CN107058546A - Corn embryonic callus induction related gene GRMZM2G023133 InDel molecular labelings and application - Google Patents
Corn embryonic callus induction related gene GRMZM2G023133 InDel molecular labelings and application Download PDFInfo
- Publication number
- CN107058546A CN107058546A CN201710287468.7A CN201710287468A CN107058546A CN 107058546 A CN107058546 A CN 107058546A CN 201710287468 A CN201710287468 A CN 201710287468A CN 107058546 A CN107058546 A CN 107058546A
- Authority
- CN
- China
- Prior art keywords
- callus induction
- corn
- molecular labelings
- indel molecular
- embryonic callus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides corn embryonic callus induction related gene GRMZM2G023133 InDel molecular labelings and application, positioned at No. 6 chromosome 1647888954bp of corn position, allele is 7bp insertion/deletions, the InDel molecular labelings and maize immature embryos frequency of embryonic callus induction are significantly correlated, and allele is the inbred frequency of embryonic callus induction of 7bp insertions higher than the inbred that allele is 7bp missings.The molecular labeling of the present invention can be used for corn assistant breeding, accelerate the high inductivity material initiative of maize immature embryos and selecting process for new fuchsin.
Description
Technical field
The invention belongs to molecular genetics field, it is related to a kind of corn embryonic callus induction related gene
GRMZM2G023133 InDel molecular labelings and application.
Background technology
Corn is the important cereal crops in the whole world and energy crop, although China is the second largest production of whole world corn
State, but it is a lack of the high-grade maize germ plasm resource of degeneration-resistant, disease-resistant, high-combining ability and wide adaptability.Transgenic breeding is that improvement is beautiful
One of important channel of rice germ plasm resource.This process of rataria induced embryonic callus is the important of whole maize genetic conversion
Link, the height of induced efficiency directly affects the height of transgenosis success rate.
Research and production practices show that embryo-derived callus induction rate is a complicated quantitative character, in corn
There is significant genotypic difference between self-mating system.Most of Elite Maize Inbred Lines frequency of embryonic callus induction are very low, some
Even embryo callus can not be induced at all, thus can not directly as foreign gene direct acceptor, can only be to be returned
The method of transformation receives the target gene from transgenosis self-mating system.The traditional transgenic maize varieties Cultivating techniques body of China
System must experience genetic transformation, selfing purifying, backcross transformation, hybridization several links such as assemble, target gene is returned only in transformant
Transformation then needed for 3~5 years to Inbred Lines, greatly extended corn gene breeding cycle.Identification control maize
Property callus induction related gene, illustrate the molecule mechanism of Callus formation, lured to cultivate more high embryo callus
Conductance Inbred Lines provide theories integration, lay the foundation, on the other hand can also promote to accelerate transgenic corns breeding process
The fast development in whole gene functional study field.
Whole-genome association (GWAS) is that one kind identifies Phenetic in natural population based on linkage disequilibrium (LD)
The analysis method of relation between shape and genetic marker, is the effective way for excavating superior allelic.QTL positioning is then using chain
Gene of the colony based on the whether chain identification influence quantitative character of genetic marker and QTL residing section on chromosome.QTL determines
Position is the QTL scannings for full-length genome, and association analysis can be more accurately located to some SNP.Therefore, association point
It is complementary that analysis and QTL, which are positioned, and significant SNP site can be identified with association analysis, then it is carried out in chain colony
Checking, the integration of two methods will greatly promote the anatomy of complicated quantitative character.At present, corn germplasm improvement and molecule auxiliary are educated
Not yet there are embryonic callus induction related gene molecular markers development and the report utilized in kind.
The content of the invention
In view of the shortcomings of the prior art, first purpose of the invention is to provide corn embryonic callus induction correlation
Gene GRMZM2G023133 InDel molecular labelings, InDel marks are notable with maize immature embryos frequency of embryonic callus induction
It is related.
Second object of the present invention is to provide the primer pair for expanding above-mentioned InDel marks.
Third object of the present invention is to provide the application of above-mentioned InDel marks.
