CN107091926B - A kind of detection method and detection kit of tetracycline - Google Patents
A kind of detection method and detection kit of tetracycline Download PDFInfo
- Publication number
- CN107091926B CN107091926B CN201710147202.2A CN201710147202A CN107091926B CN 107091926 B CN107091926 B CN 107091926B CN 201710147202 A CN201710147202 A CN 201710147202A CN 107091926 B CN107091926 B CN 107091926B
- Authority
- CN
- China
- Prior art keywords
- sequence
- tetracycline
- detection
- regions
- region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/535—Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Plasma & Fusion (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of detection method of tetracycline and detection kits.Using the aptamer of tetracycline as molecular recognition elements, non-loop-stem structure nucleic acid is designed, when, there are DNA self assembly when tetracycline, can be started, realizing the amplification of detection signal in system, displaces a large amount of nucleic acid sequences for being rich in G base.The G tetramer eventually formed has similar horseradish peroxidase enzyme catalytic activity, can catalysis oxidation TMB-H2O2Detection architecture makes colorless substrate become blue, and tetracycline concentration is positively correlated with blue variation, so as to judge tetracycline concentration in detection architecture.Present invention sensitivity with higher is limited to 10 pM to the detection of tetracycline, and detection has specificity well, and common interference object does not have an impact detection.Detection process is not necessarily to detecting instrument, as a result directly naked eyes as it can be seen that have it is easy to operate, it is low in cost, respond the advantages that rapid, the detection method and detection kit are suitable for being widely popularized in base.
Description
Technical field
The invention belongs to analytical chemistry fields, and in particular to a kind of detection method and detection kit of tetracycline.
Background technique
Tetracycline (Tetracycline) belongs to broad-spectrum antibiotic, is usually used in preventing poultry disease, promotes childhood poultry raw
It is long etc..Food of the long-term consumption containing tetracycline will cause high risks to human health, cause skeleton deformity and growth inhibition,
The normal physiological function for interfering human body, influences the growth and development of Children and teenager, reduces human body to the resistivity of pathogenic bacteria,
And hepatorenal damage can be caused, cause vestibular response, allergic reaction, allergy, drug resistance etc..
Currently, tetracycline residue detection mainly uses microbial method, mass chromatography method and enzyme-linked immunosorbent assay.But micro- life
Usually there is false positive results, Interference Detection judgement in object analytic approach；Mass chromatography method usually requires before carrying out complexity to sample
Processing is related to expensive detecting instrument, cumbersome, and the testing time is long, costly；Although traditional enzyme-linked immunization simplicity,
Quickly, but poor sensitivity, it is difficult to meet the needs of trace detection.
To solve the above problems, the present invention using the aptamer of tetracycline as molecular recognition elements, believes in conjunction with DNA self assembly
Number amplification, realizes super sensitivity detection, in combination with G- tetramer colour developing principle, realizes that detection process is not necessarily to detecting instrument, significantly
Operation is simplified, sensitivity and convenience are improved, is suitable for scene quickly analysis detection tetracycline pollution condition.
Summary of the invention
To solve the deficiencies in the prior art, the present invention is directed to realize that detection signal follows using non-loop-stem structure DNA self assembly
Ring amplification, achievees the purpose that super sensitivity detection tetracycline, and develop relevant detection kit.
The technical solution used in the present invention is:
A kind of detection kit of tetracycline, including colorbuffer system, hemin, DNA hybridization buffer liquid；
The detection kit further includes following nucleic acid sequence:
Sequence A: for the aptamer of tetracycline, nucleotides sequence is classified as 5'-CGTACGGAATTCGCTAGCCCCCCGGC
AGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-3'(SE Q ID NO:1)；
Sequence B: there are 4 regions and 5 regions；Sequence B is complementary with part A, forms A-B double-strand；In the presence of having tetracycline,
A and tetracycline interact, and B is set to change；The B replaced is for starting subsequent DNA self assembly amplification detection signal；
Sequence C: being that the nucleic acid sequence rich in G base will form the G with catalytic activity after hemin is added
Tetramer structure, C have 1 region and 2 regions；
Sequence D: there are 6 regions, 3 regions and 4 regions；
Sequence E: there is the region 2*, the region 3*, the region 4* and the region 5*；
Sequence F: there are 2 regions, 3 regions and 4 regions；
Wherein 1,2,3,4,5 above-mentioned regions respectively with 1*, 2*, 3*, 4*, 5* regional sequence complementary pairing.
