CN107119077A

CN107119077A - The new application of CtIP inhibitor and a kind of accurately genomic DNA fragment edit methods

Info

Publication number: CN107119077A
Application number: CN201710345545.XA
Authority: CN
Inventors: 吴强; 李金环; 寿佳
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2017-05-16
Filing date: 2017-05-16
Publication date: 2017-09-01
Anticipated expiration: 2037-05-16
Also published as: CN107119077B

Abstract

The invention belongs to biological technical field, and in particular toCtIPThe new application of inhibitor and a kind of accurately genomic DNA fragment edit methods.The present invention suppresses by in-depth study discovery extensivelyCtIPExpression, it is possible to increase the accurate joint efficiency of jointing after genomic DNA fragment editor, improve genomic DNA fragment editor after jointing accurate connection ratio, so as to realize accurately genomic DNA fragment editor.

Description

The new application of CtIP inhibitor and a kind of accurately genomic DNA fragment edit methods

Technical field

The invention belongs to biological technical field, and in particular to the new application of CtIP inhibitor and a kind of accurately genome DNA fragmentation edit methods.

Background technology

Since the Human Genome Project (Human Genome Project) and DNA element encyclopedia The completion of (Encyclopedia of DNA Elements) project, scientists are analyzed and identified in substantial amounts of genome Gene and DNA controlling elements [1,2].The DNA controlling elements played an important role in gene expression regulation include promoter, enhancing Son, silencer and insulator etc..However, checking that the function of most controlling elements is not tested and illustrating [2-8].Visit The function of sok gene and DNA controlling elements, can be studied by science of heredity DNA fragmentation editor.

Gene editing and the gene function modification of early stage is to realize [9-14] by gene transposition and transgenosis.With survey The development of sequence technology, reverse genetics is applied to that genome is carried out specifically to be mutated [15,16].Particularly dependent on homologous The gene targeted mice of restructuring is promptly applied in scientific research [15,17,18].In addition, in mouse and zebra fish DNA The reversion and repetition of fragment are applied to study specific genome structure change [19-24].

In recent years, the short palindrome in II type Regularity interval for coming from bacterium and ancient bacterium repeats system [Clustered regularly interspaced short palindromic repeats(CRISPR)/CRISPR-associated Nuclease 9 (Cas9), CRISPR/Cas9] it is emerging genome editing technique [25-27], because it designs simple and operation It is convenient, promptly it is applied to eukaryotic gene groups editor.We utilize CRISPR/Cas9 systems real in human cell line and mouse DNA fragmentation heredity editor is showed and (has deleted, inverts and repeat) [28].Two are carried out in genome by Cas9 and two sgRNAs Individual site targeted disruption, can realize that the deletion of DNA fragmentation, reversion (are fallen under the repair system effect that the albumen such as CtIP are participated in Position), repeat, transposition and insertion (provided that donor) etc. [29-32].The genetic manipulation of this DNA fragmentation editor, can be used for Study gene expression regulation and the three-dimensional genome structure [28,31-33] of protocadherin and globin.

Specifically, two sgRNAs (Single-guideRNAs, sgRNAs) are designed for mesh DNA fragmentation, SpCas9 (coming from Streptococcus pyogenes) can be in PAM (Protospacer under sgRNAs mediation Adjacent motif) site upstream cuts to DNA double chain, DNA double chain fracture is formed, under cell itself repair system Realize the heredity editor of DNA fragmentation.In DNA fragmentation editor's joint, it has been found that there is a certain proportion of DNA fragmentation essence Quasi- connection (the DNA joints of cutting fracture are directly connected at the PAM upstreams 3bp in site where i.e. two sgRNAs), while also depositing Accurately (junction has the deletion and insertion of base) is not being connected.DNA can be realized by CRISPR/Cas9 systems at present The editor of fragment, but for furtheing investigate the accurate function of specific DNA section, effectively realize the accurate heredity of DNA fragmentation The method that editor includes deleting, inverting (inversion), repetition, transposition and insertion is also to be found.

The content of the invention

In order to overcome the problems of in the prior art, it is an object of the invention to provide the new application of CtIP inhibitor And a kind of accurately genomic DNA fragment edit methods.

To achieve these goals and other related purposes, the present invention is adopted the following technical scheme that：

Purposes of the first aspect of the present invention there is provided CtIP inhibitor in genomic DNA fragment editor.

Preferably, the CtIP inhibitor is used for the rate of precision for improving genomic DNA fragment editor.

Preferably, what the CtIP inhibitor was used to improving jointing after genomic DNA fragment editor is directly connected to rate.

After the genomic DNA fragment editor jointing be directly connected to refer at jointing to delete in the absence of base Remove and insert.

Compared with the raising refers to when not using CtIP inhibitor.

The genomic DNA fragment editor includes but is not limited to：Deletion, reversion or the inversion of genomic DNA fragment, again Multiple, transposition and insertion.

The genomic DNA fragment editor can be internal, can also be external.

The CtIP inhibitor refers to the compound for having inhibition for CtIP.

For CtIP there is inhibition to include but is not limited to：Suppress CtIP activity, suppress CtIP phosphorylation, or suppression Transcription, montage, translation, modification or any type of activity expression of CtIP genes processed.

The CtIP inhibitor can be siRNA, shRNA, sgRNA, antibody, micromolecular compound etc..

Purposes of the second aspect of the present invention there is provided CtIP inhibitor in genomic DNA fragment editor's product is prepared.

Preferably, the CtIP inhibitor as improve genomic DNA fragment editor rate of precision active ingredient.

Preferably, the CtIP inhibitor is directly connected to rate as jointing after genomic DNA fragment editor is improved Active ingredient.

Compared with the raising refers to when not using CtIP inhibitor.

The CtIP inhibitor refers to the compound for having inhibition for CtIP.

The genomic DNA fragment editor product, including the CtIP inhibitor and at least one of effective dose can be to genes Group DNA fragmentation enters the genome edit tool of edlin.

The genomic DNA fragment editor product necessarily includes CtIP inhibitor, and is used as raising base using CtIP inhibitor Because group rate of precision of DNA fragmentation editor or improve genomic DNA fragment editor after jointing be directly connected to rate it is effective into Point.

In the genomic DNA fragment editor product play improve genomic DNA fragment editor after jointing it is accurate The active ingredient of bonding ratio effect can be only CtIP inhibitor, and the chemicals of similar function can be also played comprising other.

The material that genomic DNA fragment editor can be intervened can for siRNA, shRNA, sgRNA, antibody, Micromolecular compound etc..