To achieve the above object, the present invention is as follows using technical scheme：The temperate zones on ground such as collection China, the U.S., Mexico,
The torrid zone, 301 parts of Subtropical Maize Inbred Lines, it is embryo-derived more with reference to association colony self-mating system as the association colony of this research
The phenotypic data and SNP genotype datas of injured tissue inductivity, with the general linear model and mixed linear of TASSEL softwares
Two methods of model carry out whole-genome association, detect (Maize B73 a RefGen_v3Chr6:
1647888954bp) the InDel sites significantly associated with maize immature embryos frequency of embryonic callus induction.The site is located at
GRMZM2G023133 gene internals, allele is 7bp insertion/deletions, has two kinds of missing and insertion pure in for examination self-mating system
Genotype is closed, the sequence of the 7bp is as shown in SEQ ID No.1, the flanking sequence such as SEQ ID No.2 institutes of the allele
Show.
The InDel molecular labelings and maize immature embryos frequency of embryonic callus induction are significantly correlated, and allele inserts for 7bp
Inbred frequency of embryonic callus induction higher than allele be 7bp lack inbred.
Screen after an InDel significantly associated, based on site flanking sequence, applicant is devised comprising above-mentioned
The detection maize immature embryos frequency of embryonic callus induction related gene GRMZM2G023133 in InDel sites characteristic primer pair.
Primer pair sequence is as follows：
Upstream (F)：CAAGATGGCTCGGCCATTGGA(SEQ ID No.3)
Downstream (R)：AGTAAAGTTGGACGTACGGGGC(SEQ ID No.4)
Further, the invention provides above-mentioned InDel molecular labelings in identification maize immature embryos embryonic callus induction energy
Application in power related gene GRMZM2G023133；And screening or identifying that maize immature embryos embryonic callus induction ability is high
Germ plasm resource in application；Application in corn germplasm improvement.And improving maize immature embryos embryonic callus induction
Application in rate.Preferably, the loci gene type 7bp of InDel molecular labelings is inserted as favorable genes type.Present invention also offers
Application of the above-mentioned InDel molecular labelings in corn gene breeding.
The present invention provides a kind of side for detecting maize immature embryos frequency of embryonic callus induction related gene GRMZM2G023133
Method, enters performing PCR with above-mentioned primer pair and expands, corn gene group DNA to be detected, if it is possible to amplify shown in SEQ ID No.2
Fragment, then illustrate that the corn to be detected has embryo-derived callus induction rate related gene GRMZM2G022133.
PCR programs are：94 DEG C of pre-degeneration 2min；98 DEG C of denaturation 10s；60 DEG C of annealing 30s；68 DEG C of extension 5s；Totally 35 are followed
Ring；68 DEG C re-extend 10min.
Meanwhile, inventor is using 239 familys of corn IBM Syn 10 DH (B73 × Mo17) colony built
Chain colony, with reference to bin marker genotype datas and the phenotypic data of embryo-derived callus induction rate, carries out QTL and determines
Position.As a result find that above-mentioned InDel molecular labelings fall in the section that QTL is positioned, further demonstrate above-mentioned InDel molecular labelings
With the importance of maize immature embryos frequency of embryonic callus induction.
By the validity that further exploitation of checking institute is marked, inventor respectively selects 8 parts associating in colony and chain colony
Corn inbred line, determines its embryo-derived callus induction rate (see Fig. 1), and using genomic DNA as template, draw using above-mentioned
Thing and program enter performing PCR amplification and sequence verification, as a result show that InDel sites success carries out length in 16 parts of corn inbred lines
Polymorphic detection (see Fig. 2).
Present invention also offers one kind detection maize immature embryos frequency of embryonic callus induction related gene GRMZM2G022133
Kit, it contains the primer pair shown in SEQ ID No.3 and SEQ ID No.4.
The strategy that the present invention is combined using whole-genome association and QTL positioning, discloses the gene and corn children
Inner link between embryo frequency of embryonic callus induction, excavates wherein significant functional site, and be used as genetic marker application
It is significant to accelerating corn gene breeding process in corn molecular breeding.