Preferably, the base number of sequence B is 18-26, and more preferably 23, too long may cause of base number is difficult to replace
B, too short to may cause background value excessively high.
Preferably, the base number in 1 region is 3-7.
Preferably, the base number in 2 regions is 10-16.
Preferably, the base number in 3 regions is 3-5, and the base number in 4 regions 12-18, the base number in 5 regions is 4-10
It is a.
Preferably, the region 3* in sequence E or the region 5* are the complementary binding site of DNA, and wherein the base number in the region 5* is
4-10, the base number in the region 3* is 4.
Preferably, after sequence C, D and E mixing, 2 regions of sequence C and the region 2* of E are complementary, 3 and 4 regions of D and E's
The region 3* and 4* is complementary, forms C-D-E mixture.
Preferably, the base number in 4 regions 12-18.
Preferably, sequence C includes four groups of GGG sequences, the non-G base in 1-3, interval in each group GGG sequence.
Preferably, detection kit further includes following nucleic acid sequence:
Sequence A:5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCC
CACTGCGCGTGGATCCGAGCTCCACGTG-3'(SEQ ID NO:1)；
Sequence B: 5'-GATCCACGCGCAGTGG-GACCAA-3'(SEQ ID NO:2)；
Sequence C: 5'-GGGTA-GGGCGGGTTGGG-3'(SEQ ID NO:3)；
Sequence D: 5'-CCACATACATCATATT-CCCT-GATCCACGCGCAGTGG-3'(SEQ ID NO:4)；
Sequence E:5'-TTGGTC-CCACTGCGCGTGGATC-AGGG-CCCAACCCGCCC-3'(SEQ ID NO:5)；
Sequence F:5'-GGGCGGGTTGGG-CCCT-GATCCACGCGCAGTGG-3'(SEQ ID NO:6).
Preferably, colorbuffer system is made of colorbuffer, substrate and hydrogen peroxide, including tetramethyl biphenyl
Amine-hydrogen peroxide buffer solution system, o-phenylenediamine-hydrogen peroxide buffer solution system or 2,2- join (the 3- ethyl-benzothiazole-of nitrogen-two
6- sulfonic acid) di-ammonium salts-hydrogen peroxide buffer solution system.
Preferably, hybridization buffer is Tris-HCl buffer, contains 150 mM NaCl and 50 mM KCl.
A kind of detection method of tetracycline, including the following steps:
1) nucleic acid sequence A, B, C, D, E, F are first dissolved respectively with hybridization buffer；The A of 500 nM and the B of 500 nM are mixed
It closes, reacts at room temperature 30 minutes, form A-B mixture；Object to be detected is added, reacts at room temperature 45 minutes, completes displacement reaction；
2) C, D, E of 500 nM is mixed well, and is reacted at room temperature 30 minutes, and C-D-E mixture is formed；By the solution of step 1)
It is added in C-D-E mixture, mixes well, react at room temperature 50 minutes, complete displacement reaction；The F of 500 nM is then added, sufficiently
It mixes, reacts at room temperature 50 minutes, complete displacement reaction；
3) hemin of 0.3 M is added to the solution of step 2, reacts at room temperature 30 minutes；Take out 50 L reaction
Liquid is added in 950 L colorbuffer systems, is reacted at room temperature 15 minutes, and color change is observed；If having four in solution to be measured
When ring element, solution changes color, when not having tetracycline, solution is colourless；
Wherein, nucleic acid sequence A, B, C, D, E, F, hybridization buffer, colorbuffer system is as described in any of the above-described.
