomic DNA fragment.

The direct connection of the junction junctions after editing the genomic DNA fragments means that there is no deletion or insertion of bases at the junction junctions.

The improvement is compared to when no CtIP inhibitor is employed.

Such genomic DNA fragment edits include, but are not limited to: deletions, inversions or inversions, duplications, translocations and insertions of genomic DNA fragments.

The genomic DNA fragment editing may be in vivo or in vitro.

The CtIP inhibitor is a compound having an inhibitory effect on CtIP.

Having inhibitory effects on CtIP include, but are not limited to: inhibit CtIP activity, inhibit phosphorylation of CtIP, or inhibit transcription, splicing, translation, modification or any form of active expression of CtIP gene.

The CtIP inhibitor can be siRNA, shRNA, sgRNA, antibody, small molecule compound and the like.

In a second aspect of the invention, there is provided the use of a CtIP inhibitor in the preparation of a genomic DNA fragment editing product.

Preferably, the CtIP inhibitor is used as an effective component for improving the precision rate of editing the genomic DNA fragments.

Preferably, the CtIP inhibitor is used as an effective component for improving the direct connection rate of the connection joint after the genome DNA fragments are edited.

The improvement is compared to when no CtIP inhibitor is employed.

The CtIP inhibitor is a compound having an inhibitory effect on CtIP.

The genome DNA fragment editing product comprises an effective amount of CtIP inhibitor and at least one genome editing tool capable of editing genome DNA fragments.

The genome DNA fragment editing product necessarily contains a CtIP inhibitor, and the CtIP inhibitor is used as an effective component for improving the accuracy of genome DNA fragment editing or improving the direct connection rate of a connection joint after the genome DNA fragment editing.

The effective component in the genome DNA fragment editing product, which plays a role in improving the accurate connection rate of the connection joint after the genome DNA fragment is edited, can be only a CtIP inhibitor, and can also contain other chemicals playing similar roles.

The substance capable of interfering with the editing of the genomic DNA fragment can be siRNA, shRNA, sgRNA, antibody, small molecular compound and the like.

The genome editing tool is not particularly limited as long as it can generate a DNA double strand break. For example, the genome editing tool can be selected from, but not limited to, CRISPR/Cas9, CRISPR/Cpf1, CRISPR/C2C1, teleen, ZFN, I-SceI, and derivative systems optimized by corresponding genome editing tool engineering, and the like.

In some embodiments of the invention, editing of a DNA fragment of interest using a CRISPR/Cas9 system that includes sgRNAs and Cas9 directed against the DNA fragment of interest is exemplified.

In use, an effective amount of a CtIP inhibitor and at least one tool capable of editing genomic DNA fragments can be administered simultaneously or sequentially. That is, the CtIP inhibitor may be administered to the subject to be edited at a stage before, during, or after the subject to be edited receives the editing of the genomic DNA fragment.

The way the genomic DNA fragments are edited includes but is not limited to: mutations, deletions, inversions or inversions, duplications, translocations and insertions.

The third aspect of the present invention provides a method for editing a genomic DNA fragment, wherein a CtIP inhibitor is used to inhibit CtIP when editing a genomic DNA fragment to be edited with a genomic editing tool.

The manner of editing the genomic DNA fragments includes, but is not limited to: mutations, deletions, inversions or inversions, duplications, translocations and insertions.

Editing of the genomic DNA fragment can be performed using genomic DNA fragment editing tools of the prior art, such as sgRNAs and CRISPR/Cas9 of Cas9 for a DNA fragment of interest as exemplified in some embodiments of the invention. In addition, the CRISPR/Cpf1, CRISPR/C2C1, TELEN, ZFN, I-SceI and corresponding genome editing tools can be used for modifying optimized derivative systems and the like to edit genome DNA fragments.

The improvement is compared to when no CtIP inhibitor is employed.

The method for editing the genomic DNA fragment may be in vivo or in vitro.

The CtIP inhibitor can be applied to the object to be edited before, during and after the object to be edited receives the genomic DNA fragment editing.

In some embodiments of the invention, it is exemplified that administering a CtIP inhibitor before, during, and after editing a DNA fragment of interest using a CRISPR/Cas9 system comprising sgRNAs and Cas9 directed to the DNA fragment of interest, respectively, is effective in providing accurate editing of the DNA fragment of interest. Particularly, the accurate connection rate of the connection joint after the genome DNA fragments are deleted can be effectively improved.

The CtIP inhibitor is a compound having an inhibitory effect on CtIP.

Having inhibitory effects on CtIP include, but are not limited to: inhibit CtIP activity, inhibit phosphorylation of CtIP, or inhibit transcription, splicing, translation, modification, or any form of active expression.

The CtIP inhibitor exemplified in example 1 of the present invention can be a CRISPR-Cas9 system comprising sgRNAs (shown in SEQ ID Nos. 5 to 8) against CtIP and SpCas 9. The CtIP inhibitor as exemplified in example 3 of the present invention may also be selected from the small molecule compounds 3-AP.

The subject may be of any species. The subject includes prokaryotes, fungi, plants, and animals.

For example, the subject may be a mammal or a cell of the mammal. The mammalian cell may be an ex vivo mammalian cell. The mammal may be selected from, but is not limited to, humans, mice, rats, rabbits, monkeys, pigs, cattle, sheep, dogs. The object can also be agricultural related plants, fungi, mushrooms, lucid ganoderma, fishes, breeding animals and the like.