The present invention does not have special limitation to the genome edit tool, as long as DNA double chain fracture can be produced. For example, the genome edit tool may be selected from but be not restricted to CRISPR/Cas9, CRISPR/Cpf1, CRISPR/C2c1, TELEN, ZFN, I-SceI and the flavor of corresponding gene group edit tool transformation and optimization etc..

In some embodiments of the present invention, illustrate using including the sgRNAs's and Cas9 for target DNA fragment CRISPR/Cas9 systems enter edlin to target DNA fragment.

When using, the CtIP inhibitor and at least one that can concurrently or sequentially give effective dose can be to genes Group DNA fragmentation enters the instrument of edlin.That is, the CtIP inhibitor can be in object receptor gene group DNA fragmentation to be edited The stage applies to object to be edited before, during and after editor.

The mode of the genomic DNA fragment editor includes but is not limited to：Mutation, delete, it is reversion or inversion, repetitions, easy Position and insertion.

The third aspect of the present invention provides a kind of genomic DNA fragment edit methods, and methods described utilizes genome editor When instrument enters edlin to genomic DNA fragment to be edited, CtIP is suppressed using CtIP inhibitor.

The mode for entering edlin to genomic DNA fragment includes but is not limited to：Mutation, delete, reversion or inversion, repetition, Transposition and insertion.

Entering edlin to genomic DNA fragment can be carried out using genomic DNA fragment edit tool of the prior art, example Such as the CRISPR/Cas9 of the sgRNAs and Cas9 for target DNA fragment enumerated in some of the invention embodiments.This Outside, it can also be transformed using CRISPR/Cpf1, CRISPR/C2c1, TELEN, ZFN, I-SceI and corresponding gene group edit tool Flavor of optimization etc. enters edlin to genomic DNA fragment.

Compared with the raising refers to when not using CtIP inhibitor.

The genomic DNA fragment edit methods can be internal, can also be external.

The CtIP inhibitor can before, during and after object receptor gene group DNA fragmentation editor to be edited the stage to waiting to compile Object is collected to apply.

In some embodiments of the present invention, illustrate using including the sgRNAs's and Cas9 for target DNA fragment CRISPR/Cas9 systems enter edlin to target DNA fragment before, in, after apply CtIP inhibitor respectively, can effectively carry For the rate of precision of target DNA fragment editor.Specifically, the essence of jointing after genomic DNA fragment is deleted can be effectively improved Quasi- bonding ratio.

The CtIP inhibitor refers to the compound for having inhibition for CtIP.

For CtIP there is inhibition to include but is not limited to：Suppress CtIP activity, suppress CtIP phosphorylation, or suppression Make transcription, montage, translation, modification or any type of activity expression.

CtIP inhibitor as the embodiment of the present invention 1 is enumerated can be comprising sgRNAs (the SEQ ID for CtIP Shown in NO.5~8) with SpCas9 CRISPR-Cas9 systems.CtIP inhibitor also may be used as described in cited by the embodiment of the present invention 3 Selected from micromolecular compound 3-AP.

Described object can be any species.The object includes prokaryotes, fungi, plant and animal.

For example, described object can be the cell of mammal or the mammal.The cell of the mammal It can be the cell of in vitro mammal.The mammal may be selected from but be not limited to people, mouse, rat, rabbit, monkey, pig, Ox, sheep, dog.Described object can also be agriculture corresponding plants, Mycophyta, mushroom, ganoderma lucidum, fish, cultivation class animal etc..

There is provided the CtIP inhibitor of a kind of genomic DNA fragment editor product, including effective dose for the fourth aspect of the present invention And at least one can enter the instrument of edlin to genomic DNA fragment.

The genomic DNA fragment editor product must include CtIP inhibitor, and be used as raising base using CtIP inhibitor Because group rate of precision of DNA fragmentation editor or improve genomic DNA fragment editor after jointing accurate bonding ratio it is effective into Point.

The instrument that genomic DNA fragment editor can be intervened can for siRNA, shRNA, sgRNA, antibody, Micromolecular compound etc..

When using, the CtIP inhibitor and at least one that can concurrently or sequentially give effective dose can be to genes Group DNA fragmentation enters the instrument of edlin.That is, the CtIP inhibitor can be in object receptor gene group DNA fragmentation to be edited The stage applies to object before, during and after editor.

The genomic DNA fragment editor includes but is not limited to：The mutation of genomic DNA fragment, deletion, reversion are fallen Position, repetition, transposition and insertion.

Base mutation feature when CtIP inhibitor can also change unit point editor, the addition of the mutation including base and Delete.

Compared with prior art, the present invention has the advantages that：

The present invention suppresses CtIP expression, it is possible to increase genomic DNA fragment is deleted by in-depth study discovery extensively Except the accurate joint efficiency of rear jointing, the accurate connection ratio of jointing after genomic DNA fragment editor is improved.This hair It is bright to realize accurately genomic DNA fragment editor, it can preferably study the accurate function of specific DNA section, and this The involved method of invention is more simple, and operation is easy, more efficient.

Brief description of the drawings

Figure 1A：Add the sgRNAs and sgRNAs, the humanization SpCas9 plasmids for STM sites of targeting CtIP genes Common transfection human embryo kidney (HEK) HEK293T cells, the accurate connection result of the deletion fragment jointing in STM sites.

Figure 1B：Add the sgRNAs and the sgRNAs for HS51 sites, humanization SpCas9 matter of targeting CtIP genes The common transfection human embryo kidney (HEK) HEK293T cells of grain, the accurate connection result of the deletion fragment jointing in HS51 sites.

Fig. 1 C：Add the sgRNAs and sgRNAs, Ren Yuan for β-globin locus sites of targeting CtIP genes Change SpCas9 plasmids and transfect human embryo kidney (HEK) HEK293T cells jointly, the deletion fragment jointing in β-globin locus sites Accurate connection result.

Fig. 1 D：Screen CtIP gene knockout situations in 2 obtained CtIP Genetic Mutant Cells systems.

Fig. 1 E：The cell line of CtIP gene knockouts is compared with normal HEK293T cells, and STM sites DNA fragmentation deletes joint Accurate connection.

Fig. 1 F：The cell line of CtIP gene knockouts is compared with normal HEK293T cells, and HS51 sites DNA fragmentation is deleted and connect The accurate connection of head.

Fig. 1 G：The cell line of CtIP gene knockouts is compared with normal HEK293T cells, β-globin locus site DNA Fragment deletes the accurate connection of joint.

Fig. 1 H：In normal HEK293T cells, CtIP-#14 and CtIP-#27 mutational cell lines, 3-AP is to STM sites DNA fragmentation deletes situation about precisely connecting.

