CN107083356A - The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts - Google Patents

The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts Download PDF

Info

Publication number
CN107083356A
CN107083356A CN201710442901.XA CN201710442901A CN107083356A CN 107083356 A CN107083356 A CN 107083356A CN 201710442901 A CN201710442901 A CN 201710442901A CN 107083356 A CN107083356 A CN 107083356A
Authority
CN
China
Prior art keywords
embryo fibroblasts
duck embryo
duck
hydrogen peroxide
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710442901.XA
Other languages
Chinese (zh)
Inventor
汪铭书
徐洋
程安春
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Agricultural University
Original Assignee
Sichuan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Agricultural University filed Critical Sichuan Agricultural University
Priority to CN201710442901.XA priority Critical patent/CN107083356A/en
Publication of CN107083356A publication Critical patent/CN107083356A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0656—Adult fibroblasts
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Reproductive Health (AREA)
  • Developmental Biology & Embryology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Rheumatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to the application that a kind of hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts, after final concentration of 400 μM of hydrogen peroxide treatment duck embryo fibroblasts, DAPI dyeing observes that nucleus reduces, torsional deformation, caryoplasm is gathered in nuclear membrane edge and apoptotic body occurs, fluorescent quantitation RT PCR and Caspase activity detection kits detect antiapoptotic factors Caspase 3 in the cell after processing, Caspase 9 mRNA level in-site and protein active is raised, show that this method can successfully obtain duck embryo fibroblasts Apoptosis Model, the method operation of the present invention is easy, cost is relatively low, the foundation of this method can help the structure of researcher's completion duck embryo fibroblasts Apoptosis Model, model basis is established in research to carry out Apoptosis inhibitor in duck embryo fibroblasts, it is significant.