The fourth aspect of the present invention provides a genomic DNA fragment editing product, comprising an effective amount of a CtIP inhibitor and at least one tool capable of editing genomic DNA fragments.

The genome DNA fragment editing product must contain a CtIP inhibitor, and the CtIP inhibitor is used as an effective component for improving the precision rate of genome DNA fragment editing or improving the precision connection rate of a connection joint after the genome DNA fragment editing.

The tools capable of intervening in editing the genomic DNA fragments can be siRNA, shRNA, sgRNA, antibodies, small molecule compounds and the like.

In use, an effective amount of a CtIP inhibitor and at least one tool capable of editing genomic DNA fragments can be administered simultaneously or sequentially. That is, the CtIP inhibitor may be administered to a subject before, during, or after the subject to be edited receives editing of a genomic DNA fragment.

Such genomic DNA fragment edits include, but are not limited to: mutations, deletions, inversions or inversions, duplications, translocations and insertions of genomic DNA fragments.

CtIP inhibitors can also alter the base mutation characteristics at single-site editing, including the addition and deletion of bases.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, extensive and intensive researches show that the expression of CtIP is inhibited, the accurate connection efficiency of the connection joint after deletion of the genome DNA fragments can be improved, and the accurate connection proportion of the connection joint after editing of the genome DNA fragments can be improved. The method can realize accurate genome DNA fragment editing, can better research the accurate function of a specific DNA segment, and is simpler, easy to operate and higher in efficiency.

Drawings

FIG. 1A: the sgRNAs added with the target CtIP gene, sgRNAs aiming at the STM site and humanized SpCas9 plasmid transfect human embryonic kidney HEK293T cells together, and the deletion fragment of the STM site is connected with the precise connection result of the connector.

FIG. 1B: the sgRNAs added with the target CtIP gene, sgRNAs aiming at the HS51 site and humanized SpCas9 plasmid transfect human embryonic kidney HEK293T cells together, and the deletion fragment at the HS51 site is connected with a precise connection result of a connector.

FIG. 1C: the sgRNAs added with the targeting CtIP gene, sgRNAs aiming at beta-globin loci and humanized SpCas9 plasmid are used for co-transfecting human embryonic kidney HEK293T cells, and the precise connection result of the connection joint of the deletion fragments of the beta-globin loci is obtained.

FIG. 1D: and (3) screening CtIP gene knockout conditions in the obtained 2 CtIP gene mutation cell lines.

FIG. 1E: compared with the normal HEK293T cell, the STM site DNA fragment deletes the accurate connection condition of the joint in the CtIP gene knockout cell line.

FIG. 1F: compared with the normal HEK293T cell, the CtIP gene knockout cell line has the advantage that the HS51 site DNA fragment deletes the accurate connection condition of the joint.

FIG. 1G: compared with a normal HEK293T cell, the CtIP gene knockout cell line has the advantage that the accurate connection condition of the beta-globin loci DNA fragment deletion joint.

FIG. 1H: and (3) in the normal HEK293T cell, CtIP- #14 and CtIP- #27 mutant cell lines, the 3-AP deletes the accurate connection of the DNA fragment of the STM locus.

FIG. 1I: and (3) in normal HEK293T cells, CtIP- #14 and CtIP- #27 mutant cell lines, the 3-AP is precisely connected with the DNA fragment deletion at the HS51 site.

Detailed Description

According to the invention, extensive and intensive researches show that the activity of CtIP is inhibited, the accurate connection efficiency of the connection joint after the genome DNA fragments are edited can be improved, and the accurate connection proportion of the connection joint after the genome DNA fragments are edited can be improved.

CtIP

CtIP, also called RBBP8, whose 22-45 amino acids are the connection region with MRN complex (Mre11-Rad50-Nbs1), which is rapidly recognized together with the C-terminal 650-897 amino acids and interacts with the MRN complex, and is located on the damaged DNA sequence to complete the damage repair process.

CtIP inhibitors

CtIP is also called RBBP8, and 22-45 amino acids of the CtIP are a connecting region with MRN complex (Mre11-Rad50-Nbs1), and the CtIP and the C-terminal 650-897 amino acids are jointly and rapidly recognized and mutually combined with the MRN complex to be positioned on a damaged DNA sequence to complete the damage repair process.

CtIP inhibitors are compounds having an inhibitory effect on CtIP. Having inhibitory effects on CtIP include, but are not limited to: inhibit CtIP activity, inhibit phosphorylation of CtIP, or inhibit transcription, splicing, translation, modification or any form of active expression of CtIP gene.

The CtIP inhibitor includes but is not limited to siRNA, shRNA, sgRNA, antibody and small molecule compound.

The CtIP inhibitor exemplified in the embodiment 1 of the invention can be a CRISPR/Cas9 system for a CtIP gene, and the CRISPR/Cas9 system for the CtIP gene comprises sgRNAs (shown in SEQ ID NO. 5-8) targeting the CtIP gene and Cas9 nuclease responsible for cutting the CtIP gene.

The CtIP inhibitor can also be a small molecule compound 3-AP capable of inhibiting CtIP activity as exemplified in example 3 of the present invention. In addition, the small molecule compound Roscovitine (Rosc) can also inhibit CtIP activity.

Inhibition of CtIP activity refers to a decrease in CtIP activity. Preferably, CtIP activity is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, and most preferably by at least 90% compared to prior to inhibition.

Inhibition of CtIP phosphorylation can inhibit target repair involving CtIP.