The principle of above-mentioned reaction are as follows:
Nucleic acid A is the aptamer of tetracycline, is first hybridized with nucleic acid B, and A-B double-strand is formed.The base number of B is 18-26,
Optimum choice 23, too long may cause of base number is difficult to replace B, and too short to may cause background value excessively high.When there is tetracycline to deposit
When, A and tetracycline interact, and B is set to change.The B replaced is for starting subsequent DNA self assembly amplification detection letter
Number.
Nucleic acid C, D, E are first mixed, and form C-D-E mixture.In E, the region 3* and the region 5* can be used as the knot of subsequent DNA
Chalaza, wherein the base number in the region 5* is 4-10, preferably 6；The base number in the region 3* is 4.It is set to the B changed
It is added in C-D-E mixture, using the region 5* of E as DNA binding site, B can replace D, form C-B-E mixture.This
When E the region 3* be exposed.
Nucleic acid F is added, using the region 3* of E as DNA binding site, F can replace C and B, form E-F mixture.Displacement
The B to get off can enter the circulation of next round again, and finally constantly C is replaced, reaches the mesh of enrichment C amplification detection signal
's.The C replaced is one section of sequence for being rich in G base.After hemin (Hemin) is added, will form has catalysis
Active G tetramer structure.They can catalysis oxidation TMB-H2O2(tetramethyl benzidine-hydrogen peroxide), OPD-H2O2(adjacent benzene two
Amine-hydrogen peroxide) or ABTS-H2O2Detections such as (2,2- connection nitrogen-two (3- ethyl-benzothiazole -6- sulfonic acid) di-ammonium salts-hydrogen peroxide)
System generates color substrate, and as a result naked eyes are as it can be seen that achieve the purpose that detect tetracycline.
The beneficial effects of the present invention are:
The present invention designs non-loop-stem structure DNA, is opened by tetracycline using the aptamer of tetracycline as molecular recognition elements
Dynamic DNA self assembling process, continuous amplification of signal, a large amount of displacements are rich in the nucleic acid sequence of G base, and eventually forming has similar horseradish
The active G- tetramer structure of Catalyzed Synthesis By Peroxidase makes testing result directly naked eyes as it can be seen that without detecting instrument.Entire detection
The design of process uses non-loop-stem structure DNA, reduces nonspecific interference, simplifies operation, observes in conjunction with colour developing, facilitates use
In quickly detection now.
Detailed description of the invention
Fig. 1 is the schematic diagram of detection method of the present invention；
Fig. 2 is the result figure of the tetracycline detection to various concentration；
Fig. 3 is specificity experiments result figure.
Specific embodiment
A kind of detection kit of tetracycline, including colorbuffer system, hemin, DNA hybridization buffer liquid；
The detection kit further includes following nucleic acid sequence:
Sequence A: for the aptamer of tetracycline, nucleotides sequence is classified as 5'-CGTACGGAATTCGCTAGCCCCCCGGC
AGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-3'；
Sequence B: there are 4 regions and 5 regions；Sequence B is complementary with part A, forms A-B double-strand；In the presence of having tetracycline,
A and tetracycline interact, and B is set to change；The B replaced is for starting subsequent DNA self assembly amplification detection signal；
Sequence C: being that the nucleic acid sequence rich in G base will form the G with catalytic activity after hemin is added
Tetramer structure, C have 1 region and 2 regions；
Sequence D: there are 6 regions, 3 regions and 4 regions；
Sequence E: there is the region 2*, the region 3*, the region 4* and the region 5*；
Sequence F: there are 2 regions, 3 regions and 4 regions；
Wherein 1,2,3,4,5 above-mentioned regions respectively with 1*, 2*, 3*, 4*, 5* regional sequence complementary pairing.
Preferably, the base number of sequence B is 18-26, and more preferably 23, too long may cause of base number is difficult to replace
B, too short to may cause background value excessively high.
Preferably, the base number in 1 region is 3-7.
Preferably, the base number in 2 regions is 10-16.
Preferably, the base number in 3 regions is 3-5, and the base number in 4 regions 12-18, the base number in 5 regions is 4-10
It is a.
Preferably, the region 3* in sequence E or the region 5* are the complementary binding site of DNA, and wherein the base number in the region 5* is
4-10, the base number in the region 3* is 4.