Fig. 1 I：In normal HEK293T cells, CtIP-#14 and CtIP-#27 mutational cell lines, 3-AP is to HS51 sites DNA fragmentation deletes situation about precisely connecting.

Embodiment

The present invention suppresses CtIP activity by in-depth study discovery extensively, it is possible to increase genomic DNA fragment is compiled The accurate joint efficiency of jointing after volume, improves the accurate connection ratio of jointing after genomic DNA fragment editor.

CtIP

CtIP, also known as RBBP8, its 22-45 amino acid are the bonding pads with MRN compounds (Mre11-Rad50-Nbs1) Domain, the 650-897 amino acid of it and C-terminal jointly quickly identification and with the effect of be combineding with each other of MRN compounds, be positioned at damaged dna Injury repair process is completed in sequence.

CtIP inhibitor

CtIP is also known as RBBP8, and its 22-45 amino acid is the bonding pad with MRN compounds (Mre11-Rad50-Nbs1) Domain, the 650-897 amino acid of it and C-terminal jointly quickly identification and with the effect of be combineding with each other of MRN compounds, be positioned at damaged dna Injury repair process is completed in sequence.

CtIP inhibitor refers to the compound for having inhibition for CtIP.For CtIP have inhibition include but It is not limited to：Suppress CtIP activity, suppress CtIP phosphorylation, or suppress the transcriptions of CtIP genes, montage, translation, modification or Any type of activity expression.

The CtIP inhibitor includes but is not limited to siRNA, shRNA, sgRNA, antibody, micromolecular compound.

If CtIP inhibitor that the embodiment of the present invention 1 is enumerated can be the CRISPR/Cas9 systems for CtIP genes, The CRISPR/Cas9 systems for CtIP genes include the sgRNAs of targeting CtIP genes (shown in SEQ ID NO.5~8) And the responsible Cas9 nucleases cut to CtIP genes.

The CtIP inhibitor as described in cited by the embodiment of the present invention 3, which can also be, can suppress the small molecule of CtIP activity Compound 3-AP.In addition, micromolecular compound Roscovitine (Rosc) can also suppress CtIP activity.

It is to instigate CtIP activity decreases to suppress CtIP activity.Preferably, before compared to suppression, the reduction of CtIP activity is at least 10%, at least 30%, then good reduction at least 50% are preferably reduced, at least 70% is more preferably reduced, optimal reduction is at least 90%.

The targeting reparation of CtIP participations can be suppressed by suppressing CtIP phosphorylations.

The genetic transcription or expression for suppressing CtIP refer to：CtIP gene is not transcribed, or reduce turn of CtIP gene Record activity, or CtIP gene is not expressed, or reduce the expression activity of CtIP gene.

Those skilled in the art can also use conventional method that CtIP genetic transcriptions or expression is adjusted, such as clpp gene Remove, gene silencing, RNA interfering etc..

The suppression of CtIP genetic transcription or expression can pass through the technical side such as qPCR or RNA-seq and Western Blot Method detection expression quantity checking.

Preferably, compared with wild type, CtIP genetic transcriptions or expression reduction at least 10% are preferably reduced at least 30%, then good reduction at least 50%, at least 70%, and good reduction at least 90% are more preferably reduced, may most preferably CtIP Gene is not expressed completely.

In addition, can also suppress the translation, modification or any type of work of CtIP genes using this area conventional technique Property expression come play suppress CtIP activity effect.

Micromolecular compound

Middle finger of the present invention is made up of several or tens atoms, compound of the molecular mass below 1000.

3-AP (3-aminopyridine-2-carboxaldehyde thiosemicarbazone) is a kind of ribose core Thuja acid reductase micromolecular inhibitor, there is article report, and 3-AP suppresses the base that CtIP is participated in by suppressing CtIP protein phosphorylations Because repairing.

Roscovitine (ROSC) is cell cycle protein dependent kinase (CDK) inhibitor, can be suppressed as CtIP Agent.

Accurately genomic DNA fragment edit methods

The accurate genomic DNA fragment edit methods of the present invention, it is using genome edit tool to gene to be edited When group DNA fragmentation enters edlin, CtIP is suppressed using CtIP inhibitor.

The CtIP inhibitor can receive before, during and after target DNA fragment is deleted the stage to be edited in object to be edited Object is applied.

Described object can be any species.The object includes prokaryotes, fungi, plant and animal.For example, institute The object stated can be the cell of mammal or the mammal.The cell of the mammal can move in vitro lactation The cell of thing.The mammal may be selected from but be not limited to people, mouse, rat, rabbit, monkey, pig, ox, sheep, dog.Described Object can also be agriculture corresponding plants, Mycophyta, mushroom, ganoderma lucidum, fish, cultivation class animal etc..

Genomic DNA fragment editor's product

Genomic DNA fragment editor's product of the present invention, including the CtIP inhibitor and at least one of effective dose can be right Genomic DNA fragment enters the instrument of edlin.

The instrument that genomic DNA fragment editor can be intervened can for siRNA, shRNA, sgRNA, antibody, Micromolecular compound.In some embodiments of the present invention, illustrate using include for target DNA fragment sgRNAs and Cas9 CRISPR/Cas9 systems delete product as genomic DNA fragment, and target DNA fragment is deleted.

When using, the CtIP inhibitor and at least one that can concurrently or sequentially give effective dose can be to genes Group DNA fragmentation enters the instrument of edlin.That is, the CtIP inhibitor can be deleted in object receptor gene group DNA fragmentation and produced The stage applies to object before, during and after product carry out target DNA fragment deletion.

Before the specific embodiment of the invention is further described, it should be appreciated that protection scope of the present invention is not limited to down State specific specific embodiment；It is also understood that the term used in the embodiment of the present invention is specific specific in order to describe Embodiment, the protection domain being not intended to be limiting of the invention.The test method of unreceipted actual conditions in the following example, Generally according to normal condition, or according to the condition proposed by each manufacturer.

When embodiment provides number range, it should be appreciated that except non-invention is otherwise noted, two ends of each number range Any one numerical value can select between point and two end points.Unless otherwise defined, in the present invention all technologies for using and Scientific terminology is identical with the meaning that those skilled in the art of the present technique are generally understood that.Except the specific method used in embodiment, equipment, Outside material, according to those skilled in the art to the grasp of prior art and the record of the present invention, it can also use and this Any method, equipment and the material of the similar or equivalent prior art of method, equipment described in inventive embodiments, material come real The existing present invention.