Inhibiting gene transcription or expression of CtIP means: the gene of CtIP is not transcribed or the transcription activity of the gene of CtIP is reduced, or the gene of CtIP is not expressed or the expression activity of the gene of CtIP is reduced.

The skilled artisan can also use conventional methods to modulate CtIP gene transcription or expression, such as gene knock-out, gene silencing, interfering RNA, and the like.

The inhibition of gene transcription or expression of CtIP can be verified by detecting expression quantity by qPCR or RNA-seq and Western Blot.

Preferably, the CtIP gene transcription or expression is reduced by at least 10%, preferably by at least 30%, even more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 90%, compared to the wild type, and most preferably the CtIP gene is not expressed at all.

In addition, techniques conventional in the art may also be employed to inhibit translation, modification, or any form of active expression of the CtIP gene to function as a means of inhibiting CtIP activity.

Small molecule compounds

The invention refers to a compound which is composed of several or dozens of atoms and has the molecular mass of less than 1000.

3-AP (3-aminopyridine-2-carboxylate thiosemicarbazone) is a small molecule inhibitor of ribonucleotide reductase, and the article reports that 3-AP inhibits gene repair involving CtIP by inhibiting phosphorylation of CtIP protein.

Roscovitine (rosc) is a Cyclin Dependent Kinase (CDK) inhibitor that can act as a CtIP inhibitor.

Accurate genome DNA fragment editing method

According to the accurate genome DNA fragment editing method, when the genome editing tool is used for editing the genome DNA fragment to be edited, the CtIP inhibitor is used for inhibiting the CtIP.

The CtIP inhibitor can be applied to the object to be edited before, during and after the object to be edited receives the deletion of the target DNA fragment.

The subject may be of any species. The subject includes prokaryotes, fungi, plants, and animals. For example, the subject may be a mammal or a cell of the mammal. The mammalian cell may be an ex vivo mammalian cell. The mammal may be selected from, but is not limited to, humans, mice, rats, rabbits, monkeys, pigs, cattle, sheep, dogs. The object can also be agricultural related plants, fungi, mushrooms, lucid ganoderma, fishes, breeding animals and the like.

Genomic DNA fragment editing product

The genome DNA fragment editing product comprises an effective amount of CtIP inhibitor and at least one tool capable of editing the genome DNA fragment.

The tool capable of intervening in editing the genome DNA fragment can be siRNA, shRNA, sgRNA, antibody and small molecular compound. In some embodiments of the invention, deletion of a DNA fragment of interest is exemplified by using a CRISPR/Cas9 system comprising sgRNAs and Cas9 for the DNA fragment of interest as a genomic DNA fragment deletion product.

In use, an effective amount of a CtIP inhibitor and at least one tool capable of editing genomic DNA fragments can be administered simultaneously or sequentially. That is, the CtIP inhibitor may be administered to the subject at a stage before, during, or after the subject receives the genomic DNA fragment deletion product for deletion of the DNA fragment of interest.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORY MANUAL, Second edition, Cold Spring Harbor LABORATORY Press, 1989and Third edition, 2001; ausubel et al, Current PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; (iii) METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol.119, chromatography Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.

Example 1 transfection of sgRNAs against CtIP Gene can improve precision ligation efficiency after deletion of DNA fragment 1. construction of STM site and sgRNAs plasmid of CtIP Gene

(1) Purchasing primers

Forward and reverse deoxyoligonucleotides having 5' overhang ends "ACCG" and "AAAC" that can be complementarily paired against sgRNAs targeting sequences of STM site (β -globin RE1) and CtIP gene, respectively, were purchased from shanghai sony biotechnology ltd.

Forward and reverse deoxyoligonucleotides:

β-globin RE1sgRNA1F：accgATTGTTGTTGCCTTGGAGTG(SEQ ID NO.1)

β-globin RE1sgRNA1R：aaacCACTCCAAGGCAACAACAAT(SEQ ID NO.2)

β-globin RE1sgRNA2F：accgCTGGTCCCCTGGTAACCTGG(SEQ ID NO.3)

β-globin RE1sgRNA2R：aaacCCAGGTTACCAGGGGACCAG(SEQ ID NO.4)

CtIPsgRNA1F：accgGAGCAGAGCAGCGGGGCAA(SEQ ID NO.5)

CtIPsgRNA1R：aaacTTGCCCCGCTGCTCTGCTC(SEQ ID NO.6)

CtIPsgRNA2F：accgTTGCCCAAAGATTCCCCAG(SEQ ID NO.7)

CtIPsgRNA2R：aaacCTGGGGAATCTTTGGGCAA(SEQ ID NO.8)。

(2) obtaining complementary paired double-stranded DNA with overhang end

1) By ddH₂O dissolving the deoxyoligonucleotide to 100 mu M and diluting to 20 mu M;

2) the positive and negative deoxyoligonucleotide is added into the following reaction system:

reaction conditions are as follows: water bath at 95 deg.C for 5min, opening the cover of the water bath kettle, cooling to about 60 deg.C, covering the cover, and cooling to room temperature.

(3) Enzyme digestion pGL3-U6-sgRNA-PGK-Puro vector

1) The vector plasmid was digested with BsaI restriction enzyme in the following reaction scheme:

reaction conditions are as follows: 1.5 hours at 37 ℃;

2) gel recovery purification of the DNA digestion fragment and purification according to the gel recovery kit (Axygen).

(4) Ligation of the digested vector to double-stranded DNA with a overhang

The linking system is as follows:

reaction conditions are as follows: the reaction was carried out at room temperature for 1.5 hours.