Description

Hydrogen peroxide sets up duck embryo fibroblasts apoptosis mould in induction duck embryo fibroblasts Application in type
Technical field
The invention belongs to biological field, it is related to hydrogen peroxide and sets up duck embryo fibroblasts in induction duck embryo fibroblasts Application in Apoptosis Model.
Background technology
Duck plague is commonly called as infection with swollen head, also known as duck viral enteritis (Duck virus enteritis, DEV), is duck, goose, day A kind of acute, high mortal viral disease that goose etc. often suffers from.The disease is characterized in popular extensive, propagates rapid, the incidence of disease and death Rate is all high.This disease is found first in Holland early in nineteen twenty-three BaudetShi, until BosShi in 1940 proposes the name of duck plague first Claim, there is this pathogenetic report in various countries of Europe, the United States later.Duck plague is to exist Huang Yinxian nineteen fifty-sevens in the popular formal report of China What Guangdong was proposed first, the ground such as subsequent Wuhan, Shanghai, Zhejiang, Jiangsu, Guangxi, Hunan and Fujian is found successively, is passed to the eighties It is multicast to northeast each province.Since nineteen fifty-seven, this disease is widely current in China south China, Central China, East China duck culturing industry comparatively developed regions, causes Very big economic loss.
After virus infected cell, cell is the duplication and propagation for resisting virus, independently occurs apoptosis.But herpesviral It is to be conducive to the copy propagation of itself in initial infection, its some gene plays the death that Anti-G value postpones infection cell, Advantage is provided for self-reproduction.The generation of a large amount of infectious progeny viruses causes infected cell dead, ultimately results in machine Body is damaged, and its characteristic, which becomes, turns to injury of blood vessel, and tissue bleeding, body cavity hemorrhage, alimentary canal mucous membrane has bleeding, necrotic lesion, drenches Bar impaired organ, and the degeneration of organa parenchymatosum change.Therefore, to the research of herpesviral anti-apoptotic functional gene not Only be conducive to further exploring latent infection, duplication and the mechanism of transmission of herpesviral, and can be the antiviral sense of exploitation The screening for contaminating medicine provides platform.At present structure Apoptosis Model is mainly taken for the research with anti-apoptotic functional gene Mode.It is that model base is established in the research of scientific research personnel's development Apoptosis inhibitor it would therefore be highly desirable to need to set up duck model of cell apoptosis Plinth.
The content of the invention
In view of this, an object of the present invention is that provide a kind of hydrogen peroxide sets up in induction duck embryo fibroblasts Application in duck embryo fibroblasts Apoptosis Model；The second object of the present invention be provide using hydrogen peroxide-induced duck embryos into The method that fibrocyte sets up duck embryo fibroblasts Apoptosis Model；The third object of the present invention is to provide by above method system The duck embryo fibroblasts Apoptosis Model obtained；The fourth object of the present invention is to provide duck embryo fibroblasts Apoptosis Model thin Application in the experiment of born of the same parents' Apoptosis inhibitor.
To reach above-mentioned purpose, the present invention provides following technical scheme：
1st, the application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts.
2nd, the method that duck embryo fibroblasts Apoptosis Model is set up using hydrogen peroxide-induced duck embryo fibroblasts, it is special Levy and be：Use final concentration of 400 μM of hydrogen peroxide treatment duck embryo fibroblasts.
It is preferred that, the time of the processing is 12 hours.
It is furthermore preferred that the condition of the processing is 37 DEG C, the CO of volume fraction 5%212h is cultivated in incubator.
In the present invention, the duck embryo fibroblasts of culture are added the MEM nutrient solutions containing NBCS and adjusted by before processing Cell concentration, and in 37 DEG C, the CO of volume fraction 5%2Overnight incubation in incubator, the volume fraction of the NBCS is 10%.