The beneficial effects of the present invention are：With reference to whole-genome association and QTL positioning strategies, quickly and accurately detect
To SNP the or Indel sites significantly associated with specific trait.The InDel positions of No. 6 chromosome 1647888954bp position of corn
Point (Maize B73RefGen_v3Chr6:It is 1647888954bp) significantly correlated with embryo-derived callus induction rate, explain
Phenotypic variation is respectively 6.19%.The InDel sites, for molecular breeding, can improve maize immature embryos embryo as genetic marker
Property callus induction ability, with higher application value.
Brief description of the drawings
Fig. 1 is 8 parts of association colony's self-mating systems (027,141,155,208,333,336,339,356) and 8 parts of chain colonies
The embryo-derived callus induction rate of self-mating system (003,009,062,097,144,182,270,327).Wherein 003,027,
097th, 141,155,182,208,270 higher inductivity is shown, and 009,062,144,327,333,336,339,356
Inductivity is almost 0.
Fig. 2 is the sequencing knot in above-mentioned 8 parts association colony's self-mating systems and 8 parts of chain colony's self-mating system PCR amplification InDel sites
Really.The insertion that the loci gene type that wherein square frame identifies high frequency of embryonic callus induction self-mating system is 7bp, and the low embryo of correspondence
Property callus induction rate self-mating system loci gene type be 7bp missing.
Embodiment
With reference to specific test method and accompanying drawing technical scheme and its produced technique effect are done into
The elaboration of one step, the description below are merely to explain the present invention, but the present invention is not any limitation as in any way, based on this hair
Any conversion or replacement that bright training centre is made, belong to protection scope of the present invention.The method of the invention unless otherwise specified,
It is this area conventional method.Agents useful for same unless otherwise specified, can be obtained from commercial channels.
Significantly correlated one of the corn gene GRMZM2G022133 of embodiment 1. and embryo-derived callus induction rate
The acquisition of InDel molecular labelings.
Method is as follows：
1) collect 301 parts from China, the U.S., Mexico corn inbred line, construct map used in association colony.
There is abundant genetic diversity in the colony, includes 121 Temperate maize self-mating systems and 180 torrid zone/subtropical zone corn selfings
System.
2) association colony phenotypic evaluation.Respectively at 2015 and 2016 in Sichuan Agricultural University Xishuangbanna base and high
State base carries out field planting to 301 parts of corn inbred lines of acquisition, sets single file area, often the cave of row 7, per 2 plants of cave, 54000 plants/
Hm2,3 repetitions.It is used as the test material of IMMATURE EMBRYOS CULTURE with bagging selfed seed, pollinates 12-15 days or so, each DH systems are derived from
3, fruit ear (i.e. 3 times repetitions) is handed over, each fruit ear is inoculated with 3 culture dishes (each repeating 3 observed values), each culture dish 36
Individual rataria, rataria size is controlled in 1.0-1.5cm.With containing 2mg/L 2,4-D N6 inducing cultures, 27 DEG C of light cultures 30 days
Afterwards, the inductivity (percentage that embryo callus rataria number accounts for inoculation rataria number occur) of investigation embryo callus.Through system
Find that wherein frequency of embryonic callus induction there are 3 in 40%~80% material after meter, 30%~40% material there are 3,
20%~30% material has 12, and 10%~20% material has 25, and 0%~10% material has 69,0% material
There are 188.Variance analysis shows that frequency of embryonic callus induction difference between different self-mating systems reaches the pole level of signifiance (table 1).
The variance analysis of the maize immature embryos frequency of embryonic callus induction of table 1
* * are represented under 0.01 level significantly in table 1.
3) whole-genome association.With reference to the phenotype of the embryo-derived callus induction rate of corn inbred line in step 2
Data and high density SNP marker, are utilized respectively TESSEL 5.0 general linear model (GLM) and mixed linear model
(MLM) analysis is associated, gene frequency threshold value is set to 0.05, in P<In 0.0001 level, SNP marker and character are judged
The conspicuousness of association.As a result detect an InDel site and maize immature embryos frequency of embryonic callus induction is significantly correlated, should
InDel marks are positioned at No. 6 chromosome 1647888954bp of corn position, and allele is 7bp insertion/deletion, described
7bp sequence is as shown in SEQ ID No.1, and the flanking sequence of the allele is as shown in SEQ ID No.2.The inspection of GLM models
It is respectively 0.0273 to survey P values, and the detection P values that explainable phenotypic variation is respectively 5.46%, MLM models are respectively 0.0534,
Explainable phenotypic variation is respectively 6.19%.Two different models are mutually authenticated, it is to avoid closed in the 0.01 level site
The false positive for being coupled fruit is possible, further demonstrate the real reliability of result.
