CN107091926A - The detection method and detection kit of a kind of tetracycline - Google Patents
The detection method and detection kit of a kind of tetracycline Download PDFInfo
- Publication number
- CN107091926A CN107091926A CN201710147202.2A CN201710147202A CN107091926A CN 107091926 A CN107091926 A CN 107091926A CN 201710147202 A CN201710147202 A CN 201710147202A CN 107091926 A CN107091926 A CN 107091926A
- Authority
- CN
- China
- Prior art keywords
- sequence
- regions
- tetracycline
- detection
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/535—Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
Abstract
The invention discloses a kind of detection method of tetracycline and detection kit.Using the aptamer of tetracycline as molecular recognition elements, non-loop-stem structure nucleic acid is designed, when there is tetracycline in system, DNA self assemblies can be started, the amplification of detection signal is realized, a large amount of nucleotide sequences for being rich in G bases are displaced.The G tetramers eventually formed have similar horseradish peroxidase enzyme catalytic activity, can catalysis oxidation TMB H2O2Detection architecture, makes colorless substrate become au bleu, tetracycline concentration is changing into positive correlation with blueness, so as to judge tetracycline concentration in detection architecture.The present invention has higher sensitivity, and the detection to tetracycline is limited to 10 pM, and detection has specificity well, and common interference thing does not produce influence to detection.Detection process is without detecting instrument, and as a result directly naked eyes are visible, with low cost with simple to operate, the advantages of responding rapid, and the detection method and detection kit are suitable to be widely popularized in basic unit.
Description
Technical field
The invention belongs to analytical chemistry field, and in particular to the detection method and detection kit of a kind of tetracycline.
Background technology
Tetracycline（Tetracycline）Belong to broad-spectrum antibiotic, be usually used in preventing poultry disease, promote the life of childhood poultry
It is long etc..Food of the long-term consumption containing tetracycline will cause high risks to health, cause skeleton deformity and growth inhibition,
The normal physiological function of human body is disturbed, growing for influence Children and teenager reduces resistivity of the human body to pathogenic bacteria,
And hepatorenal damage can be caused, cause vestibular response, allergic reaction, allergy, drug resistance etc..
At present, tetracycline residue detection is main using microbial method, mass chromatography method and enzyme-linked immunosorbent assay.But micro- life
Usually there are false positive results in thing analytic approach, and Interference Detection judges；Mass chromatography method usually requires to carry out before complexity sample
Processing, is related to the detecting instrument of costliness, cumbersome, testing time length, costly；Although traditional ELISA simplicity,
Quickly, but poor sensitivity, it is difficult to meet the demand of trace detection.
To solve the above problems, the present invention is using the aptamer of tetracycline as molecular recognition elements, with reference to DNA self assemblies letter
Number amplification, realizes super sensitivity detection, in combination with G- tetramer colour developing principles, realizes detection process without detecting instrument, significantly
Operation is simplified, sensitivity and convenience is improved, suitable for live quick analysis detection tetracycline pollution condition.
The content of the invention
To solve the deficiencies in the prior art, it is contemplated that realizing that detection signal is followed using non-loop-stem structure DNA self assemblies
Ring amplifies, and reaches the purpose of super sensitivity detection tetracycline, and develops the detection kit of correlation.
The technical solution used in the present invention is：
A kind of detection kit of tetracycline, including colorbuffer system, hemin, DNA hybridization buffer liquid；It is described
Detection kit also includes following nucleic acid sequence：
Sequence A：For the aptamer of tetracycline, its nucleotides sequence is classified as 5'-
CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-
3'（SEQ ID NO：1）；
Sequence B：With 4 regions and 5 regions；Sequence B is complementary with part A, forms A-B double-strands；In the presence of having tetracycline, A with
Tetracycline interacts, and B is set to change；The B replaced is used to start follow-up DNA self assemblies amplification detection signal；
Sequence C：It is the nucleotide sequence rich in G bases, adds after hemin, the G tetra- with catalytic activity can be formed and gathered
Body structure, C has 1 region and 2 regions；
Sequence D：With 6 regions, 3 regions and 4 regions；
Sequence E：With 2* regions, 3* regions, 4* regions and 5* regions；
Sequence F：With 2 regions, 3 regions and 4 regions；
1,2,3,4,5 wherein above-mentioned regions respectively with 1*, 2*, 3*, 4*, 5* regional sequence complementary pairing.