It is preferred that, the duck embryo fibroblasts of the culture are made by following methods：The healthy duck embryos of 9~11 ages in days are taken, are used Scissors fully shreds idiosome as 0.5~1mm3Fritter, then with the PBS cyclic washing 2 equivalent to 5 times of volumes of idiosome ~3 times limpid to suspension, and it is 2% tryptose then to move into centrifuge tube and add mass fraction immediately the tissue block after washing , there is floccule after 4000r/min centrifugation 5min, supernatant discarding under the conditions of being subsequently placed in 37 DEG C to tissue block edge in enzyme solutions Liquid, add the complete culture solution containing NBCS, penicillin and streptomysin, the NBCS volume fraction be 10%, The penicillin mass fraction is 1~2% and the streptomysin mass fraction is 1-2% streptomysins, and piping and druming makes the tissue of precipitation Cell is resuspended in nutrient solution, by cell suspension with eight layers of filtered through gauze impurity elimination, is dispensed into 6 porocyte plates, is put by every hole 2mL It is 5%CO in 37 DEG C, containing volume fraction2Cell culture incubator in quiescent culture to cell confluency degree 80%.
3rd, the duck embryo fibroblasts Apoptosis Model as made from methods described.
4th, application of the duck embryo fibroblasts Apoptosis Model in Apoptosis Inhibition test.
The beneficial effects of the present invention are：Hydrogen peroxide is set up duck embryo fibroblasts in induction duck embryo fibroblasts and withered The application in model is died, by using 400 μM of hydrogen peroxide-induced duck embryo fibroblasts, compared with prior art, The present invention uses duck embryo fibroblasts as the modeling cell of hydrogen peroxide-induced model of cell apoptosis first.It is thin by investigating Karyon form, intracellular Caspase 3/9 transcriptional level, Caspase3/7 and Caspase 9 protein activity level are determined Hydrogen peroxide causes the effect of duck embryo fibroblasts apoptosis, and operation is easy, and cost is relatively low.The foundation of this method can help to study Personnel complete the structure of duck embryo fibroblasts Apoptosis Model, while can be the development Apoptosis inhibitor in duck embryo fibroblasts Model basis is established in research, significant.
Brief description of the drawings
In order that the purpose of the present invention, technical scheme and beneficial effect are clearer, the present invention provides drawings described below and carried out Explanation：
Fig. 1 is karyomorphism observation result (A：Influence of the hydrogen peroxide treatment to karyomorphism；B：Normal cell is thin Karyon form；C：Influence of the mitomycin C processing to karyomorphism；D：Influence of the ultraviolet processing to cellular morphology).
Fig. 2 is influence (A of the hydrogen peroxide treatment to apoptosis factor transcriptional level：Apoptosis factor caspase3； B：Apoptosis factor caspase9).
Fig. 3 is influence (A of the hydrogen peroxide treatment to apoptosis factor caspase3/7 protein activity levels： Caspase3/7 albumen；B：Caspase9 albumen).
Fig. 4 is the influence of Apoptosis caused by duck plague virus US5 gene pairs hydrogen peroxide.
Embodiment
Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are described in detail.
The method for building up of embodiment 1, duck embryo fibroblasts Apoptosis Model
The method for building up of duck embryo fibroblasts Apoptosis Model, comprises the following steps：
(1) cell culture
The well-developed healthy duck embryos of 9-11 ages in days are taken, air chamber is placed in incubator tray upwards, with G418 thimerosals to its air chamber End is carried out disinfection, and the eggshell at air chamber end is peeled off with disinfecting forceps, takes out duck embryos, is placed on sterilization plate, removes head, wing, pawl 2-3 times is rinsed to remove remained blood and blastochyle with being placed in after internal organ in another plates for filling 37 DEG C of preheating PBSs.Inhale PBS unnecessary in plate is removed, is fully shredded idiosome as 0.5-1mm with scissors3Fritter, then with the PBS of 5 times of volumes Buffer solution cyclic washing 2-3 times is limpid to suspension.Tissue block after washing is moved into 10mL centrifuge tubes and 2% pancreas is added immediately Protein enzyme solution, is subsequently placed in thermostat water bath (37 DEG C), is put into after abundant mixing floccule occurs to tissue block edge super Fast centrifuge, 4,000r/min centrifugation 5min, abandoning supernatant is added dual anti-containing 10% NBCS and 1%-2% in right amount The complete culture solution of (penicillin and streptomysin).Gently blown and beaten repeatedly with pipette, the histocyte of precipitation is resuspended in culture In liquid, by cell suspension with eight layers of filtered through gauze impurity elimination, it is dispensed into by every hole 2mL in 6 porocyte plates, is placed in 37 DEG C, containing 5% CO2Cell culture incubator in quiescent culture to cell confluency degree 80%；
(2) hydrogen peroxide-induced