Unless otherwise indicated, disclosed in this invention experimental method, detection method, preparation method using this technology lead Domain conventional molecular biology, biochemistry, chromatin Structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and The routine techniques of association area.These technologies existing perfect explanation in the prior art, for details, reference can be made to Sambrook etc. MOLECULAR CLONING：A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989and Third edition, 2001；Ausubel etc., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley＆Sons, New York, 1987and periodic updates；the Series METHODS IN ENZYMOLOGY, Academic Press, San Diego；Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998；METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic Press, San Diego, 1999；With METHODS IN MOLECULAR BIOLOGY, Vol.119, Chromatin Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999 etc..

The transfection of embodiment 1 can improve the accurate joint efficiency after DNA fragmentation is deleted for the sgRNAs of CtIP genes 1.STM sites and the sgRNAs plasmid constructions of CtIP genes

(1) primer is bought

From Shanghai Sani bio tech ltd, purchase is directed to STM sites (β-globin RE1) and CtIP genes respectively SgRNAs targetings sequence have 5 ' suspended ends " ACCG " and " AAAC " can be with forward and reverse deoxy-oligonucleotide of complementary pairing.

Forward and reverse deoxy-oligonucleotide：

β-globin RE1sgRNA1F：accgATTGTTGTTGCCTTGGAGTG(SEQ ID NO.1)

β-globin RE1sgRNA1R：aaacCACTCCAAGGCAACAACAAT(SEQ ID NO.2)

β-globin RE1sgRNA2F：accgCTGGTCCCCTGGTAACCTGG(SEQ ID NO.3)

β-globin RE1sgRNA2R：aaacCCAGGTTACCAGGGGACCAG(SEQ ID NO.4)

CtIPsgRNA1F：accgGAGCAGAGCAGCGGGGCAA(SEQ ID NO.5)

CtIPsgRNA1R：aaacTTGCCCCGCTGCTCTGCTC(SEQ ID NO.6)

CtIPsgRNA2F：accgTTGCCCAAAGATTCCCCAG(SEQ ID NO.7)

CtIPsgRNA2R：aaacCTGGGGAATCTTTGGGCAA(SEQ ID NO.8).

(2) double-stranded DNA with suspended end of complementary pairing is obtained

1) ddH is used₂Deoxy-oligonucleotide is dissolved to 100 μM by O, and is diluted to 20 μM；

2) positive and negative deoxy-oligonucleotide is added into following reaction system：

Reaction condition：Then 95 DEG C of water-baths, 5min opens water-bath lid temperature and is down to 60 DEG C or so, close the lid cold But to room temperature.

(3) digestion pGL3-U6-sgRNA-PGK-Puro vector

1) BsaI digestion with restriction enzyme vector plasmids are used, reaction system is as follows：

Reaction condition：37 DEG C, 1.5 hours；

2) glue reclaim purified dnase section section, illustrates purifying according to glue reclaim kit (Axygen).

(4) carrier after connection digestion and the double-stranded DNA with suspended end

Linked system is as follows：

Reaction condition：Room temperature reaction 1.5 hours.

(5) connection product is converted

Connection product is converted with Stbl3 competence, in the antibiotic of benzyl containing ammonia (Amp, 100mg/L) LB plate incubated overnights, 37℃。

(6) picking monoclonal is sequenced

1) from picking single bacterium colony on ammonia benzyl antibiotic LB flat boards, LB (Amp, 100mg/L) Liquid Culture is stayed overnight.

2) plasmid extraction, illustrates extraction according to the small kit (Axygen) of taking out of plasmid.

3) plasmid after extracting serves extra large Sani bio tech ltd sequencing.

(7) successfully plasmid is sequenced to take out in carrying out

1) successful plasmid is sequenced to be converted again with Stbl3 competence, in the LB flat board cultures containing Amp (100mg/L) Night.

2) morning picking single bacterium colony is cultivated 8 hours in 2ml LB (Amp, 100mg/L) fluid nutrient medium, is then transferred to Overnight incubation in 200ml LB (Amp, 100mg/L) fluid nutrient medium.

3) bacterium is collected, illustrates to extract plasmid according to kit (Qiagen) is taken out in plasmid.

2. it is prepared by humanization Cas9 plasmids

1) humanization Cas9 plasmids are built middle laboratory from Peking University's seat and obtained.

2) converted again with Stbl3 competence, in LB flat boards (Amp, 100mg/L) overnight incubation.

3) morning picking single bacterium colony is cultivated 8 hours in 2ml LB (Amp, 100mg/L) fluid nutrient medium, is then transferred to Overnight incubation in 200ml LB (Amp, 100mg/L) fluid nutrient medium, taken out in plasmid.

3. carry out cell transfecting with Lipofectamine 2000

1) HEK293T cell culture, at 37 DEG C, contains 5%CO in blake bottle₂Cultivated in cell culture incubator, treat that it is grown To blake bottle 80~90%.

2) cell grown (is added into 10% hyclone, without blue or green chain in 12 orifice plates with the complete nonreactive culture mediums of DMEM Mycin is dual anti-) carry out bed board, incubated overnight.

3) when the cell length in 12 orifice plates is to 80~90%, by the popularity Cas9 plasmids (800ng), the STM that prepare The sgRNAs plasmids (each 600ng) in site and the sgRNAs plasmids (each 600ng) of CtIP genes pass through Lipofectamine 2000 carry out cell transfecting, each each two repetitions of sample.

4) transfect after two days, collect cell, with genome extracts kit (Genomic DNAPurification kit, Promega) extract genome.

4. prepare high-throughput sequencing library

DNA fragmentation be expected delete joint accurate connection site (3bp of PAM upstreams at Cas9 cut after the direct phase of joint Primer even) is designed at the about 30bp of upstream, primer 5 ' is then held to the sequence measuring joints for adding the Illumina with barcode, Anti-sense primer can design away from splicing site some position and plus Illumina sequence measuring joints, from the biological work of raw work Journey (Shanghai) Co., Ltd. primer synthesizes laggard performing PCR amplification, then using Roche PCR purification kits (Product No.: 11732676001) purified, DNA product is dissolved in after 10mMTris-HCL buffer (PH=8.5), mixed in equal amounts and formed Storehouse, carries out PE150 second generation high-flux sequences.