It is preferred that, the base number of sequence B is 18-26, and more preferably 23, base number is long may to be caused to be difficult to replace
B, it is too short background value to be caused too high.
It is preferred that, the base number in 1 region is 3-7.
It is preferred that, the base number in 2 regions is 10-16.
It is preferred that, the base number in 3 regions is 3-5, the base number in 4 regions 12-18, and the base number in 5 regions is 4-10
It is individual.
It is preferred that, 3* regions or 5* regions in sequence E are DNA complementary binding site, and the base number in wherein 5* regions is
4-10, the base number in 3* regions is 4.
It is preferred that, after sequence C, D and E mixing, 2 regions of sequence C and E 2* regional complementarities, D 3 and 4 regions and E's
3* and 4* regional complementarities, form C-D-E mixtures.
It is preferred that, the base number in 4 regions 12-18.
It is preferred that, sequence C, which includes, is spaced 1-3 non-G bases in four groups of GGG sequences, each group GGG sequences.
It is preferred that, detection kit also includes following nucleic acid sequence：
Sequence A:5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCC
CACTGCGCGTGGATCCGAGCTCCACGTG-3'（SEQ ID NO：1）；
Sequence B: 5'-GATCCACGCGCAGTGG-GACCAA-3'（SEQ ID NO：2）；
Sequence C: 5'-GGGTA-GGGCGGGTTGGG-3'（SEQ ID NO：3）；
Sequence D: 5'-CCACATACATCATATT-CCCT-GATCCACGCGCAGTGG-3'（SEQ ID NO：4）；
Sequence E: 5'-TTGGTC-CCACTGCGCGTGGATC-AGGG-CCCAACCCGCCC-3'（SEQ ID NO：5）；
Sequence F: 5'-GGGCGGGTTGGG-CCCT-GATCCACGCGCAGTGG-3'（SEQ ID NO：6）.
It is preferred that, colorbuffer system is made up of colorbuffer, substrate and hydrogen peroxide, including tetramethyl biphenyl
Amine-hydrogen peroxide buffer solution system, o-phenylenediamine-hydrogen peroxide buffer solution system or 2, the 2- connection (3- ethyl-benzothiazoles-of nitrogen-two
6- sulfonic acid) di-ammonium salts-hydrogen peroxide buffer solution system.
It is preferred that, hybridization buffer is Tris-HCl buffer solutions, contains 150 mM NaCl and 50 mM KCl.
A kind of detection method of tetracycline, comprises the following steps：
1) nucleotide sequence A, B, C, D, E, F are first dissolved respectively with hybridization buffer；500 nM A is mixed with 500 nM B, room
Temperature reaction 30 minutes, forms A-B mixtures；Thing to be detected is added, is reacted at room temperature 45 minutes, displacement reaction is completed；
2) 500 nM C, D, E is fully mixed, and is reacted at room temperature 30 minutes, forms C-D-E mixtures；By step 1）Solution add
In C-D-E mixtures, fully mix, react at room temperature 50 minutes, complete displacement reaction；500 nM F is subsequently added, it is fully mixed
It is even, react at room temperature 50 minutes, complete displacement reaction；
3) to step 2）Solution add 0.3 M hemin, react at room temperature 30 minutes；50 L reaction solutions are taken out, plus
Enter into 950 L colorbuffer systems, react at room temperature 15 minutes, observe color change；If having tetracycline in solution to be measured
When, solution changes color, when not having tetracycline, solution is colourless；
Wherein, nucleotide sequence A, B, C, D, E, F, hybridization buffer, colorbuffer system is as described above described in any one.
The principle of above-mentioned reaction is：
Nucleic acid A is the aptamer of tetracycline, is first hybridized with nucleic acid B, forms A-B double-strands.B base number is 18-26, optimization
Selection 23, base number is long may to be caused to be difficult to replace B, too short background value to be caused too high.In the presence of having tetracycline,
A interacts with tetracycline, and B is set to change.The B replaced is used to start follow-up DNA self assemblies amplification detection signal.
Nucleic acid C, D, E are first mixed, and form C-D-E mixtures.In E, 3* regions and 5* regions can as follow-up DNA knot
The base number of chalaza, wherein 5* regions is 4-10, preferably 6；The base number in 3* regions is 4.It is set to the B changed
It is added in C-D-E mixtures, DNA binding site is in the 5* regions using E, and B can replace D, forms C-B-E mixtures.This
When E 3* regions be exposed.