(5) Conversion of ligation products

The ligation products were competent transformed with Stbl3 and cultured overnight at 37 ℃ on LB plates containing ampicillin (Amp, 100 mg/L).

(6) Picking monoclonal sequencing

1) Single colonies were picked from ampicillin LB plates and cultured overnight in LB (Amp, 100mg/L) broth.

2) Plasmid extraction was performed according to the plasmid miniprep kit (Axygen).

3) The extracted plasmid was sequenced by Shanghai Sangni Biotech Co., Ltd.

(7) Successfully sequenced plasmid was extracted

1) Successfully sequenced plasmids were competent retransformed with Stbl3 and cultured overnight on LB plates containing Amp (100 mg/L).

2) In the morning, a single colony was picked and cultured in 2ml of LB (Amp, 100mg/L) liquid medium for 8 hours, and then transferred to 200ml of LB (Amp, 100mg/L) liquid medium for overnight culture.

3) The bacteria were harvested and the plasmids were extracted according to the plasmid extraction kit (Qiagen).

2. Preparation of humanized Cas9 plasmid

1) The humanized Cas9 plasmid was obtained from the laboratory of the university of beijing chairman institute.

2) The cells were competent for retransformation with Stbl3 and cultured overnight on LB plates (Amp, 100 mg/L).

3) In the morning, a single colony was picked and cultured in 2ml of LB (Amp, 100mg/L) liquid medium for 8 hours, and then transferred to 200ml of LB (Amp, 100mg/L) liquid medium for overnight culture, and plasmid extraction was performed.

3. Cell transfection with Lipofectamine 2000

1) HEK293T cells were cultured in flasks at 37 ℃ with 5% CO₂And (5) culturing in a cell culture box until the cells grow to 80-90% of the culture bottle.

2) The grown cells were plated in 12-well plates with DMEM complete antibody-free medium (10% fetal bovine serum, no penicillin double antibody) and cultured overnight.

3) When the cells in the 12-well plate grow to 80-90%, the prepared humanized Cas9 plasmid (800ng), sgRNAs at STM sites (600 ng respectively) and sgRNAs of CtIP genes (600 ng respectively) are subjected to cell transfection by Lipofectamine 2000, and each sample is repeated twice.

4) Two days after transfection, cells were collected and extracted with a genome extraction kit (

Genomic DNAPuration kit, Promega) extracts the genome.

4. Preparation of high throughput sequencing libraries

Designing a primer at about 30bp upstream of a precise connection site (a linker is directly connected after Cas9 is cut at 3bp upstream of PAM) of a predicted deletion linker of a DNA fragment, then adding a sequencing linker of Illumina with barcode to the 5' end of the primer, designing a downstream primer at a position far away from the splicing site and adding a sequencing linker of Illumina, carrying out PCR amplification after synthesizing the primer from the Biotechnology (Shanghai) Limited company, then purifying by using a Roche PCR purification kit (Product No.:11732676001), dissolving the DNA Product in 10mM Tris-HCL buffer (PH 8.5), mixing the DNA Product in equal quantity to form a library, and carrying out second-generation high-throughput sequencing by PE 150.

5. High throughput sequencing data processing

After the high-throughput sequencing was completed, the sequencing results of the samples were separated from the library by barcode using the Linux program, stored in respective folders, and subjected to BWA-MEM alignment, and the aligned sequences were analyzed for insertion and deletion mutations of DNA fragments by the Varscan2 program (V2.3.9), with the Varscan2 program parameters as follows:

and aiming at the STM locus, carrying out PCR amplification on the DNA fragment deletion event by using a high-throughput sequencing primer, carrying out high-throughput sequencing analysis on the DNA terminal connection condition of the deletion event, and counting the accurate and inaccurate conditions of the DNA fragment deletion connection joint according to a sequencing result.

As shown in FIG. 1A, compared with a control group, the sgRNAs added with the target CtIP gene, sgRNAs aiming at the STM site and humanized SpCas9 plasmid transfect human embryonic kidney HEK293T cells together, so that the expression of the CtIP gene is interfered, the accurate connection ratio of the deletion fragment connection joint of the STM site is obviously improved (the accurate connection ratio is improved by 25.33% compared with the control group), and the accurate connection efficiency at the connection joint is greatly improved (the accurate connection efficiency is improved by 20.29% compared with the control group).

Meanwhile, referring to the above method, for another HS51RE1(HS51 site) DNA genetic editing fragment, the result is shown in fig. 1B, compared with the control group, the sgRNAs added with the target CtIP gene, the sgRNAs for HS51 site and the humanized SpCas9 plasmid transfect human embryonic kidney HEK293T cells together, which interferes with the expression of the CtIP gene, the accurate connection ratio at the deletion linker junction of HS51 site is also obviously improved (the accurate connection ratio is improved by 12.56% compared with the control group), and the accurate connection efficiency at the connection linker is greatly improved (the accurate connection efficiency is improved by 10.85% compared with the control group).