Preferably, after sequence C, D and E mixing, 2 regions of sequence C and the region 2* of E are complementary, 3 and 4 regions of D and E's
The region 3* and 4* is complementary, forms C-D-E mixture.
Preferably, the base number in 4 regions 12-18.
Preferably, sequence C includes four groups of GGG sequences, the non-G base in 1-3, interval in each group GGG sequence.
Preferably, detection kit further includes following nucleic acid sequence:
Sequence A:5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCC
CACTGCGCGTGGATCCGAGCTCCACGTG-3'(SEQ ID NO:1)；
Sequence B: 5'-GATCCACGCGCAGTGG-GACCAA-3'(SEQ ID NO:2)；
Sequence C: 5'-GGGTA-GGGCGGGTTGGG-3'(SEQ ID NO:3)；
Sequence D: 5'-CCACATACATCATATT-CCCT-GATCCACGCGCAGTGG-3'(SEQ ID NO:4)；
Sequence E:5'-TTGGTC-CCACTGCGCGTGGATC-AGGG-CCCAACCCGCCC-3'(SEQ ID NO:5)；
Sequence F:5'-GGGCGGGTTGGG-CCCT-GATCCACGCGCAGTGG-3'(SEQ ID NO:6).
Preferably, colorbuffer system is made of colorbuffer, substrate and hydrogen peroxide, including tetramethyl biphenyl
Amine-hydrogen peroxide buffer solution system, o-phenylenediamine-hydrogen peroxide buffer solution system or 2,2- join (the 3- ethyl-benzothiazole-of nitrogen-two
6- sulfonic acid) di-ammonium salts-hydrogen peroxide buffer solution system.
Preferably, hybridization buffer is Tris-HCl buffer, contains 150 mM NaCl and 50 mM KCl.
A kind of detection method of tetracycline, including the following steps:
1) nucleic acid sequence A, B, C, D, E, F are first dissolved respectively with hybridization buffer；The A of 500 nM and the B of 500 nM are mixed
It closes, reacts at room temperature 30 minutes, form A-B mixture；Object to be detected is added, reacts at room temperature 45 minutes, completes displacement reaction；
2) C, D, E of 500 nM is mixed well, and is reacted at room temperature 30 minutes, and C-D-E mixture is formed；By the solution of step 1)
It is added in C-D-E mixture, mixes well, react at room temperature 50 minutes, complete displacement reaction；The F of 500 nM is then added, sufficiently
It mixes, reacts at room temperature 50 minutes, complete displacement reaction；
3) hemin of 0.3 M is added to the solution of step 2, reacts at room temperature 30 minutes；Take out 50 L reaction
Liquid is added in 950 L colorbuffer systems, is reacted at room temperature 15 minutes, and color change is observed；If having four in solution to be measured
When ring element, solution changes color, when not having tetracycline, solution is colourless；
Wherein, nucleic acid sequence A, B, C, D, E, F, hybridization buffer, colorbuffer system is as described in any of the above-described.
The principle (see figure 1) of above-mentioned reaction are as follows:
Nucleic acid A is the aptamer of tetracycline, is first hybridized with nucleic acid B, and A-B double-strand is formed.The base number of B is 18-26,
Optimum choice 23, too long may cause of base number is difficult to replace B, and too short to may cause background value excessively high.When there is tetracycline to deposit
When, A and tetracycline interact, and B is set to change.The B replaced is for starting subsequent DNA self assembly amplification detection letter
Number.
Nucleic acid C, D, E are first mixed, and form C-D-E mixture.In E, the region 3* and the region 5* can be used as the knot of subsequent DNA
Chalaza, wherein the base number in the region 5* is 4-10, preferably 6；The base number in the region 3* is 4.It is set to the B changed
It is added in C-D-E mixture, using the region 5* of E as DNA binding site, B can replace D, form C-B-E mixture.This
When E the region 3* be exposed.