The cell that step (1) is cultivated uses the MEM nutrient solutions adjustment cell containing 10% (V/V) NBS (NBCS) dense Degree, 37 DEG C, 5%CO2Overnight incubation in incubator；Experimental group adds the end that the nutrient solution without serum diluted per hole after culture Concentration is 400 μM of hydrogen peroxide, 37 DEG C, 5%CO2Continue to cultivate 12h in incubator, while adding equivalent not after incubated overnight Cell culture fluid containing serum is used as blank control；
(3) DAPI dyeing detection karyomorphism feature
The cell after step (2) culture is taken, cell culture fluid is discarded, 1ml mass fractions are added molten for 4% paraformaldehyde Liquid, in fixing cell 15min under room temperature (18~25 DEG C).Abandon 4% paraformaldehyde solution, PBS three times, each 5min.Plus 1ml, mass fraction 0.2% Triton PBS solutions, in permeabilization cell 30min under 4 DEG C of environment, abandon liquid, PBS three It is secondary, each 5min.DAPI dye liquors are added, room temperature (18~25 DEG C) lucifuge is incubated 10min, abandons liquid, PBS three times, every time 5min.Film flying is air-dried, glycerine fixes film flying on slide, fluorescence microscopy Microscopic observation karyomorphism feature, as a result such as Fig. 1 Shown in middle A and B.
According to above-mentioned identical method, difference is vertically to open with 0.05mg/ml mitomycin Cs or super-clean bench uviol lamp Continue to cultivate cell 12h after lid irradiating cell 5min, karyomorphism is then observed, as a result as shown in C in Fig. 1 and D.
As a result show, after 400 μM of hydrogen peroxide treatment duck embryo fibroblasts 12h, nucleus is observed in DAPI dyeing Reduce, torsional deformation, caryoplasm is gathered in nuclear membrane edge and apoptotic body (A in Fig. 1) occurs, and normal cell nucleus is larger, is in Circular or ellipse, clear-cut (B in Fig. 1).And the DEF nucleus after mitomycin C and UV processing do not observe it is bright The change (C and D in Fig. 1) of aobvious apoptotic nucleus.Therefore, in the experiment for building Apoptosis Model, H is selected2O2It is thin as DEF The derivant of born of the same parents' apoptosis.
(3) fluorescence quantitative RT-RCR detects the intracellular transcriptional levels of caspase 3/9
Handle after 12h, add 1ml RNAiso pluse and receive sample, extracting RNA and reverse transcription.ReferencePremix Ex TaqTMII (Tli RNaseH Plus) specification quantitatively detected to each cDNA samples, and using GAPDH as internal reference.Inspection Survey primer as follows：
Caspase 3F：5’-aatgtcatgtcgcaacgctagata-3’(SEQ ID NO.1)；
Caspase 3R：5’-tgtccgccacagtctgattgata-3’(SEQ ID NO.2)；
Caspase 9F：5’-gctgcttcaacttcctccgta-3’(SEQ ID NO.3)；
Caspase 9R：5’-catctccacggacagacaaagg-3’(SEQ ID NO.4)；
GAPDH F：5’-atgttcgtgatgggtgtgaa-3’(SEQ ID NO.5)；
GAPDH R：5’-ctgtcttcgtgtgtggctgt-3’(SEQ ID NO.6)；
According to relative quantification calculation formula 2-△△CtEach sample mRNA transcriptional levels are calculated, to change multiple as ordinate In triplicate, as a result as shown in Figure 2 mapping, test.
As a result show, H is passed through in fluorescence quantitative RT-RCR detection2O2The cell of processing and the Apoptosis-Related Factors of normal cell Caspase3, caspase9 mRNA level in-site, treatment group cell caspase 3mRNA levels are about 1.5 times of normal cell (A in Fig. 2), caspase 9mRNA levels are about 3 times (B in Fig. 2) of normal cell, show the cell after hydrogen peroxide treatment Interior Caspase 3 and Caspase 9 mRNA transcriptional levels significantly raise (n=3, p*<0.05)。
(4) intracellular Caspase 3/7, Caspase9 protein activity levels are detected
After cell processing 12h, by trypsin digestion cell, 1ml cell suspensions are obtained per hole, take 50 μ L cell suspensions to add to In 96 hole elisa Plates.According to3/7Assay Systems、9Assay Systems reagents Box specification, mixes Caspase-GloSubstrate and Caspase-GloBuffer, equal proportion addition mix reagent and Cell sample, is incubated 30min~3h, while cell count is carried out to every hole cell, most after detecting glimmering in multi-function microplate reader Light value, is mapped, as a result as shown in Figure 3 with relative light unit (RLU) for ordinate.
As a result show, normal cell every 1 × 104In individual cell the cracking level of the albumen of caspase 3/7 be about 4.5 × 104The cracking level of RLU, caspase 9 is about 3.0 × 104RLU；Treatment group cell every 1 × 104Caspase 3/7 in individual cell The cracking level of albumen is about 6.0 × 104The cracking level of RLU, caspase 9 is about 8.0 × 104RLU.Show at hydrogen peroxide Intracellular Caspase 3/7, Caspase9 protein activity levels after reason are significantly raised.
The application of the duck embryo fibroblasts Apoptosis Model of the hydrogen peroxide-induced of embodiment 2.