5. high-flux sequence data processing

After the completion of high-flux sequence, the sequencing result of sample is separated from library by barcode using Linux programs Come, be stored in respective file, then carry out BWA-MEM comparisons, the sequence after comparison passes through Varscan2 programs (V2.3.9) insertion and deletion mutation of analysis DNA fragmentation, Varscan2 program parameters are as follows：

For STM sites, enter performing PCR amplification using high-flux sequence primer pair DNA fragmentation deletion event, carry out high flux The DNA ends connection of sequencing analysis deletion event, counts DNA fragmentation according to sequencing result and does not delete jointing precisely and not Accurate situation.

Research shows, as shown in Figure 1A, is compared with control group, adds the sgRNAs of targeting CtIP genes with being directed to STM SgRNAs, the humanization SpCas9 plasmids in site transfect human embryo kidney (HEK) HEK293T cells jointly, disturb CtIP gene expressions, STM The accurate connection ratio of the deletion fragment jointing in site is significantly improved (to be improved with control group than being precisely connected ratio 25.33%) the accurate joint efficiency, and at jointing is greatly improved (to be improved with control group than accurate joint efficiency 20.29%).

Referring concurrently to the above method, fragment is edited for another HS51RE1 (HS51 site) DNA heredity, as a result such as Shown in Figure 1B, compared with control group, add the sgRNAs and sgRNAs, the humanization for HS51 sites of targeting CtIP genes SpCas9 plasmids transfect human embryo kidney (HEK) HEK293T cells jointly, disturb CtIP gene expressions, the deletion joint connection in HS51 sites Accurately connection ratio is also significantly improved and (improves 12.56% than being precisely connected ratio with control group) at place, and in connection The accurate joint efficiency of joint greatly improves and (improves 10.85% than accurate joint efficiency with control group).

In addition, another β-globin sites (β-globin locus) DNA heredity editor's fragments chosen, as a result as schemed Shown in 1C, compared with control group, add the sgRNAs of targeting CtIP genes with being directed to β-globin locus sites SgRNAs, humanization SpCas9 plasmids transfect human embryo kidney (HEK) HEK293T cells jointly, disturb CtIP gene expressions, β-globin The deletion joint in site accurately connects ratio and is also significantly improved (with control group than being precisely connected ratio raising 12.62%) the accurate joint efficiency, and at jointing is greatly improved (to be improved with control group than accurate joint efficiency 12.71%).

Sequence is targetted for the sgRNAs of above-mentioned different loci：

β-globin RE1sgRNA1：GATTGTTGTTGCCTTGGAGTG(SEQ ID NO.9)

β-globin RE1sgRNA2：GCTGGTCCCCTGGTAACCTGG(SEQ ID NO.10)

HS51RE1sgRNA1：GCCACACATCCAAGGCTGAC(SEQ ID NO.11)

HS51RE1sgRNA2：GAGATTTGGGGCGTCAGGAAG(SEQ ID NO.12)

β-globin locussgRNA1：GGAGATGGCAGTGTTGAAGC(SEQ ID NO.13)

β-globin locussgRNA2：CTAGGGGTCAGAAGTAGTTC(SEQ ID NO.14)

For the high flux primer of above-mentioned different loci：

Hiseq-hSTM-del-aF1:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCTTAGAGCCAGGACTAA TTGC(SEQ ID NO.15)

Hiseq-hSTM-del-2R:

CAAGCAGAAGACGGCATACGAGATAGTCAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGCTCTGCCTGA AAGGAGTC(SEQ ID NO.16)

Hiseq-hHs51-del-aF:

ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAAGGAGATCCGTGTCGTC (SEQ ID NO.17)

Hiseq-hHs51-del-bR:CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTTTTTTGGCTAACAACATAGTGCTTC(SEQ ID NO.18)

Hiseq-glob-del-aF2:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGGTTAGCGGCTTGCTCAAT TC(SEQ ID NO.19)

Hiseq-glob-del-bR1:

CAAGCAGAAGACGGCATACGAGATATCACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTTCAGCCATCC CAAGACTC(SEQ ID NO.20)

In summary, CtIP is to DNA break end in NHEJ (Non-homologous end-joining) system The important auxilin cut, the cell for having transfected targeting CtIP genes sgRNAs disturbs CtIP gene expressions, so that The protein function is inhibited, so that the ability reduction that repairing composite is cut to DNA ends after DNA break.

Targetted by CRISPR/Cas9 systems with two sgRNAs and be responsible for cutting DNA double-strand in cell repair system CtIP genes and two sgRNAs collective effects for target DNA fragment, can effectively improve target DNA fragment and delete joint Locate the ratio and efficiency precisely connected.

CtIP mutation can effectively improve the accurate joint efficiency of target DNA fragment deletion in the cell line of embodiment 2

1. the cell line of CtIP mutation is obtained by CRISPR systems

1) HEK293T cell culture treats its length to blake bottle 80~90%, by the cell grown in 12 holes in blake bottle In plate bed board, incubated overnight are carried out with the complete nonreactive culture mediums of DMEM.When the cell length in 12 orifice plates is to 80~90%, it will make The humanization Cas9 plasmids (800ng) and the sgRNAs plasmids (each 600ng) in CtIP sites got ready are by Lipofectamine 2000 carry out cell transfecting.

2) cell of 48 hours adds Puromycin (2 μ g/ml) and carries out drug screening in four days after transfecting, then fresh Cultivated eight days in culture medium, collect cell, dispersed cell is subjected to cell count, certain amount kind is then diluted to and arrives (per hole only one of which cell) in 96 orifice plates, the orifice plate of only one of which cell mass continues after cultivating 6 days plus nutrient solution is further cultured for 8 My god.

3) collect part cell and screen primer identification of dna part edit situation with CtIP, remaining cell continues to cultivate.

CtIP genescreen primers：

CR-CtIP1-1F：GTACTACTTCTGGGTCTCCCGC(SEQ ID NO.21)

CR-CtIP1-1R：CACTACACTGCAGGTGCTCACC(SEQ ID NO.22)

CR-CtIP2-1F：CATGAATGGAGACTGTGTGATGG(SEQ ID NO.23)

CR-CtIP2-1R：CAAACTTTCACGTGGACGTAGAG(SEQ ID NO.24)

2. CtIP mutational cell line transfections are carried out with Lipofectamine 2000

HEK293T cells and CtIP mutant cell cultures treat that its length, to blake bottle 80~90%, will be grown in blake bottle Cell carry out bed board, incubated overnight with the complete nonreactive culture mediums of DMEM in 12 orifice plates.Treat cell length in 12 orifice plates to 80 When~90%, the sgRNAs plasmids (each 600ng) in the humanization Cas9 plasmids (800ng) prepared and STM sites are passed through Lipofectamine 2000 carries out cell transfecting, each each two repetitions of sample.Two days after transfection, cell is collected, gene is used Group extracts kit (Genomic DNAPurification kit, Promega) extract genome.