Nucleic acid F is added, using the region 3* of E as DNA binding site, F can replace C and B, form E-F mixture.Displacement
The B to get off can enter the circulation of next round again, and finally constantly C is replaced, reaches the mesh of enrichment C amplification detection signal
's.The C replaced is one section of sequence for being rich in G base.After hemin (Hemin) is added, will form has catalysis
Active G tetramer structure.They can catalysis oxidation TMB-H2O2(tetramethyl benzidine-hydrogen peroxide), OPD-H2O2(adjacent benzene two
Amine-hydrogen peroxide) or ABTS-H2O2Detections such as (2,2- connection nitrogen-two (3- ethyl-benzothiazole -6- sulfonic acid) di-ammonium salts-hydrogen peroxide)
System generates color substrate, and as a result naked eyes are as it can be seen that achieve the purpose that detect tetracycline.
The present invention is further illustrated combined with specific embodiments below, and however, it is not limited to this.
Embodiment 1
A kind of detection method of tetracycline carries out in accordance with the following steps:
(1) first with Tris-HCl buffer (20 mM, pH 7.5 contain 150 mM NaCl and 50 mM KCl) difference
Dissolve nucleic acid A, B, C, D, E, F.The A of 500 nM is mixed with the B of 500 nM, is reacted at room temperature 30 minutes, and A-B mixture is formed.Add
Enter tetracycline detectable substance, react at room temperature 45 minutes, completes displacement reaction, B is replaced.
C, D, E of (2) 500 nM is mixed well, and is reacted at room temperature 30 minutes, and C-D-E mixture is formed.C-D-E is added in B
It in mixture, mixes well, reacts at room temperature 50 minutes, complete displacement reaction.The F of 500 nM is then added, mixes well, room temperature
Displacement reaction is completed in reaction 50 minutes.A large amount of C is set to change.
(3) the hemin(hemin of 0.3 M is added), it reacts at room temperature 30 minutes.50 L reaction solutions are taken out, are added
Into 950 L colorbuffers (contain 26.6 mM citric acids, 51.4 mM disodium hydrogen phosphates, 25 mM KCl's, 10L 0.5%
TMB, the H of 20 L 30%2O2, pH=5.0), it reacts at room temperature 15 minutes, observes color change.When there is tetracycline, solution turned blue,
When not having tetracycline, solution is colourless.
Embodiment 2
A kind of tetracycline detection kit, including following component:
(1) nucleic acid sequence A, B, C, D, E, F.Their sequence is as follows:
A:5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCC
CACTGCGCGTGGATCCGAGCTCCACGTG-3'(SEQ ID NO:1)；
The area B:5'-GATCCACGCGCAGTGG(4) area-GACCAA(5) -3'(SEQ ID NO:2)；
The area C:5'-GGGTA(1) area-GGGCGGGTTGGG(2) -3'(SEQ ID NO:3)；
The area D:5'-CCACATACATCATATT(6) area-CCCT(3) area-GATCCACGCGCAGTGG(4) -3'(SEQ ID
NO:4)；
The area E:5'-TTGGTC(5*) area-CCACTGCGCGTGGATC(4*) area-AGGG(3*)-CCCAACCCGCCC(2*
Area) -3'(SEQ ID NO:5)；
The area F:5'-GGGCGGGTTGGG(2) area-CCCT(3) area-GATCCACGCGCAGTGG(4) -3'(SEQ ID NO:
6).
(2) Tris-HCl buffer contains 150 mM NaCl and 50 mM KCl.
(3) hemin.
(4) colorbuffer system includes to contain 26.6 mM citric acids, 51.4 mM disodium hydrogen phosphates, 25 mM KCl,
The TMB of 10L 0.5%, the H of 20 L 30%2O2, pH=5.0.
Embodiment 3
Detection to various concentration tetracycline:
Tetracycline standard solution is prepared, concentration is respectively 10 pM, 100 pM, 1 nM, 10 nM and 100 nM, and room temperature is protected
It deposits.
The tetracycline of various concentration is added separately in reaction system described in embodiment 1, is sufficiently seen after reaction
Experimental result is examined, as shown in Fig. 2, the tetracycline of 10 pM can produce apparent blue variation, illustrates that its detection is limited to 10 pM.With
Tetracycline concentration increase, color also increases, and gradually tends to be saturated.