Nucleic acid F is added, DNA binding site is in the 3* regions using E, and F can replace C and B, form E-F mixtures.Displacement
The B got off can enter the circulation of next round again, and finally constantly C is replaced, and reach the mesh of enrichment C amplification detection signals
's.The C replaced is one section of sequence rich in G bases.Add hemin（Hemin）Afterwards, it can be formed with catalysis
The G tetramer structures of activity.They can catalysis oxidation TMB-H2O2（Tetramethyl benzidine-hydrogen peroxide）、OPD-H2O2（Adjacent benzene two
Amine-hydrogen peroxide）Or ABTS-H2O2（2,2- connection nitrogen-two (3- ethyls-benzothiazole -6- sulfonic acid) di-ammonium salts-hydrogen peroxide）Deng detection
System, produces color substrate, and as a result naked eyes are visible, so as to reach the purpose of detection tetracycline.
The beneficial effects of the invention are as follows：
The present invention designs non-loop-stem structure DNA, started by tetracycline using the aptamer of tetracycline as molecular recognition elements
DNA self assembling processes, continuous amplification of signal, a large amount of nucleotide sequences of the displacement rich in G bases are eventually formed with similar horseradish mistake
The G- tetramer structures of oxide enzymatic activity, make testing result directly naked eyes visible, without detecting instrument.Entirely detected
The design of journey uses non-loop-stem structure DNA, reduces nonspecific interference, simplifies operation, with reference to colour developing observation, is conveniently used for
Present quick detection.
Brief description of the drawings
Fig. 1 is the schematic diagram of detection method of the present invention；
Fig. 2 is the result figure of the tetracycline detection to various concentrations；
Fig. 3 is specificity experiments result figure.
Embodiment
A kind of detection kit of tetracycline, including colorbuffer system, hemin, DNA hybridization buffer liquid；
The detection kit also includes following nucleic acid sequence：
Sequence A：For the aptamer of tetracycline, its nucleotides sequence is classified as 5'-
CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-
3'；
Sequence B：With 4 regions and 5 regions；Sequence B is complementary with part A, forms A-B double-strands；In the presence of having tetracycline, A with
Tetracycline interacts, and B is set to change；The B replaced is used to start follow-up DNA self assemblies amplification detection signal；
Sequence C：It is the nucleotide sequence rich in G bases, adds after hemin, the G tetra- with catalytic activity can be formed and gathered
Body structure, C has 1 region and 2 regions；
Sequence D：With 6 regions, 3 regions and 4 regions；
Sequence E：With 2* regions, 3* regions, 4* regions and 5* regions；
Sequence F：With 2 regions, 3 regions and 4 regions；
1,2,3,4,5 wherein above-mentioned regions respectively with 1*, 2*, 3*, 4*, 5* regional sequence complementary pairing.
It is preferred that, the base number of sequence B is 18-26, and more preferably 23, base number is long may to be caused to be difficult to replace
B, it is too short background value to be caused too high.
It is preferred that, the base number in 1 region is 3-7.
It is preferred that, the base number in 2 regions is 10-16.
It is preferred that, the base number in 3 regions is 3-5, the base number in 4 regions 12-18, and the base number in 5 regions is 4-10
It is individual.
It is preferred that, 3* regions or 5* regions in sequence E are DNA complementary binding site, and the base number in wherein 5* regions is
4-10, the base number in 3* regions is 4.
It is preferred that, after sequence C, D and E mixing, 2 regions of sequence C and E 2* regional complementarities, D 3 and 4 regions and E's
3* and 4* regional complementarities, form C-D-E mixtures.
It is preferred that, the base number in 4 regions 12-18.
It is preferred that, sequence C, which includes, is spaced 1-3 non-G bases in four groups of GGG sequences, each group GGG sequences.
It is preferred that, detection kit also includes following nucleic acid sequence：
Sequence A:5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCC
CACTGCGCGTGGATCCGAGCTCCACGTG-3'（SEQ ID NO：1）；
Sequence B: 5'-GATCCACGCGCAGTGG-GACCAA-3'（SEQ ID NO：2）；
Sequence C: 5'-GGGTA-GGGCGGGTTGGG-3'（SEQ ID NO：3）；
Sequence D: 5'-CCACATACATCATATT-CCCT-GATCCACGCGCAGTGG-3'（SEQ ID NO：4）；
Sequence E: 5'-TTGGTC-CCACTGCGCGTGGATC-AGGG-CCCAACCCGCCC-3'（SEQ ID NO：5）；
Sequence F: 5'-GGGCGGGTTGGG-CCCT-GATCCACGCGCAGTGG-3'（SEQ ID NO：6）.