3. prepare high-throughput sequencing library

Method is in the same manner as in Example 1.

4. high-flux sequence data processing

Method is in the same manner as in Example 1.

As described above, by transfected Cas9 plasmids and for CtIP genes sgRNAs HEK293T cells carry out Dan Ke Longhua, enters performing PCR by CtIP genescreen primers and screens.In 96 monoclonal cells, screening obtains 2 CtIP clpp genes The cell line removed, i.e. CtIP-#27 and CtIP-#14 (as shown in figure iD).

Next, in the cell line and normal HEK293T cells of the two CtIP gene knockouts, transfection is directed to STM SgRNAs, Cas9 plasmid in site, transfection collect genomic DNA after 48 hours, utilize high-flux sequence primer pair target site Enter performing PCR amplification, build storehouse and carry out high-flux sequence.As a result as referring to figure 1E, the cell line of the two CtIP gene knockouts with just Normal HEK293T cells are compared, and the accurate joint efficiency of STM sites DNA fragmentation deletion joint, which is effectively improved, (to be respectively increased 17.02% and 21.45%), however, influenceing smaller to insertion mutation.

In the cell line and normal HEK293T cells of the two CtIP gene knockouts, transfection is for HS51 sites SgRNAs, Cas9 plasmid, transfection collect genomic DNA after 48 hours, and performing PCR is entered using high-flux sequence primer pair target site Amplification, builds storehouse and carries out high-flux sequence.As a result as shown in fig. 1F, the cell line of the two CtIP gene knockouts with it is normal HEK293T cells are compared, and the accurate joint efficiency of HS51 sites DNA fragmentation deletion joint, which is effectively improved, (is respectively increased 8.63% With 7.83%), however, on insertion mutation influence it is smaller.

In the cell line and normal HEK293T cells of the two CtIP gene knockouts, transfection is directed to β-globin SgRNAs, Cas9 plasmid of point, transfection collect genomic DNA after 48 hours, are entered using high-flux sequence primer pair target site Performing PCR is expanded, and is built storehouse and is carried out high-flux sequence.As a result as shown in Figure 1 G, the cell line of the two CtIP gene knockouts with it is normal HEK293T cells are compared, and the accurate joint efficiency of β-globin sites DNA fragmentation deletion joint, which is effectively improved, (to be respectively increased 12.58% and 13.75%), however, influenceing smaller to insertion mutation.In summary, can be with after CtIP gene mutations in cell line Effectively improve target DNA fragment and delete the efficiency that joint is precisely connected.

The 3-AP of embodiment 3 improves the accurate joint efficiency that DNA fragmentation is deleted

1. carry out cell line transfection with Lipofectamine 2000 in STM sites

HEK293T cells and CtIP mutant cells are subjected to bed board, mistake in 12 orifice plates with the complete nonreactive culture mediums of DMEM Night cultivates.When the cell length in 12 orifice plates is to 80~90%, culture medium is removed, 0.2 μ containing DMSO or various concentrations is added M, 0.4 μM, 0.8 μM, 1.6 μM of 3-AP (SML0568, sigma) the complete nonreactive culture mediums of DMEM, by the humanization prepared Cas9 plasmids (800ng) and for STM sites sgRNAs (each 600ng) pass through Lipofectamine 2000 carry out cell turn Dye.After 24 hours, culture medium is removed, the completely dual anti-culture mediums of DMEM is added and (adds 10% hyclone and 1% mycillin is double It is anti-), after 24 hours, collect cell, with genome extracts kit (Genomic DNAPurification Kit, Promega) extract genome, each each two repetitions of sample.

2. prepare high-throughput sequencing library

Method is in the same manner as in Example 1.

3. high-flux sequence data processing

Method is in the same manner as in Example 1.

3-AP (3-aminopyridine-2-carboxaldehyde thiosemicarbazone) is a kind of ribose core Thuja acid reductase micromolecular inhibitor, there is article report, and 3-AP suppresses the same of CtIP mediations by suppressing CtIP protein phosphorylations Source recombinantal repair [34].

In normal HEK293T cells, CtIP-#14 and CtIP-#27 mutational cell lines, containing DMSO (control) or not Under the conditions of the 3-AP (sigma) of same concentration (0.2 μM, 0.4 μM, 0.8 μM, 1.6 μM) medium culture, transfection Cas9 plasmids and For the sgRNAs plasmids in STM sites, after 24 hours, cell extraction genome is collected.Enter performing PCR with high-flux sequence primer to expand Increase the DNA fragmentation deletion linker fragment for obtaining STM sites, form storehouse after equimolecular quantity mixing, carry out high-flux sequence.As a result such as Shown in Fig. 1 H, for normal HEK293T cells, the accurate of DNA fragmentation deletion can just be improved by adding 0.2~0.8 μM of 3AP Connection ratio；In CtIP-#14 cell lines, with the increase of 3-AP concentration, the accurate connection ratio that DNA fragmentation is deleted is continuous Increase；In CtIP-#27 cell lines, 0.4 μM is increased to 3-AP concentration, the accurate connection ratio that DNA fragmentation is deleted is just not It is further added by；Accurate connection ratio in CtIP-#27 and CtIP-#14 cell lines is above in normal HEK293T cells；This It is to be consistent with experimental result above.In addition, the accurate connection ratio in CtIP-#27 cell lines is higher than CtIP-#14 cells Accurate connection ratio in cell line.In the cell line that CtIP is mutated, DNA fragmentation can just be improved by adding the 3-AP of low concentration The accurate connection ratio deleted.

In normal HEK293T cells, CtIP-#14 and CtIP-#27 mutational cell lines, containing DMSO (control) or not Under the conditions of the 3-AP (sigma) of same concentration (0.2 μM, 0.4 μM, 0.8 μM, 1.6 μM) medium culture, transfection Cas9 plasmids and For the sgRNAs plasmids in HS51 sites, after 24 hours, cell extraction genome is collected.Enter performing PCR with high-flux sequence primer The DNA fragmentation that amplification obtains HS51 sites deletes linker fragment, forms storehouse after equimolecular quantity mixing, carries out high-flux sequence.Knot As shown in Figure 1 I, for normal HEK293T cells, DNA fragmentation deletion can just be improved to fruit by adding 0.2~0.8 μM of 3AP Precisely connect ratio；In CtIP-#14 cell lines, the accurate connection ratio deleted with the increase of 3-AP concentration, DNA fragmentation It is continuously increased；In CtIP-#27 cell lines, 0.4 μM, the accurate connection ratio that DNA fragmentation is deleted are increased to 3-AP concentration Just it is not further added by；Accurate connection ratio in CtIP-#27 and CtIP-#14 cell lines is above in normal HEK293T cells； This is also to be consistent with experimental result above.In addition, the accurate connection ratio in CtIP-#27 cell lines is higher than CtIP-#14 Accurate connection ratio in cell system.In the cell line that CtIP is mutated, DNA can just be improved by adding the 3-AP of low concentration The accurate connection ratio that fragment is deleted.