Embodiment 4
Specificity experiments:
Prepare 100 nM chaff interferent standard solution, they be respectively Amoxicillin, Ciprofloxacin, clindamycin, streptomysin,
Gentamicin, kanamycins, terramycin and aureomycin.
The disturbance object standard solution of 100 nM and 1 nM tetracycline are added separately to anti-described in embodiment 1
Answer in system, sufficiently reaction after observe color change, as shown in figure 3, the Amoxicillin of 100 nM, Ciprofloxacin, clindamycin,
Streptomysin, gentamicin, kanamycins, terramycin and aureomycin do not generate color change, do not have an impact to detection.Only
Blue can just be generated after tetracycline is added by having, this proves that this method has specificity well to the detection of tetracycline.
Embodiment 5
Rate of recovery experiment:
The tetracycline standard items (100 pM, 1 nM, 10 nM) that various concentration is added in environmental water sample, after mixing well
The method described in embodiment 1 is detected, and concentrations are respectively 98 pM, 0.92 nM, 10.2 nM, corresponding recycling
Rate is respectively 98%, 92% and 102%, and rate of recovery range is 92%-102%, is able to satisfy actual sample detection demand.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Ecological Environment in Guangdong technical research institute
<120>detection method and detection kit of a kind of tetracycline
<130>
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 76
<212> DNA
<213>artificial sequence
<400> 1
cgtacggaat tcgctagccc cccggcaggc cacggcttgg gttggtccca ctgcgcgtgg 60
atccgagctc cacgtg 76
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<400> 2
gatccacgcg cagtgggacc aa 22
<210> 3
<211> 17
<212> DNA
<213>artificial sequence
<400> 3
gggtagggcg ggttggg 17
<210> 4
<211> 36
<212> DNA
<213>artificial sequence
<400> 4
ccacatacat catattccct gatccacgcg cagtgg 36
<210> 5
<211> 38
<212> DNA
<213>artificial sequence
<400> 5
ttggtcccac tgcgcgtgga tcagggccca acccgccc 38
<210> 6
<211> 32
<212> DNA
<213>artificial sequence
<400> 6
gggcgggttg ggccctgatc cacgcgcagt gg 32
Claims (5)
1. a kind of detection kit of tetracycline, including colorbuffer system, hemin, DNA hybridization buffer liquid,
Be characterized in that: the detection kit further includes following nucleic acid sequence:
Sequence A: for the aptamer of tetracycline, nucleotides sequence is classified as 5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGC
CACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-3'；
Sequence B: there are 4 regions and 5 regions；Sequence B is complementary with part A, forms A-B double-strand；In the presence of having tetracycline, A with
Tetracycline interaction, B are set to change；The B replaced is for starting subsequent DNA self assembly amplification detection signal；
Sequence C: being the nucleic acid sequence rich in G base, and after hemin is added, it is poly- to will form the G tetra- with catalytic activity
Body structure, C have 1 region and 2 regions；
Sequence D: there are 6 regions, 3 regions and 4 regions；
Sequence E: there is the region 2*, the region 3*, the region 4* and the region 5*；
Sequence F: there are 2 regions, 3 regions and 4 regions；
Sequence B: 5'-GATCCACGCGCAGTGG-GACCAA-3'；
Sequence C: 5'-GGGTA-GGGCGGGTTGGG-3'；
Sequence D: 5'-CCACATACATCATATT-CCCT-GATCCACGCGCAGTGG-3'；
Sequence E:5'-TTGGTC-CCACTGCGCGTGGATC-AGGG-CCCAACCCGCCC-3'；
Sequence F:5'-GGGCGGGTTGGG-CCCT-GATCCACGCGCAGTGG-3'.
2. detection kit according to claim 1, it is characterised in that: after sequence C, D and E mixing, 2 regions of sequence C
Complementary with the region 2* of E, 3 and 4 regions of D are complementary with the region 3* and 4* of E, form C-D-E mixture.