In addition, as a result of selecting another β -globin locus (β -globin arcus) DNA genetic editing fragment, as shown in fig. 1C, compared with the control group, the sgRNAs of the target CtIP gene, the sgRNAs of the β -globin arcus locus, and the humanized SpCas9 plasmid are added to transfect human embryonic kidney HEK293T cells together, thereby interfering with expression of the CtIP gene, and the precise ligation ratio at the deletion linker junction of the β -globin locus is also significantly increased (12.62% higher than the precise ligation ratio of the control group), and the precise ligation efficiency at the ligation linker is greatly increased (12.71% higher than the precise ligation efficiency of the control group).

sgRNAs targeting sequences to the different sites:

β-globin RE1sgRNA1：GATTGTTGTTGCCTTGGAGTG(SEQ ID NO.9)

β-globin RE1sgRNA2：GCTGGTCCCCTGGTAACCTGG(SEQ ID NO.10)

HS51RE1sgRNA1：GCCACACATCCAAGGCTGAC(SEQ ID NO.11)

HS51RE1sgRNA2：GAGATTTGGGGCGTCAGGAAG(SEQ ID NO.12)

β-globin locussgRNA1：GGAGATGGCAGTGTTGAAGC(SEQ ID NO.13)

β-globin locussgRNA2：CTAGGGGTCAGAAGTAGTTC(SEQ ID NO.14)

high-throughput primers for the different sites described above:

Hiseq-hSTM-del-aF1:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTTAGAGCCAGGACTAATTGC(SEQ ID NO.15)

Hiseq-hSTM-del-2R:

CAAGCAGAAGACGGCATACGAGATAGTCAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGCTCTGCCTGAAAGGAGTC(SEQ ID NO.16)

Hiseq-hHs51-del-aF:

ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAAGGAGATCCGTGTCGTC(SEQ ID NO.17)

Hiseq-hHs51-del-bR:CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTTTTTTGGCTAACAACATAGTGCTTC(SEQ ID NO.18)

Hiseq-glob-del-aF2:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGGTTAGCGGCTTGCTCAATTC(SEQ ID NO.19)

Hiseq-glob-del-bR1:

CAAGCAGAAGACGGCATACGAGATATCACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTTCAGCCATCCCAAGACTC(SEQ ID NO.20)

in summary, CtIP is an important accessory protein for cutting the broken end of DNA in NHEJ (Non-homologus end-joining) system, and the cell transfected with the sgRNA targeting the CtIP gene interferes with the expression of the CtIP gene, so that the function of the protein is inhibited, and the capability of the repair complex to cut the end of DNA after DNA breakage is reduced.

By means of the combined action of the CtIP gene responsible for cutting the DNA double strand in the two sgRNAs targeting cell repair systems and the two sgRNAs aiming at the target DNA fragment through the CRISPR/Cas9 system, the accurate connection proportion and efficiency of the target DNA fragment at a deleted joint can be effectively improved.

Example 2 CtIP mutation in cell line can effectively improve the precise connection efficiency of deletion of target DNA fragment

1. Cell line for obtaining CtIP mutation by CRISPR system

1) HEK293T cells were cultured in culture flasks, and when they grew to 80-90% in culture flasks, the well grown cells were plated in 12-well plates with DMEM complete antibiotic-free medium and cultured overnight. When the cells in the 12-well plate grow to 80-90%, the prepared humanized Cas9 plasmid (800ng) and sgRNAs plasmids (600 ng each) of CtIP sites are subjected to cell transfection by Lipofectamine 2000.

2) Puromycin (2 mug/ml) is added into cells 48 hours after transfection for drug screening for four days, then the cells are cultured in a fresh culture medium for eight days, the cells are collected, the uniformly dispersed cells are counted, then the cells are diluted to a certain number of kinds and are placed into a 96-well plate (only one cell is in each well), and after 6 days of culture, the well plate with only one cell mass is continuously added with culture solution for culturing for 8 days.

3) Collecting partial cells, screening primers with CtIP to identify DNA fragment editing condition, and continuously culturing the rest cells.

CtIP gene screening primers:

CR-CtIP1-1F：GTACTACTTCTGGGTCTCCCGC(SEQ ID NO.21)

CR-CtIP1-1R：CACTACACTGCAGGTGCTCACC(SEQ ID NO.22)

CR-CtIP2-1F：CATGAATGGAGACTGTGTGATGG(SEQ ID NO.23)

CR-CtIP2-1R：CAAACTTTCACGTGGACGTAGAG(SEQ ID NO.24)

2. CtIP mutant cell line transfection with Lipofectamine 2000

HEK293T cells and CtIP mutant cells are cultured in a culture bottle, when the cells grow to 80-90% of the culture bottle, the grown cells are plated in a 12-well plate by using DMEM (DMEM) completely free of an anti-culture medium, and the cells are cultured overnight. When the cells in the 12-well plate grow to 80-90%, the prepared humanized Cas9 plasmid (800ng) and sgRNAs plasmid (600 ng each) at STM site were transfected by Lipofectamine 2000 in duplicate for each sample. Two days after transfection, cells were collected and extracted with a genome extraction kit (

Genomic DNAPuration kit, Promega) extracts the genome.

3. Preparation of high throughput sequencing libraries

The procedure was the same as in example 1.

4. High throughput sequencing data processing

The procedure was the same as in example 1.

HEK293T cells transfected with Cas9 plasmid and sgRNAs for CtIP gene were monocloned and PCR screened with CtIP gene screening primers as described above. Among 96 monoclonal cells, 2 CtIP gene knockout cell lines, i.e., CtIP- #27 and CtIP- #14 (shown in FIG. 1D) were screened.

Next, sgRNAs and Cas9 plasmids for STM sites were transfected in both the CtIP knockout cell line and normal HEK293T cells, genomic DNA was collected 48 hours after transfection, PCR amplification was performed on the targeted sites using high-throughput sequencing primers, and a library was constructed for high-throughput sequencing. The result is shown in fig. 1E, compared with the normal HEK293T cell, the two CtIP gene knockout cell lines have effectively improved precise connection efficiency of the STM locus DNA fragment deletion linker (improved by 17.02% and 21.45%, respectively), however, the effect on insertion mutation is less.