The present embodiment is applied to the Apoptosis Model built in embodiment 1.With Apoptosis Model research duck plague virus US5 The Apoptosis inhibitor function of gene expression product, comprises the following steps：
(1) using duck plague virus US5 genetic recombination eukaryon expression plasmids pCAGGS-US5, zero load pCAGGS transfection duck embryos into Fibrocyte, transfection method is carried out according to Lipofectamine 3000Reagent, is transfected after 37 DEG C, 5%CO2Incubator Continue to cultivate 36h.Wherein pCAGGS-US5 is built by following methods：According to the sequence of CHv plants of US5 genes of duck plague virus DPV The primer of (GenBank accession number is FJ222443) design clone's US5 genes, primer sequence is as follows：
US5 amplimers F：5’-catcattttggcaaagaattcgccaccatggccatgtatacagacgttacggt C-3 ' (SEQ ID NO.7), underscore represents EcoR I restriction enzyme sites；
US5 amplimers R： 5’-ttggcagagggaaaaagatcttcaagcgtaatctggaacatcgtatgggtat Accatacaaaggcata-3 ' (SEQ ID NO.8), underscore represents Hind restriction enzyme sites；Then with duck plague virus DPV CHv Strain cDNA is template, and sequence shown in SEQ ID NO.7 and SEQ ID NO.8 is primer, enters performing PCR amplification, expands annealing temperature For 60 DEG C, amplified production is connected with expression vector pCAGGS homologous recombinations, conversion, obtains positive bacteria, and identified acquisition recombinates matter Grain, as pCAGGS-US5.
(2) experiment packet and processing
Experiment is divided into three groups, respectively pCAGGS (H2O2-) group, pCAGGS (H2O2+) group, pCAGGS-US5 (H2O2+) Group.By pCAGGS (H2O2+) group, pCAGGS-US5 (H2O2+) group cell per well adds and diluted without the nutrient solution of serum Hydrogen oxide, final concentration of 400 μM of hydrogen peroxide, pCAGGS (H2O2-) cell culture fluid of the group addition equivalent without serum, 37 DEG C, 5%CO2Continue to cultivate 12h in incubator.
(4) the intracellular protein activity levels of Caspase 3/7 are detected
After cell processing 12h, by trypsin digestion cell, 1ml cell suspensions are obtained per hole, take 50 μ L cell suspensions to add to In 96 hole elisa Plates.According to3/7Assay Systems、9Assay Systems reagents Box specification, mixingSubstrate andBuffer, equal proportion adds mix reagent and thin Born of the same parents' sample, is incubated 30min~3h, while cell count is carried out to every hole cell, most after detecting fluorescence in multi-function microplate reader Value, is mapped, as a result as shown in Figure 4 with relative light unit (RLU) for ordinate.
As a result show, pCAGGS (H2O2-) group, every 1 × 104In individual cell the protein actives of caspase 3/7 be about 3 × 103RLU； pCAGGS(H2O2+) group, every 1 × 104The protein actives of caspase 3/7 are about 6 × 10 in individual cell3RLU； pCAGGS-US5 (H2O2+) group, every 1 × 104The protein actives of caspase 3/7 are about 3.3 × 10 in individual cell3RLU。pCAGGS (H2O2+) organize and pCAGGS (H2O2-) group compares, caspase3/7 protein actives significantly raise (n=3, p**<0.05), explanation Hydrogen peroxide result in duck embryo fibroblasts Apoptosis.pCAGGS-US5(H2O2+) organize and pCAGGS (H2O2+) group compares, Caspase3/7 protein activity levels are remarkably decreased (n=3, p*<0.05), illustrate that US5 gene expression products inhibit peroxidating Duck embryo fibroblasts apoptosis caused by hydrogen.
Finally illustrate, preferred embodiment above is merely illustrative of the technical solution of the present invention and unrestricted, although logical Cross above preferred embodiment the present invention is described in detail, it is to be understood by those skilled in the art that can be Various changes are made to it in form and in details, without departing from claims of the present invention limited range.
<110>Sichuan Agricultural University；
<120>The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts
<160> 8
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223> Caspase 3 F
<400> 1
aatgtcatgt cgcaacgcta gata 24
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223> Caspase 3 R
<400> 2
tgtccgccac agtctgattg ata 23
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223> Caspase 9 F
<400> 3
gctgcttcaa cttcctccgt a 21
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223> Caspase 9 R
<400> 4
catctccacg gacagacaaa gg 22
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223> GAPDH F
<400> 5
atgttcgtga tgggtgtgaa 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223> GAPDH R
<400> 6
ctgtcttcgt gtgtggctgt 20
<210> 7
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223>US5 amplimers F
<400> 7
catcattttg gcaaagaatt cgccaccatg gccatgtata cagacgttac ggtc 54
<210> 8
<211> 68
<212> DNA
<213>Artificial sequence
<220>
<223>US5 amplimers F
<400> 8
ttggcagagg gaaaaagatc ttcaagcgta atctggaaca tcgtatgggt ataccataca 60
aaggcata 68