3. detection kit according to claim 1, it is characterised in that: colorbuffer system is by colorbuffer, bottom
Object and hydrogen peroxide are constituted, including tetramethyl benzidine-hydrogen peroxide buffer solution system, o-phenylenediamine-hydrogen peroxide buffer solution system
Or 2,2- joins nitrogen-two (3- ethyl-benzothiazole -6- sulfonic acid) di-ammonium salts-hydrogen peroxide buffer solution system.
4. detection kit according to claim 1, it is characterised in that: DNA hybridization buffer liquid is Tris-HCl buffer,
Contain 150mM NaCl and 50mM KCl.
5. a kind of detection method of tetracycline, it is characterised in that: include the following steps:
1) nucleic acid sequence A, B, C, D, E, F are first dissolved respectively with DNA hybridization buffer liquid；The A of 500nM is mixed with the B of 500nM,
Room temperature reaction 30 minutes forms A-B mixture；Object to be detected is added, reacts at room temperature 45 minutes, completes displacement reaction；
2) C, D, E that concentration is respectively 500nM are mixed well, is reacted at room temperature 30 minutes, form C-D-E mixture；By step
1) solution is added in C-D-E mixture, mixes well, and reacts at room temperature 50 minutes, completes displacement reaction；500nM is then added
F, mix well, react at room temperature 50 minutes, complete displacement reaction；
3) hemin of 0.3M is added to the solution of step 2), reacts at room temperature 30 minutes；50L reaction solution is taken out, is added
It into 950L colorbuffer system, reacts at room temperature 15 minutes, observes color change；If have tetracycline in solution to be measured,
Solution changes color, when not having tetracycline, solution is colourless；
Wherein, nucleic acid sequence A, B, C, D, E, F, DNA hybridization buffer liquid, any one of colorbuffer system such as Claims 1 to 4
It is described.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710147202.2A CN107091926B (en) | 2017-03-13 | 2017-03-13 | A kind of detection method and detection kit of tetracycline |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710147202.2A CN107091926B (en) | 2017-03-13 | 2017-03-13 | A kind of detection method and detection kit of tetracycline |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107091926A CN107091926A (en) | 2017-08-25 |
| CN107091926B true CN107091926B (en) | 2019-08-27 |
Family
ID=59649329
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710147202.2A Active CN107091926B (en) | 2017-03-13 | 2017-03-13 | A kind of detection method and detection kit of tetracycline |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107091926B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107643401B (en) * | 2017-10-13 | 2019-08-27 | 广东省生态环境技术研究所 | A kind of detection method and detection kit of bisphenol-A |
| CN107884399B (en) * | 2017-11-08 | 2020-04-28 | 北京化工大学 | Purine compound modified nanogold material and kit thereof |
| CN108037089B (en) * | 2017-11-15 | 2018-10-23 | 河海大学 | A kind of method of tetracycline in quick measurement chicken fat |
| CN109060787A (en) * | 2018-08-28 | 2018-12-21 | 福建出入境检验检疫局检验检疫技术中心 | A method of tetracycline antibiotics are detected based on nano enzyme |
| CN109837353A (en) * | 2018-12-05 | 2019-06-04 | 重庆医科大学 | Based on DNA nanometers of autonomous dresses to the method for detection of Salmonella invA genetic test |
| CN111693518B (en) * | 2019-03-14 | 2022-08-05 | 重庆工商大学 | Mercury ion detection method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726572A (en) * | 2015-03-09 | 2015-06-24 | 广东省生态环境与土壤研究所 | Molecule detection method and detection kit based on DNA self-assembly and G tetramers |
| CN104975079A (en) * | 2015-05-28 | 2015-10-14 | 广东省生态环境与土壤研究所 | 17beta-estradiol visualization detection method based on DNA nano-structure, and 17beta-estradiol visualization detection kit based on DNA nano-structure |
| CN105018474A (en) * | 2014-08-22 | 2015-11-04 | 江苏省原子医学研究所 | Probe based on G-quadruplex-chlorine heme DNA enzyme and application of probe |
-
2017