In the two CtIP gene knockout cell lines and normal HEK293T cells, sgRNAs and Cas9 plasmids aiming at HS51 sites are transfected, genomic DNA is collected after transfection for 48 hours, a high-throughput sequencing primer is used for carrying out PCR amplification on the targeted sites, and a library is constructed for high-throughput sequencing. The result is shown in fig. 1F, compared with normal HEK293T cells, the two CtIP gene knockout cell lines have effectively improved precise ligation efficiency of the HS51 site DNA fragment deletion linker (by 8.63% and 7.83%, respectively), however, have less influence on insertion mutation.

In the two CtIP gene knockout cell lines and normal HEK293T cells, sgRNAs and Cas9 plasmids aiming at beta-globin sites are transfected, genomic DNA is collected after transfection for 48 hours, a high-throughput sequencing primer is used for carrying out PCR amplification on the targeted sites, and a library is constructed for high-throughput sequencing. The result is shown in fig. 1G, compared with the normal HEK293T cell, the two CtIP gene knockout cell lines effectively improve the precise connection efficiency of the β -globin locus DNA fragment deletion linker (by 12.58% and 13.75%, respectively), however, the two CtIP gene knockout cell lines have less influence on insertion mutation. In conclusion, the CtIP gene in the cell line can effectively improve the efficiency of accurate connection at the deleted joint of the target DNA fragment after mutation.

Example 33 AP increases the efficiency of precision ligation of DNA fragment deletions

1. Transfection of cell lines with Lipofectamine 2000 at STM site

HEK293T cells and CtIP mutant cells were plated in 12-well plates with DMEM complete antibody-free medium overnight. When the cells in the 12-well plate are 80-90% long, the medium is removed, DMEM complete non-resistant medium containing DMSO or 3-AP (SML0568, sigma) at different concentrations, 0.2 μ M, 0.4 μ M, 0.8 μ M, 1.6 μ M, is added, and the prepared humanized Cas9 plasmid (800ng) and sgRNAs (600 ng each) for STM sites are transfected by Lipofectamine 2000. After 24 hours, the medium was removed, DMEM complete double antibody medium (10% fetal bovine serum and 1% penicillin double antibody) was added, and after 24 hours, cells were collected and extracted with a genome extraction kit (

Genomic DNAPurification kit, Promega) extracted the genome, two replicates per sample.

2. Preparation of high throughput sequencing libraries

The procedure was the same as in example 1.

3. High throughput sequencing data processing

The procedure was the same as in example 1.

3-AP (3-aminopyridine-2-carboxylate thiosemicarbazone) is a small molecule inhibitor of ribonucleotide reductase and has been reported to inhibit CtIP-mediated repair by homologous recombination through inhibition of CtIP protein phosphorylation [34 ].

In normal HEK293T cells, CtIP- #14 and CtIP- #27 mutant cell lines, the Cas9 plasmid and sgRNAs plasmid against STM sites were transfected in medium culture conditions containing DMSO (control) or different concentrations (0.2. mu.M, 0.4. mu.M, 0.8. mu.M, 1.6. mu.M) of 3-AP (sigma), and 24 hours later, the cells were harvested for genome extraction. And carrying out PCR amplification by using a high-throughput sequencing primer to obtain a DNA fragment deletion adaptor fragment of the STM locus, mixing the molecular weights equally to form a library, and carrying out high-throughput sequencing. As shown in FIG. 1H, for normal HEK293T cells, the addition of 0.2-0.8. mu.M 3AP can increase the precise ligation ratio of DNA fragment deletion; in the CtIP- #14 cell line, the precise connection proportion of the deletion of the DNA fragment is continuously increased along with the increase of the concentration of the 3-AP; in CtIP- #27 cell line, the proportion of perfect ligation of DNA fragment deletions did not increase with an increase in 3-AP concentration to 0.4. mu.M; the accurate connection ratio of the CtIP- #27 cell line and the CtIP- #14 cell line is higher than that of the normal HEK293T cell line; this is also in agreement with the previous experimental results. Furthermore, the precise ligation ratio in CtIP- #27 cell line was higher than that in CtIP- #14 cell line. In a CtIP mutant cell line, the accurate connection proportion of DNA fragment deletion can be improved by adding 3-AP with low concentration.

In normal HEK293T cells, CtIP- #14 and CtIP- #27 mutant cell lines, the Cas9 plasmid and the sgRNAs plasmid against the HS51 site were transfected in medium culture conditions containing DMSO (control) or different concentrations (0.2. mu.M, 0.4. mu.M, 0.8. mu.M, 1.6. mu.M) of 3-AP (sigma), and after 24 hours, the cells were harvested for genome extraction. And (3) carrying out PCR amplification by using a high-throughput sequencing primer to obtain a DNA fragment deletion joint fragment of the HS51 locus, mixing molecular weights, forming a library, and carrying out high-throughput sequencing. As shown in FIG. 1I, for normal HEK293T cells, the addition of 0.2-0.8. mu.M 3AP can increase the precise ligation ratio of DNA fragment deletion; in the CtIP- #14 cell line, the precise connection proportion of the deletion of the DNA fragment is continuously increased along with the increase of the concentration of the 3-AP; in CtIP- #27 cell line, the proportion of perfect ligation of DNA fragment deletions did not increase with an increase in 3-AP concentration to 0.4. mu.M; the accurate connection ratio of the CtIP- #27 cell line and the CtIP- #14 cell line is higher than that of the normal HEK293T cell line; this is also in agreement with the previous experimental results. Furthermore, the precise ligation ratio in CtIP- #27 cell line was higher than that in CtIP- #14 cell line. In a CtIP mutant cell line, the accurate connection proportion of DNA fragment deletion can be improved by adding 3-AP with low concentration.