It is preferred that, colorbuffer system is made up of colorbuffer, substrate and hydrogen peroxide, including tetramethyl biphenyl
Amine-hydrogen peroxide buffer solution system, o-phenylenediamine-hydrogen peroxide buffer solution system or 2, the 2- connection (3- ethyl-benzothiazoles-of nitrogen-two
6- sulfonic acid) di-ammonium salts-hydrogen peroxide buffer solution system.
It is preferred that, hybridization buffer is Tris-HCl buffer solutions, contains 150 mM NaCl and 50 mM KCl.
A kind of detection method of tetracycline, comprises the following steps：
1) nucleotide sequence A, B, C, D, E, F are first dissolved respectively with hybridization buffer；500 nM A is mixed with 500 nM B, room
Temperature reaction 30 minutes, forms A-B mixtures；Thing to be detected is added, is reacted at room temperature 45 minutes, displacement reaction is completed；
2) 500 nM C, D, E is fully mixed, and is reacted at room temperature 30 minutes, forms C-D-E mixtures；By step 1）Solution add
In C-D-E mixtures, fully mix, react at room temperature 50 minutes, complete displacement reaction；500 nM F is subsequently added, it is fully mixed
It is even, react at room temperature 50 minutes, complete displacement reaction；
3) to step 2）Solution add 0.3 M hemin, react at room temperature 30 minutes；50 L reaction solutions are taken out, plus
Enter into 950 L colorbuffer systems, react at room temperature 15 minutes, observe color change；If having tetracycline in solution to be measured
When, solution changes color, when not having tetracycline, solution is colourless；
Wherein, nucleotide sequence A, B, C, D, E, F, hybridization buffer, colorbuffer system is as described above described in any one.
The principle of above-mentioned reaction（See Fig. 1）For：
Nucleic acid A is the aptamer of tetracycline, is first hybridized with nucleic acid B, forms A-B double-strands.B base number is 18-26, optimization
Selection 23, base number is long may to be caused to be difficult to replace B, too short background value to be caused too high.In the presence of having tetracycline,
A interacts with tetracycline, and B is set to change.The B replaced is used to start follow-up DNA self assemblies amplification detection signal.
Nucleic acid C, D, E are first mixed, and form C-D-E mixtures.In E, 3* regions and 5* regions can as follow-up DNA knot
The base number of chalaza, wherein 5* regions is 4-10, preferably 6；The base number in 3* regions is 4.It is set to the B changed
It is added in C-D-E mixtures, DNA binding site is in the 5* regions using E, and B can replace D, forms C-B-E mixtures.This
When E 3* regions be exposed.
Nucleic acid F is added, DNA binding site is in the 3* regions using E, and F can replace C and B, form E-F mixtures.Displacement
The B got off can enter the circulation of next round again, and finally constantly C is replaced, and reach the mesh of enrichment C amplification detection signals
's.The C replaced is one section of sequence rich in G bases.Add hemin（Hemin）Afterwards, it can be formed with catalysis
The G tetramer structures of activity.They can catalysis oxidation TMB-H2O2（Tetramethyl benzidine-hydrogen peroxide）、OPD-H2O2（Adjacent benzene two
Amine-hydrogen peroxide）Or ABTS-H2O2（2,2- connection nitrogen-two (3- ethyls-benzothiazole -6- sulfonic acid) di-ammonium salts-hydrogen peroxide）Deng detection
System, produces color substrate, and as a result naked eyes are visible, so as to reach the purpose of detection tetracycline.
With reference to specific embodiment, the present invention is further illustrated, but is not limited thereto.
Embodiment 1
A kind of detection method of tetracycline, is carried out in accordance with the following steps：
（1）First use Tris-HCl buffer solutions（20 mM, pH are 7.5, contain 150 mM NaCl and 50 mM KCl）Dissolve respectively
Nucleic acid A, B, C, D, E, F.500 nM A is mixed with 500 nM B, is reacted at room temperature 30 minutes, forms A-B mixtures.Add four
Ring element detectable substance, is reacted at room temperature 45 minutes, completes displacement reaction, B is replaced.