- 2017-03-13 CN CN201710147202.2A patent/CN107091926B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018474A (en) * | 2014-08-22 | 2015-11-04 | 江苏省原子医学研究所 | Probe based on G-quadruplex-chlorine heme DNA enzyme and application of probe |
| CN104726572A (en) * | 2015-03-09 | 2015-06-24 | 广东省生态环境与土壤研究所 | Molecule detection method and detection kit based on DNA self-assembly and G tetramers |
| CN104975079A (en) * | 2015-05-28 | 2015-10-14 | 广东省生态环境与土壤研究所 | 17beta-estradiol visualization detection method based on DNA nano-structure, and 17beta-estradiol visualization detection kit based on DNA nano-structure |
Non-Patent Citations (1)
| Title |
|---|
| Recent trends in SELEX technique and its application to food safety monitoring;Jingjing Wu et al.;《Microchim Acta》;20140129;第181卷;第481页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107091926A (en) | 2017-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107091926B (en) | A kind of detection method and detection kit of tetracycline | |
| Cai et al. | Botulism diagnostics: from clinical symptoms to in vitro assays | |
| Agrawal et al. | Chitinolytic assay of indigenous Trichoderma isolates collected from different geographical locations of Chhattisgarh in Central India | |
| CN106868158B (en) | A kind of detection method and detection kit of salmonella | |
| CN104726572B (en) | A kind of molecular detecting method and detection kit based on DNA self assemblies and the G tetramers | |
| Xu et al. | An aptasensor for staphylococcus aureus based on nicking enzyme amplification reaction and rolling circle amplification | |
| CN101208437A (en) | Biosensors for detecting macromolecules and other analytes | |
| CN107012208A (en) | A kind of label-free lead ion visible detection method and detection kit | |
| Cui et al. | Low-background and visual detection of antibiotic based on target-activated colorimetric split peroxidase DNAzyme coupled with dual nicking enzyme signal amplification | |
| US11898146B2 (en) | Aptamers against Clostridium difficile, compositions comprising aptamers against Clostridium difficile and methods of using the same | |
| CN108676844A (en) | A kind of structure of double enzyme amplification mercury ion biosensors | |
| CN106191042A (en) | Two-way Cycle series signals based on exonuclease III auxiliary amplifies DNA combination probe compositions and preparation method and application | |
| US11104905B2 (en) | Aptamers against Clostridium difficile | |
| CN101886122A (en) | Method for detecting chlamydia pneumoniae by loop-mediated isothermal amplification and detection kit | |
| CN109975542A (en) | A kind of Biomolecule detection kit and biomolecule detecting method | |
| CN110462061A (en) | Detection cascade | |
| Zhang et al. | Long-term N addition accelerated organic carbon mineralization in aggregates by shifting microbial community composition | |
| CN113340863A (en) | Enzyme-free circulating amplification aptamer sensor and preparation method and application thereof | |
| Caruso et al. | New methodological strategies for detecting bacterial indicators | |
| CN108220458A (en) | A kind of deoxyribozyme probe for detecting staphylococcus aureus and its application | |
| CN112697763B (en) | Method for detecting streptomycin based on dye GelRed label-free aptamer sensor and application | |
| Ginés et al. | Nucleic acid lateral flow dipstick assay for the duplex detection of Gambierdiscus australes and Gambierdiscus excentricus | |
| KR102281854B1 (en) | A method and test kit for detecting microorganisms using pcr product | |
| Zhang et al. | A transformer of molecular beacon for sensitive and real-time detection of phosphatases with effective inhibition of the false positive signals | |
| CN111793629B (en) | Aptamer ETA01 of pseudomonas aeruginosa exotoxin A and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: Tianhe District Tianyuan road Guangzhou City, Guangdong province 510650 No. 808 Patentee after: Institute of ecological environment and soil, Guangdong Academy of Sciences Address before: Guangzhou City, Guangdong province 510650 Tianyuan Road No. 808 Patentee before: GUANGDONG INSTITUTE OF ECO-ENVIRONMENTAL SCIENCE & TECHNOLOGY |
|
| CP03 | Change of name, title or address |