In conclusion, 3-AP can significantly improve the precise connection proportion of deletion of the target DNA fragment.

The references of the present application are as follows:

1.Stamatoyannopoulos,JA.(2012).What does our genome encodeGenome Res,22:1602-1611.

2.The ENCODE Project Consortium.(2012).An integrated encyclopedia of DNA elements in the human genome.Nature,489:57-74.

3.Banerji,J,L Olson,and W Schaffner.(1983).A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes.Cell,33:729-740.

4.Zhang,T,P Haws,and Q Wu.(2004).Multiple variable first exons:a mechanism for cell-and tissue-specific gene regulation.Genome Res,14:79-89.

5.Neph,S,et al.(2012).An expansive human regulatory lexicon encoded in transcription factor footprints.Nature,489:83-90.

6.Shen,Y,et al.(2012).A map of the cis-regulatory sequences in the mouse genome.Nature,488:116-120.

7.Thurman,RE,et al.(2012).The accessible chromatin landscape of the human genome.Nature,489:75-82.

8.de Laat,W and D Duboule.(2013).Topology of mammalian developmental enhancers and their regulatory landscapes.Nature,502:499-506.

9.McClintock,B.(1950).The origin and behavior of mutable loci in maize.Proc Natl Acad Sci U S A,36:344-355.

10.McClintock,B.(1984).The significance of responses of the genome to challenge.Science,226:792-801.

11.Brinster,RL,et al.(1981).Somatic expression of herpes thymidine kinase in mice following injection of a fusion gene into eggs.Cell,27:223-231.

12.Harbers,K,D Jahner,and R Jaenisch.(1981).Microinjection of cloned retroviral genomes into mouse zygotes:integration and expression in the animal.Nature,293:540-542.

13.Gordon,JW,et al.(1980).Genetic transformation of mouse embryos by microinjection of purified DNA.Proc Natl Acad Sci U S A,77:7380-7384.

14.Palmiter,RD,et al.(1982).Dramatic growth of mice that develop from eggs microinjected with metallothionein-growth hormone fusion genes.Nature,300:611-615.

15.Capecchi,MR.(2005).Gene targeting in mice:functional analysis of the mammalian genome for the twenty-first century.Nat Rev Genet,6:507-512.

16.Carroll,D.(2014).Genome engineering with targetable nucleases.Annu Rev Biochem,83:409-439.

17.Smithies,O,et al.(1985).Insertion of DNA sequences into the human chromosomal beta-globin locus by homologous recombination.Nature,317:230-234.

18.Thomas,KR and MR Capecchi.(1986).Introduction of homologous DNA sequences into mammalian cells induces mutations in the cognate gene.Nature,324:34-38.

19.Zheng,B,et al.(2000).Engineering mouse chromosomes with Cre-loxP:range,efficiency,and somatic applications.Mol Cell Biol,20:648-655.

20.Wu,S,et al.(2007).Toward simpler and faster genome-wide mutagenesis in mice.Nat Genet,39:922-930.

21.Gupta,A,et al.(2013).Targeted chromosomal deletions and inversions in zebrafish.Genome Res,23:1008-1017.

22.Xiao,A,et al.(2013).Chromosomal deletions and inversions mediated by TALENs and CRISPR/Cas in zebrafish.Nucleic Acids Res,41:e141.

23.Kraft,K,et al.(2015).Deletions,Inversions,Duplications:Engineering of Structural Variants using CRISPR/Cas in Mice.Cell Rep,10:833-839.

24.Wu,S,et al.(2008).A protocol for constructing gene targeting vectors:generating knockout mice for the cadherin family and beyond.Nature Protocol,3:1056-1076.

25.Jinek,M,et al.(2012).A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.Science,337:816-821.

26.Cong,L,et al.(2013).Multiplex genome engineering using CRISPR/Cas systems.Science,339:819-823.

27.Mali,P,et al.(2013).RNA-guided human genome engineering via Cas9.Science,339:823-826.

28.Li,J,et al.(2015).Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.J Mol Cell Biol,7:284-298.

29.Sartori,AA,et al.(2007).Human CtIP promotes DNA end resection.Nature,450:509-514.

30.Anand,R,et al.(2016).Phosphorylated CtIP Functions as a Co-factor of the MRE11-RAD50-NBS1Endonuclease in DNA End Resection.Mol Cell,64:940-950.

31.Li,J,J Shou,and Q Wu.(2015).DNA fragment editing of genomes by CRISPR/Cas9.Hereditas,37:992-1002.

32.Huang,H and Q Wu.(2016).CRISPR Double Cutting through the Labyrinthine Architecture of 3D Genomes.J Genet Genomics,43:273-288.

33.Guo,Y,et al.(2015).CRISPR Inversion of CTCF Sites Alters Genome Topology and Enhancer/Promoter Function.Cell,162:900-910.

34.Lin,ZP,et al.(2014).Triapine disrupts CtIP-mediated homologous recombination repair and sensitizes ovarian cancer cells to PARP and topoisomerase inhibitors.Mol Cancer Res,12:381-393.

while the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.