（2）500 nM C, D, E is fully mixed, and is reacted at room temperature 30 minutes, forms C-D-E mixtures.B is added C-D-E
In mixture, fully mix, react at room temperature 50 minutes, complete displacement reaction.500 nM F is subsequently added, is fully mixed, room temperature
Reaction 50 minutes, completes displacement reaction.Substantial amounts of C is set to change.
（3）Add 0.3 M hemin（Hemin）, react at room temperature 30 minutes.50 L reaction solutions are taken out, are added
Into 950 L colorbuffers（Containing 26.6 mM citric acids, 51.4 mM disodium hydrogen phosphates, 25 mM KCl's, 10L 0.5%
TMB, 20 L 30% H2O2, pH=5.0）, react at room temperature 15 minutes, observe color change.When there is tetracycline, solution turned blue,
When not having tetracycline, solution is colourless.
Embodiment 2
A kind of tetracycline detection kit, including following component：
（1）Nucleotide sequence A, B, C, D, E, F.Their sequence is as follows：
A:5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCC
CACTGCGCGTGGATCCGAGCTCCACGTG-3'（SEQ ID NO：1）；
B: 5'-GATCCACGCGCAGTGG（4th area）-GACCAA（5th area）-3'（SEQ ID NO：2）；
C: 5'-GGGTA（1st area）-GGGCGGGTTGGG（2nd area）-3'（SEQ ID NO：3）；
D: 5'-CCACATACATCATATT（6th area）-CCCT（3rd area）-GATCCACGCGCAGTGG（4th area）-3'（SEQ ID NO：
4）；
E: 5'-TTGGTC（5* areas）-CCACTGCGCGTGGATC（4* areas）-AGGG（3* areas）-CCCAACCCGCCC（2* areas）-
3'（SEQ ID NO：5）；
F: 5'-GGGCGGGTTGGG（2nd area）-CCCT（3rd area）-GATCCACGCGCAGTGG（4th area）-3'（SEQ ID NO：6）.
（2）Tris-HCl buffer solutions, contain 150 mM NaCl and 50 mM KCl.
（3）Hemin.
（4）Colorbuffer system, comprising containing 26.6 mM citric acids, 51.4 mM disodium hydrogen phosphates, 25 mM KCl,
10L 0.5% TMB, 20 L 30% H2O2, pH=5.0.
Embodiment 3
Detection to various concentrations tetracycline：
Tetracycline standard liquid is prepared, concentration is respectively 10 pM, 100 pM, 1 nM, 10 nM and 100 nM, room temperature preservation.
The tetracycline of various concentrations is added separately in the reaction system described in embodiment 1, fully seen after reaction
Experimental result is examined, as shown in Fig. 2 10 pM tetracycline can produce obvious blueness change, illustrates that its detection is limited to 10 pM.With
Tetracycline concentration increase, color also increases, and gradually tends to saturation.
Embodiment 4
Specificity experiments：
100 nM chaff interference standard liquids are prepared, they are that Amoxicillin, Ciprofloxacin, clindamycin, streptomysin, celebrating are big respectively
Mycin, kanamycins, terramycin and aureomycin.
100 nM disturbance thing standard liquid and 1 nM tetracyclines are added separately to anti-described in embodiment 1
Answer in system, fully reaction after observe color change, as shown in figure 3,100 nM Amoxicillin, Ciprofloxacin, clindamycin,
Streptomysin, gentamicin, kanamycins, terramycin and aureomycin do not produce color change, and influence is not produced on detection.Only
Blueness can just be produced after tetracycline is added by having, and this proves that detection of this method to tetracycline has good specificity.
Embodiment 5
The rate of recovery is tested：
The tetracycline standard items of various concentrations are added in environmental water sample（100 pM、1 nM、10 nM）, with real after fully mixing
Apply the method described in example 1 to be detected, concentrations are respectively 98 pM, 0.92 nM, 10.2 nM, the corresponding rate of recovery point
Not Wei 98%, 92% and 102%, rate of recovery scope be 92%-102%, actual sample detection demand can be met.