In summary, 3-AP can significantly improve the accurate connection ratio of target DNA fragment deletion.

The bibliography of the application is as follows：

1.Stamatoyannopoulos,JA.(2012).What does our genome encodeGenome Res,22:1602-1611.

2.The ENCODE Project Consortium.(2012).An integrated encyclopedia of DNA elements in the human genome.Nature,489:57-74.

3.Banerji,J,L Olson,and W Schaffner.(1983).A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes.Cell,33:729-740.

4.Zhang,T,P Haws,and Q Wu.(2004).Multiple variable first exons:a mechanism for cell-and tissue-specific gene regulation.Genome Res,14:79-89.

5.Neph,S,et al.(2012).An expansive human regulatory lexicon encoded in transcription factor footprints.Nature,489:83-90.

6.Shen,Y,et al.(2012).A map of the cis-regulatory sequences in the mouse genome.Nature,488:116-120.

7.Thurman,RE,et al.(2012).The accessible chromatin landscape of the human genome.Nature,489:75-82.

8.de Laat,W and D Duboule.(2013).Topology of mammalian developmental enhancers and their regulatory landscapes.Nature,502:499-506.

9.McClintock,B.(1950).The origin and behavior of mutable loci in maize.Proc Natl Acad Sci U S A,36:344-355.

10.McClintock,B.(1984).The significance of responses of the genome to challenge.Science,226:792-801.

11.Brinster,RL,et al.(1981).Somatic expression of herpes thymidine kinase in mice following injection of a fusion gene into eggs.Cell,27:223- 231.

12.Harbers,K,D Jahner,and R Jaenisch.(1981).Microinjection of cloned retroviral genomes into mouse zygotes:integration and expression in the animal.Nature,293:540-542.

13.Gordon,JW,et al.(1980).Genetic transformation of mouse embryos by microinjection of purified DNA.Proc Natl Acad Sci U S A,77:7380-7384.

14.Palmiter,RD,et al.(1982).Dramatic growth of mice that develop from eggs microinjected with metallothionein-growth hormone fusion genes.Nature, 300:611-615.

15.Capecchi,MR.(2005).Gene targeting in mice:functional analysis of the mammalian genome for the twenty-first century.Nat Rev Genet,6:507-512.

16.Carroll,D.(2014).Genome engineering with targetable nucleases.Annu Rev Biochem,83:409-439.

17.Smithies,O,et al.(1985).Insertion of DNA sequences into the human chromosomal beta-globin locus by homologous recombination.Nature,317:230-234.

18.Thomas,KR and MR Capecchi.(1986).Introduction of homologous DNA sequences into mammalian cells induces mutations in the cognate gene.Nature, 324:34-38.

19.Zheng,B,et al.(2000).Engineering mouse chromosomes with Cre-loxP: range,efficiency,and somatic applications.Mol Cell Biol,20:648-655.

20.Wu,S,et al.(2007).Toward simpler and faster genome-wide mutagenesis in mice.Nat Genet,39:922-930.

21.Gupta,A,et al.(2013).Targeted chromosomal deletions and inversions in zebrafish.Genome Res,23:1008-1017.

22.Xiao,A,et al.(2013).Chromosomal deletions and inversions mediated by TALENs and CRISPR/Cas in zebrafish.Nucleic Acids Res,41:e141.

23.Kraft,K,et al.(2015).Deletions,Inversions,Duplications:Engineering of Structural Variants using CRISPR/Cas in Mice.Cell Rep,10:833-839.

24.Wu,S,et al.(2008).A protocol for constructing gene targeting vectors:generating knockout mice for the cadherin family and beyond.Nature Protocol,3:1056-1076.

25.Jinek,M,et al.(2012).A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.Science,337:816-821.

26.Cong,L,et al.(2013).Multiplex genome engineering using CRISPR/Cas systems.Science,339:819-823.

27.Mali,P,et al.(2013).RNA-guided human genome engineering via Cas9.Science,339:823-826.

28.Li,J,et al.(2015).Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.J Mol Cell Biol,7:284-298.

29.Sartori,AA,et al.(2007).Human CtIP promotes DNA end resection.Nature,450:509-514.

30.Anand,R,et al.(2016).Phosphorylated CtIP Functions as a Co-factor of the MRE11-RAD50-NBS1Endonuclease in DNA End Resection.Mol Cell,64:940-950.

31.Li,J,J Shou,and Q Wu.(2015).DNA fragment editing of genomes by CRISPR/Cas9.Hereditas,37:992-1002.

32.Huang,H and Q Wu.(2016).CRISPR Double Cutting through the Labyrinthine Architecture of 3D Genomes.J Genet Genomics,43:273-288.

33.Guo,Y,et al.(2015).CRISPR Inversion of CTCF Sites Alters Genome Topology and Enhancer/Promoter Function.Cell,162:900-910.

34.Lin,ZP,et al.(2014).Triapine disrupts CtIP-mediated homologous recombination repair and sensitizes ovarian cancer cells to PARP and topoisomerase inhibitors.Mol Cancer Res,12:381-393.

It is described above, only presently preferred embodiments of the present invention, it is not any to the present invention in form and substantial limitation, It should be pointed out that for those skilled in the art, on the premise of the inventive method is not departed from, can also make Some improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art, Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more Dynamic, modification and the equivalent variations developed, are the equivalent embodiment of the present invention；Meanwhile, all substantial technologicals pair according to the present invention The variation, modification and evolution for any equivalent variations that above-described embodiment is made, still fall within the scope of technical scheme It is interior.