SEQUENCE LISTING

<110> Shanghai university of transportation

<130> 171283

<160> 24

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA1F

<400> 1

accgattgtt gttgccttgg agtg 24

<210> 2

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA1R

<400> 2

aaaccactcc aaggcaacaa caat 24

<210> 3

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA2F

<400> 3

accgctggtc ccctggtaac ctgg 24

<210> 4

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA2R

<400> 4

aaacccaggt taccagggga ccag 24

<210> 5

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA1F

<400> 5

accggagcag agcagcgggg caa 23

<210> 6

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA1R

<400> 6

aaacttgccc cgctgctctg ctc 23

<210> 7

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA2F

<400> 7

accgttgccc aaagattccc cag 23

<210> 8

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA2R

<400> 8

aaacctgggg aatctttggg caa 23

<210> 9

<211> 21

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA1

<400> 9

gattgttgtt gccttggagt g 21

<210> 10

<211> 21

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA2

<400> 10

gctggtcccc tggtaacctg g 21

<210> 11

<211> 20

<212> DNA

<213> Artificial

<220>

<223> HS51 RE1sgRNA1

<400> 11

gccacacatc caaggctgac 20

<210> 12

<211> 21

<212> DNA

<213> Artificial

<220>

<223> HS51 RE1sgRNA2

<400> 12

gagatttggg gcgtcaggaa g 21

<210> 13

<211> 20

<212> DNA

<213> Artificial

<220>

<223> β-globin locussgRNA1

<400> 13

ggagatggca gtgttgaagc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial

<220>

<223> β-globin locussgRNA2

<400> 14

ctaggggtca gaagtagttc 20

<210> 15

<211> 81

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hSTM-del-aF1

<400> 15

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttg 60

cttagagcca ggactaattg c 81

<210> 16

<211> 85

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hSTM-del-2R

<400> 16

caagcagaag acggcatacg agatagtcaa gtgactggag ttcagacgtg tgctcttccg 60

atctcagctc tgcctgaaag gagtc 85

<210> 17

<211> 77

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hHs51-del-aF

<400> 17

atgatacggc gaccaccgag atctacactc tttccctaca cgacgctctt ccgatctgca 60

aggagatccg tgtcgtc 77

<210> 18

<211> 89

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hHs51-del-bR

<400> 18

caagcagaag acggcatacg agatttgact gtgactggag ttcagacgtg tgctcttccg 60

atcttttttg gctaacaaca tagtgcttc 89

<210> 19

<211> 79

<212> DNA

<213> Artificial

<220>

<223> Hiseq-glob-del-aF2

<400> 19

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgg 60

ttagcggctt gctcaattc 79

<210> 20

<211> 85

<212> DNA

<213> Artificial

<220>

<223> Hiseq-glob-del-bR1

<400> 20

caagcagaag acggcatacg agatatcacg gtgactggag ttcagacgtg tgctcttccg 60

atcttcttca gccatcccaa gactc 85

<210> 21

<211> 22

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP1-1F

<400> 21

gtactacttc tgggtctccc gc 22

<210> 22

<211> 22

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP1-1R

<400> 22

cactacactg caggtgctca cc 22

<210> 23

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP2-1F

<400> 23

catgaatgga gactgtgtga tgg 23

<210> 24

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP2-1R

<400> 24

caaactttca cgtggacgta gag 23

Claims

Use of a CtIP inhibitor for improving the precision of deletion of a fragment ligation linker in editing a genomic DNA fragment when nonhomologous end ligation repair occurs in a cell, wherein the CtIP inhibitor is selected from an inhibitor for inhibiting CtIP phosphorylation or sgRNA for inhibiting CtIP expression, and the editing of the genomic DNA fragment refers to editing with a CRISPR/Cas9 system.
2. The use according to claim 1, wherein the CtIP inhibitor is used to increase the direct ligation rate of the junction junctions after editing of the genomic DNA fragments.
The application of a CtIP inhibitor in preparing a genome DNA fragment editing product, wherein the genome DNA fragment editing product improves the precision of a connecting joint of a deleted fragment, the CtIP inhibitor is selected from an inhibitor for inhibiting CtIP phosphorylation or sgRNA for inhibiting CtIP expression, and the genome DNA fragment editing product is a CRISPR/Cas9 system editing product.
4. The use according to claim 3, wherein the CtIP inhibitor is an effective ingredient for increasing the direct ligation rate of the junction linker after editing the genomic DNA fragment.
5. The use according to claim 3, wherein the CtIP inhibitor is 3-AP.
6. A method for precisely connecting joints after deleting fragments in genome DNA fragment editing is characterized in that when genome editing tools are used for editing genome DNA fragments to be edited, if nonhomologous end connection repair occurs in cells, the method usesCtIPInhibitor pairCtIPAnd (3) performing inhibition, wherein the genome DNA fragment editing tool is CRISPR/Cas9, and the CtIP inhibitor is selected from an inhibitor for inhibiting CtIP phosphorylation or sgRNA for inhibiting CtIP expression.
7. The method of claim 6, wherein the genomic DNA fragment editing tool is used to generate DNA double strand breaks.
8. The method of claim 6, wherein the step of determining the target position is performed by a computerCtIPThe inhibitor is administered to the subject to be edited at the pre-, mid-and post-stages of the subject to be edited undergoing editing of the genomic DNA fragments.
9. The method of claim 8, wherein the subject comprises fungi, plants, and animals.