Claims (8)

1. the application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts.
2. setting up the method for duck embryo fibroblasts Apoptosis Model using hydrogen peroxide-induced duck embryo fibroblasts, its feature exists In：Use final concentration of 400 μM of hydrogen peroxide treatment duck embryo fibroblasts.
3. method according to claim 2, it is characterised in that：The time of the processing is 12 hours.
4. method according to claim 2, it is characterised in that：The condition of the processing is 37 DEG C, the CO of volume fraction 5%2 12h is cultivated in incubator.
5. method according to claim 2, it is characterised in that：Before processing, the duck embryo fibroblasts of culture are added and contained The MEM nutrient solutions adjustment cell concentration of NBCS, and in 37 DEG C, the CO of volume fraction 5%2Overnight incubation in incubator, The volume fraction of the NBCS is 10%.
6. method according to claim 5, it is characterised in that the duck embryo fibroblasts of the culture are by following methods system ：The healthy duck embryos of 9~11 ages in days are taken, are fully shredded idiosome as 0.5~1mm with scissors3Fritter, then with equivalent to idiosome 5 The PBS cyclic washing 2~3 times of times volume is limpid to suspension, then moves into the tissue block after washing in centrifuge tube simultaneously It is 2% trypsin solution to add mass fraction immediately, is occurred under the conditions of being subsequently placed in 37 DEG C to tissue block edge after floccule 5min is centrifuged in 4000r/min, abandoning supernatant adds the complete culture solution containing NBCS, penicillin and streptomysin, institute It is that 10%, the penicillin mass fraction is 1~2% and the streptomysin mass fraction is 1- to state NBCS volume fraction 2% streptomysin；Piping and druming makes the histocyte of precipitation be resuspended in nutrient solution, by cell suspension with eight layers of filtered through gauze impurity elimination, presses It is dispensed into per hole 2mL in 6 porocyte plates, is placed in 37 DEG C, is 5%CO containing volume fraction2Cell culture incubator in quiescent culture extremely Cell confluency degree 80%.
7. the duck embryo fibroblasts Apoptosis Model as made from any one of claim 2~6 methods described.
8. application of the duck embryo fibroblasts Apoptosis Model in Apoptosis Inhibition test described in claim 7.
CN201710442901.XA 2017-06-13 2017-06-13 The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts Pending CN107083356A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710442901.XA CN107083356A (en) 2017-06-13 2017-06-13 The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710442901.XA CN107083356A (en) 2017-06-13 2017-06-13 The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts

Publications (1)

Publication Number Publication Date
CN107083356A true CN107083356A (en) 2017-08-22

Family

ID=59605646

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710442901.XA Pending CN107083356A (en) 2017-06-13 2017-06-13 The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts

Country Status (1)

Country Link
CN (1) CN107083356A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103554233A (en) * 2013-11-11 2014-02-05 四川农业大学 Duck plague virus (DPV) UL13 intercepted recombinant protein and polyclonal antibody, preparation method and application thereof
CN104072591A (en) * 2014-07-21 2014-10-01 四川农业大学 Anatid herpesvirus 1 (AHV-1) UL7 truncated recombinant protein, as well as preparation method and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103554233A (en) * 2013-11-11 2014-02-05 四川农业大学 Duck plague virus (DPV) UL13 intercepted recombinant protein and polyclonal antibody, preparation method and application thereof
CN104072591A (en) * 2014-07-21 2014-10-01 四川农业大学 Anatid herpesvirus 1 (AHV-1) UL7 truncated recombinant protein, as well as preparation method and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHUANKUO ZHAO，ET AL: "Molecular characterization and antiapoptotic function analysis of the duck plague virus Us5 gene", 《SCIENTIFIC REPORTS》 *
D. P. JIN,ET AL: "Apoptotic effects of hydrogen peroxide and vitamin C on chicken embryonic fibroblasts: redox state and programmed cell death", 《CYTOTECHNOLOGY》 *

Similar Documents

Publication Publication Date Title
Qin et al. Development and characterization of a new tropical marine fish cell line from grouper, Epinephelus coioides susceptible to iridovirus and nodavirus
Lomonte et al. Herpes simplex virus type 1 immediate-early protein Vmw110 inhibits progression of cells through mitosis and from G1 into S phase of the cell cycle
CN103667176B (en) Carassius auratus gibelio brain tissue cell line sensitive to cyprinid herpesvirus II, and establishing method and application thereof
CN101665781B (en) High-titer Porcine circovirus 2-type cultured cell, preparation method and use thereof
CN106480037A (en) A kind of long non-coding RNA and the application in diagnosis preeclampsia and target drug treatment is prepared
CN103497967A (en) Construction method and use of duck enteritis virus bacterial artificial chromosome
CN105010235B (en) The method that pig farm purifies epidemic disease
CN104152403B (en) A kind of method that establishing goose embryonic epithelium cell line and the goose embryonic epithelium cell line of foundation
CN102732486B (en) Porcine circovirus type2 strain and application thereof
CN104561092A (en) Construction method and applications of genetically engineered vaccine of recombinant PRRS virus capable of expressing classic swine fever virus (CSFV) E2 protein
Li et al. Two virus-like particles that cause lytic infections in freshwater cyanobacteria
CN107083356A (en) The application that hydrogen peroxide is set up in duck embryo fibroblasts Apoptosis Model in induction duck embryo fibroblasts
CN106754748A (en) Aedes albopictus densovirus and its application
CN110042087A (en) A kind of recombinant rabies virus rHEP- △ G-EGFP and its application
Sudhakaran et al. In vitro replication of Macrobrachium rosenbergii nodavirus and extra small virus in C6/36 mosquito cell line
CN102154290B (en) SiRNAs for inhibiting epidemic encephalitis B viruses
CN109666643A (en) One plant of cervical intraepithelial neoplasia (CIN) cell line and application thereof containing sequestered HPV18
CN109504766A (en) The application of miRNA marker miRNA-345-3p
CN104293736A (en) Telomerase immortal cattle thyroid cell line and purpose thereof
CN107177630A (en) A kind of anti-PCV2 transgene pigs preparation method without exogenous marker gene
CN107018955A (en) A kind of transgene pig of the type of resisting porcine circovirus 2
CN112630443A (en) IFA (IFA neutralizing antibody) detection method of PCV2
CN107267635B (en) Kit for detecting resistance of pig to be detected to porcine reproductive and respiratory syndrome virus
CN108210497B (en) Application of compound MLN4924 in preparation of bunyaviridae phlebovirus inhibitor
CN108977583A (en) 3 type droplet digital pcr detection primer of pig circular ring virus and probe and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20170822