Above-described embodiment is preferably embodiment, but embodiments of the present invention are not by above-described embodiment of the invention
Limitation, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Ecological Environment in Guangdong technical research institute
<120>The detection method and detection kit of a kind of tetracycline
<130>
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 76
<212> DNA
<213>Artificial sequence
<400> 1
cgtacggaat tcgctagccc cccggcaggc cacggcttgg gttggtccca ctgcgcgtgg 60
atccgagctc cacgtg 76
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<400> 2
gatccacgcg cagtgggacc aa 22
<210> 3
<211> 17
<212> DNA
<213>Artificial sequence
<400> 3
gggtagggcg ggttggg 17
<210> 4
<211> 36
<212> DNA
<213>Artificial sequence
<400> 4
ccacatacat catattccct gatccacgcg cagtgg 36
<210> 5
<211> 38
<212> DNA
<213>Artificial sequence
<400> 5
ttggtcccac tgcgcgtgga tcagggccca acccgccc 38
<210> 6
<211> 32
<212> DNA
<213>Artificial sequence
<400> 6
gggcgggttg ggccctgatc cacgcgcagt gg 32
Claims (10)
1. a kind of detection kit of tetracycline, including colorbuffer system, hemin, DNA hybridization buffer liquid, its
It is characterised by：The detection kit also includes following nucleic acid sequence：
Sequence A：For the aptamer of tetracycline, its nucleotides sequence is classified as 5'-
CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-
3'；
Sequence B：With 4 regions and 5 regions；Sequence B is complementary with part A, forms A-B double-strands；In the presence of having tetracycline, A with
Tetracycline interacts, and B is set to change；The B replaced is used to start follow-up DNA self assemblies amplification detection signal；
Sequence C：It is the nucleotide sequence rich in G bases, adds after hemin, the G tetra- with catalytic activity can be formed and gathered
Body structure, C has 1 region and 2 regions；
Sequence D：With 6 regions, 3 regions and 4 regions；
Sequence E：With 2* regions, 3* regions, 4* regions and 5* regions；
Sequence F：With 2 regions, 3 regions and 4 regions；
1,2,3,4,5 wherein above-mentioned regions respectively with 1*, 2*, 3*, 4*, 5* regional sequence complementary pairing.
2. detection kit according to claim 1, it is characterised in that：The base number of sequence B is 18-26.
3. detection kit according to claim 1, it is characterised in that：The base number in 1 region is 3-7, the alkali in 2 regions
Radix is 10-16.
4. detection kit according to claim 1, it is characterised in that：The base number in 3 regions is 3-5, the alkali in 4 regions
Radix 12-18, the base number in 5 regions is 4-10.
5. detection kit according to claim 1, it is characterised in that：After sequence C, D and E mixing, 2 regions of sequence C
With E 2* regional complementarities, D 3 and 4 regions and E 3* and 4* regional complementarities form C-D-E mixtures.
6. detection kit according to claim 1, it is characterised in that：Sequence C includes four groups of GGG sequences, each group GGG
1-3 non-G bases are spaced in sequence.
7. detection kit according to claim 1, it is characterised in that：Detection kit also includes following nucleic acid sequence：
Sequence A:5'-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCC
CACTGCGCGTGGATCCGAGCTCCACGTG-3'；
Sequence B: 5'-GATCCACGCGCAGTGG-GACCAA-3'；
Sequence C: 5'-GGGTA-GGGCGGGTTGGG-3'；
Sequence D: 5'-CCACATACATCATATT-CCCT-GATCCACGCGCAGTGG-3'；
Sequence E: 5'-TTGGTC-CCACTGCGCGTGGATC-AGGG-CCCAACCCGCCC-3'；
Sequence F: 5'-GGGCGGGTTGGG-CCCT-GATCCACGCGCAGTGG-3'.
8. detection kit according to claim 1, it is characterised in that：Colorbuffer system is by colorbuffer, bottom
Thing and hydrogen peroxide are constituted, including tetramethyl benzidine-hydrogen peroxide buffer solution system, o-phenylenediamine-hydrogen peroxide buffer solution system
Or 2,2- connection nitrogen-two (3- ethyls-benzothiazole -6- sulfonic acid) di-ammonium salts-hydrogen peroxide buffer solution system.
9. detection kit according to claim 1, it is characterised in that：Hybridization buffer is Tris-HCl buffer solutions, is contained
There are 150 mM NaCl and 50 mM KCl.