SEQUENCE LISTING

<110>Shanghai Communications University

<120>The new application of CtIP inhibitor and a kind of accurately genomic DNA fragment edit methods

<130> 171283

<160> 24

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA1F

<400> 1

accgattgtt gttgccttgg agtg 24

<210> 2

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA1R

<400> 2

aaaccactcc aaggcaacaa caat 24

<210> 3

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA2F

<400> 3

accgctggtc ccctggtaac ctgg 24

<210> 4

<211> 24

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA2R

<400> 4

aaacccaggt taccagggga ccag 24

<210> 5

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA1F

<400> 5

accggagcag agcagcgggg caa 23

<210> 6

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA1R

<400> 6

aaacttgccc cgctgctctg ctc 23

<210> 7

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA2F

<400> 7

accgttgccc aaagattccc cag 23

<210> 8

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CtIPsgRNA2R

<400> 8

aaacctgggg aatctttggg caa 23

<210> 9

<211> 21

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA1

<400> 9

gattgttgtt gccttggagt g 21

<210> 10

<211> 21

<212> DNA

<213> Artificial

<220>

<223> β-globin RE1sgRNA2

<400> 10

gctggtcccc tggtaacctg g 21

<210> 11

<211> 20

<212> DNA

<213> Artificial

<220>

<223> HS51 RE1sgRNA1

<400> 11

gccacacatc caaggctgac 20

<210> 12

<211> 21

<212> DNA

<213> Artificial

<220>

<223> HS51 RE1sgRNA2

<400> 12

gagatttggg gcgtcaggaa g 21

<210> 13

<211> 20

<212> DNA

<213> Artificial

<220>

<223> β-globin locussgRNA1

<400> 13

ggagatggca gtgttgaagc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial

<220>

<223> β-globin locussgRNA2

<400> 14

ctaggggtca gaagtagttc 20

<210> 15

<211> 81

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hSTM-del-aF1

<400> 15

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttg 60

cttagagcca ggactaattg c 81

<210> 16

<211> 85

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hSTM-del-2R

<400> 16

caagcagaag acggcatacg agatagtcaa gtgactggag ttcagacgtg tgctcttccg 60

atctcagctc tgcctgaaag gagtc 85

<210> 17

<211> 77

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hHs51-del-aF

<400> 17

atgatacggc gaccaccgag atctacactc tttccctaca cgacgctctt ccgatctgca 60

aggagatccg tgtcgtc 77

<210> 18

<211> 89

<212> DNA

<213> Artificial

<220>

<223> Hiseq-hHs51-del-bR

<400> 18

caagcagaag acggcatacg agatttgact gtgactggag ttcagacgtg tgctcttccg 60

atcttttttg gctaacaaca tagtgcttc 89

<210> 19

<211> 79

<212> DNA

<213> Artificial

<220>

<223> Hiseq-glob-del-aF2

<400> 19

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgg 60

ttagcggctt gctcaattc 79

<210> 20

<211> 85

<212> DNA

<213> Artificial

<220>

<223> Hiseq-glob-del-bR1

<400> 20

caagcagaag acggcatacg agatatcacg gtgactggag ttcagacgtg tgctcttccg 60

atcttcttca gccatcccaa gactc 85

<210> 21

<211> 22

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP1-1F

<400> 21

gtactacttc tgggtctccc gc 22

<210> 22

<211> 22

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP1-1R

<400> 22

cactacactg caggtgctca cc 22

<210> 23

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP2-1F

<400> 23

catgaatgga gactgtgtga tgg 23

<210> 24

<211> 23

<212> DNA

<213> Artificial

<220>

<223> CR-CtIP2-1R

<400> 24

caaactttca cgtggacgta gag 23

Claims

Purposes of the 1.CtIP inhibitor in genomic DNA fragment editor.
2. purposes according to claim 1, it is characterised in that the CtIP inhibitor is used to improve genomic DNA fragment The rate of precision of editor.
3. purposes according to claim 1, it is characterised in that the CtIP inhibitor is used to improve genomic DNA fragment Jointing is directly connected to rate after editor.
Purposes of the 4.CtIP inhibitor in genomic DNA fragment editor's product is prepared.
5. purposes according to claim 4, it is characterised in that the CtIP inhibitor is used as raising genomic DNA fragment Edit the active ingredient of rate of precision.
6. purposes according to claim 4, it is characterised in that the CtIP inhibitor is used as raising genomic DNA fragment The active ingredient for being directly connected to rate of jointing after editor.
7. the purposes according to any one of claim 1~6, it is characterised in that the CtIP inhibitor can suppress CtIP Activity, suppresses CtIP phosphorylation, or suppress the transcription or expression of CtIP genes.
8. purposes according to claim 7, it is characterised in that the CtIP inhibitor is siRNA, shRNA, sgRNA, anti- Body or micromolecular compound.
9. a kind of genomic DNA fragment edit methods, it is entered using genome edit tool to genomic DNA fragment to be edited During edlin, CtIP is suppressed using CtIP inhibitor.
10. method according to claim 9, it is characterised in that entering the mode of edlin to genomic DNA fragment includes dashing forward Become, delete, invert or inversion, repetition, transposition and insertion.
11. method according to claim 9, it is characterised in that the genomic DNA fragment edit tool is used to produce DNA double chain is broken.
12. method according to claim 9, it is characterised in that the genomic DNA fragment edit tool includes CRISPR/Cas9, CRISPR/Cpf1, CRISPR/C2c1, TELEN, ZFN, I-SceI and the transformation of corresponding gene group edit tool The flavor of optimization.
13. purposes according to claim 9, it is characterised in that the CtIP inhibitor is in object receptor gene to be edited The stage treats edit object administration before, during and after group DNA fragmentation editor.
14. purposes according to claim 9, it is characterised in that the object includes any species.
15. purposes according to claim 9, it is characterised in that the object includes prokaryotes, fungi, plant and moved Thing.
16. a kind of genomic DNA fragment editor product, including the CtIP inhibitor and at least one of effective dose can be to genomes DNA fragmentation enters the instrument of edlin.
17. genomic DNA fragment editor product according to claim 16, it is characterised in that the CtIP inhibitor energy Enough suppress CtIP activity, suppress CtIP phosphorylation, or suppress the transcription or expression of CtIP genes.
18. genomic DNA fragment editor product according to claim 17, it is characterised in that the CtIP inhibitor is SiRNA, shRNA, sgRNA, antibody or micromolecular compound.
19. genomic DNA fragment editor product according to claim 16, it is characterised in that the genomic DNA fragment Edit tool is used to produce DNA double chain fracture.
20. genomic DNA fragment editor product according to claim 16, it is characterised in that the genomic DNA fragment Edit tool includes CRISPR/Cas9, CRISPR/Cpf1, CRISPR/C2c1, TELEN, ZFN, I-SceI and corresponding gene group The flavor of edit tool transformation and optimization.
21. genomic DNA fragment editor product according to claim 16, it is characterised in that CtIP inhibitor can be with Base mutation feature when changing unit point editor, the mutation includes the addition and deletion of base.