10. a kind of detection method of tetracycline, it is characterised in that：Comprise the following steps：
1) nucleotide sequence A, B, C, D, E, F are first dissolved respectively with hybridization buffer；500 nM A is mixed with 500 nM B, room
Temperature reaction 30 minutes, forms A-B mixtures；Thing to be detected is added, is reacted at room temperature 45 minutes, displacement reaction is completed；
2) 500 nM C, D, E is fully mixed, and is reacted at room temperature 30 minutes, forms C-D-E mixtures；By step 1）Solution add
In C-D-E mixtures, fully mix, react at room temperature 50 minutes, complete displacement reaction；500 nM F is subsequently added, it is fully mixed
It is even, react at room temperature 50 minutes, complete displacement reaction；
3) to step 2）Solution add 0.3 M hemin, react at room temperature 30 minutes；50 L reaction solutions are taken out, plus
Enter into 950 L colorbuffer systems, react at room temperature 15 minutes, observe color change；If having tetracycline in solution to be measured
When, solution changes color, when not having tetracycline, solution is colourless；
Wherein, nucleotide sequence A, B, C, D, E, F, hybridization buffer, colorbuffer system such as any one of claim 1-9 institutes
State.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710147202.2A CN107091926B (en) | 2017-03-13 | 2017-03-13 | A kind of detection method and detection kit of tetracycline |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710147202.2A CN107091926B (en) | 2017-03-13 | 2017-03-13 | A kind of detection method and detection kit of tetracycline |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107091926A true CN107091926A (en) | 2017-08-25 |
| CN107091926B CN107091926B (en) | 2019-08-27 |
Family
ID=59649329
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710147202.2A Active CN107091926B (en) | 2017-03-13 | 2017-03-13 | A kind of detection method and detection kit of tetracycline |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107091926B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107643401A (en) * | 2017-10-13 | 2018-01-30 | 广东省生态环境技术研究所 | The detection method and detection kit of a kind of bisphenol-A |
| CN107884399A (en) * | 2017-11-08 | 2018-04-06 | 北京化工大学 | For detecting the purine compound modified nano gold material of red blood cell, preparation method and kit |
| CN108037089A (en) * | 2017-11-15 | 2018-05-15 | 河海大学 | A kind of method of tetracycline in quick measure chicken fat |
| CN109060787A (en) * | 2018-08-28 | 2018-12-21 | 福建出入境检验检疫局检验检疫技术中心 | A method of tetracycline antibiotics are detected based on nano enzyme |
| CN109837353A (en) * | 2018-12-05 | 2019-06-04 | 重庆医科大学 | Based on DNA nanometers of autonomous dresses to the method for detection of Salmonella invA genetic test |
| CN111693518A (en) * | 2019-03-14 | 2020-09-22 | 重庆工商大学 | Mercury ion detection method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726572A (en) * | 2015-03-09 | 2015-06-24 | 广东省生态环境与土壤研究所 | Molecule detection method and detection kit based on DNA self-assembly and G tetramers |
| CN104975079A (en) * | 2015-05-28 | 2015-10-14 | 广东省生态环境与土壤研究所 | 17beta-estradiol visualization detection method based on DNA nano-structure, and 17beta-estradiol visualization detection kit based on DNA nano-structure |
| CN105018474A (en) * | 2014-08-22 | 2015-11-04 | 江苏省原子医学研究所 | Probe based on G-quadruplex-chlorine heme DNA enzyme and application of probe |
-
2017
- 2017-03-13 CN CN201710147202.2A patent/CN107091926B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018474A (en) * | 2014-08-22 | 2015-11-04 | 江苏省原子医学研究所 | Probe based on G-quadruplex-chlorine heme DNA enzyme and application of probe |
| CN104726572A (en) * | 2015-03-09 | 2015-06-24 | 广东省生态环境与土壤研究所 | Molecule detection method and detection kit based on DNA self-assembly and G tetramers |
| CN104975079A (en) * | 2015-05-28 | 2015-10-14 | 广东省生态环境与土壤研究所 | 17beta-estradiol visualization detection method based on DNA nano-structure, and 17beta-estradiol visualization detection kit based on DNA nano-structure |
Non-Patent Citations (1)
| Title |
|---|
| JINGJING WU ET AL.: "Recent trends in SELEX technique and its application to food safety monitoring", 《MICROCHIM ACTA》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107643401A (en) * | 2017-10-13 | 2018-01-30 | 广东省生态环境技术研究所 | The detection method and detection kit of a kind of bisphenol-A |
| CN107884399A (en) * | 2017-11-08 | 2018-04-06 | 北京化工大学 | For detecting the purine compound modified nano gold material of red blood cell, preparation method and kit |
| CN107884399B (en) * | 2017-11-08 | 2020-04-28 | 北京化工大学 | Purine compound modified nanogold material and kit thereof |
| CN108037089A (en) * | 2017-11-15 | 2018-05-15 | 河海大学 | A kind of method of tetracycline in quick measure chicken fat |
| CN108037089B (en) * | 2017-11-15 | 2018-10-23 | 河海大学 | A kind of method of tetracycline in quick measurement chicken fat |
| CN109060787A (en) * | 2018-08-28 | 2018-12-21 | 福建出入境检验检疫局检验检疫技术中心 | A method of tetracycline antibiotics are detected based on nano enzyme |
| CN109837353A (en) * | 2018-12-05 | 2019-06-04 | 重庆医科大学 | Based on DNA nanometers of autonomous dresses to the method for detection of Salmonella invA genetic test |
| CN111693518A (en) * | 2019-03-14 | 2020-09-22 | 重庆工商大学 | Mercury ion detection method |
| CN111693518B (en) * | 2019-03-14 | 2022-08-05 | 重庆工商大学 | Mercury ion detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107091926B (en) | 2019-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107091926A (en) | The detection method and detection kit of a kind of tetracycline | |
| Lau et al. | Roles of bacterial community composition in biofilms as a mediator for larval settlement of three marine invertebrates | |
| Yemini et al. | Specific electrochemical phage sensing for Bacillus cereus and Mycobacterium smegmatis | |
| CN106868158B (en) | A kind of detection method and detection kit of salmonella | |
| CN107012208A (en) | A kind of label-free lead ion visible detection method and detection kit | |
| Engelen et al. | Monitoring impact of a pesticide treatment on bacterial soil communities by metabolic and genetic fingerprinting in addition to conventional testing procedures | |
| Zhang et al. | Mechanisms of soil acidification reducing bacterial diversity | |
| Li et al. | Investigation of 3, 3′, 5, 5′-tetramethylbenzidine as colorimetric substrate for a peroxidatic DNAzyme | |
| CN104726572B (en) | A kind of molecular detecting method and detection kit based on DNA self assemblies and the G tetramers | |
| CN101208437A (en) | Biosensors for detecting macromolecules and other analytes | |
| Hakami et al. | Gaining ground: assays for therapeutics against botulinum neurotoxin | |
| CN108676844A (en) | A kind of structure of double enzyme amplification mercury ion biosensors | |
| CN106987653A (en) | A kind of phytophthora infestans LAMP detection primer and its visible detection method | |
| WO2011156007A9 (en) | Rt-lamp assay for the detection of pan-serotype dengue virus | |
| US5330889A (en) | Process and medium for identification of bacteria of the listeria genus | |
| CN103215357B (en) | High throughput test method for tomato bacterial disease by locking-type probe | |
| CN107603981A (en) | Detect the enzyme-linked aptamer of blood coagulation and detection method of aflatoxin B1 | |
| Onohuean et al. | Antibiogram signatures of Vibrio species recovered from surface waters in South Western districts of Uganda: Implications for environmental pollution and infection control | |
| DE60122582T2 (en) | PROCESS FOR DETECTING LISTERIA MONOCYTOGENES | |
| CN110205394A (en) | It is a kind of for detecting the biosensor and method of salmonella | |
| Li et al. | A Simple Colorimetric Au‐on‐Au Tip Sensor with a New Functional Nucleic Acid Probe for Food‐borne Pathogen Salmonella typhimurium | |
| CN109666765A (en) | A kind of kit of quick diagnosis H1N1 influenza virus | |
| CN109975542A (en) | A kind of Biomolecule detection kit and biomolecule detecting method | |
| CN101233244A (en) | Improved methods of detecting viability-associated molecules | |
| Zhang et al. | Long-term N addition accelerated organic carbon mineralization in aggregates by shifting microbial community composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: Tianhe District Tianyuan road Guangzhou City, Guangdong province 510650 No. 808 Patentee after: Institute of ecological environment and soil, Guangdong Academy of Sciences Address before: Guangzhou City, Guangdong province 510650 Tianyuan Road No. 808 Patentee before: GUANGDONG INSTITUTE OF ECO-ENVIRONMENTAL SCIENCE & TECHNOLOGY |
|
| CP03 | Change of name, title or address |