4) QTL locating verifications.Utilize 239 familys of corn IBM Syn 10 DH (B73 × Mo17) colony built
For chain colony, field planting and phenotypic evaluation method, in conjunction with 6618 bin marker genotype datas, are entered with step 2
Row QTL is positioned.9 QTL sites relevant with high embryo callus subculture inductivity are detected on the 6th chromosome, phenotype contribution rate exists
Between 6.1074~9.6101%, the physical bit on section chr06.1641.5~chr06.1653.5, homologue
It is 164.100Mb~165.300Mb (Maize B73 RefGen_v3) to put.The InDel molecular labelings detected in step 3 fall
In the section that QTL is positioned, above-mentioned InDel molecular labelings and maize immature embryos frequency of embryonic callus induction are further demonstrated
Importance.
The InDel of the present invention of embodiment 2. is marked at the application test on maize immature embryos frequency of embryonic callus induction.
8 parts of corn inbred lines are respectively selected in association colony and chain colony, its embryo-derived callus induction is determined
Rate (see Fig. 1), and using genomic DNA as template, designed using InDel molecular labelings site flanking sequence (SEQ ID No.2)
Specific primer, primer sequence is as shown in SEQ ID No.3 and SEQ ID No.4, using KOD FX Neo exo+ polymerases
((Shanghai) bio tech ltd is spun by Japan) enters performing PCR amplification, and program is：94 DEG C of pre-degeneration 2min；98 DEG C of denaturation 10s；
60 DEG C of annealing 30s；68 DEG C of extension 5s；Totally 35 circulations；68 DEG C re-extend 10min.By specific target stripe glue reclaim
Kit (Omega Bio-Tek) recovery purifying, connects flat end cloning vector Peasy-Blunt Cloning Vector (north
Jing Quanshijin Bioisystech Co., Ltd) sequencing.Sequencing result is compared (see figure using SnapGene 2.3.2 softwares
2).As a result show that the success of InDel sites carries out length polymorphism detection in 16 parts of corn inbred lines, wherein 8 parts of high embryo callus subcultures
Tissue inductivity self-mating system is all 7bp insertions, 8 parts low frequency of embryonic callus induction selfing in above-mentioned InDel loci gene types
It is that loci gene type is all 7bp missings.This experiment further proves whole-genome association and QTL detection and localizations in the present invention
As a result accuracy.
Therefore, the allelotype of 7bp insertions is considered excellent/synergy allele.The present invention further confirms above-mentioned
InDel sites can be applied to molecular marker assisted selection as effective genetic marker, improve maize immature embryos embryo callus subculture group
Knit inducibility.
Although having used general explanation, embodiment and experiment above, the present invention is described in detail,
But some modifications on the basis of the present invention, can be made to it or are improved, this is apparent to those skilled in the art
's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, are belonged to claimed
Scope.
SEQUENCE LISTING
<110>Sichuan Agricultural University
<120>Corn embryonic callus induction related gene GRMZM2G023133 InDel molecular labelings and application
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 7
<212> DNA
<213> Zea mays L.
<400> 1
gaggtaa 7
<210> 2
<211> 65
<212> DNA
<213> Zea mays L.
<220>
<221>Indel molecular labelings site flanking sequence
<222> (30)..(30)
<223>N=GAGGTAA/ is lacked
<400> 2
ctacaagatg gctcggccat tggaggtaan cttccgtgcc ccgtacgtcc aactttactg 60
gaaca 65
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
caagatggct cggccattgg a 21
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<400> 4
agtaaagttg gacgtacggg gc 22
Claims (10)
1. corn embryonic callus induction related gene GRMZM2G023133 InDel molecular labelings, it is characterized in that, it is described
InDel molecular labelings are located at No. 6 chromosome 1647888954bp of corn position, the sequence such as SEQ ID of allele respectively
Shown in No.1.
2. InDel molecular labelings as claimed in claim 1, it is characterized in that, the flanking sequence such as SEQ ID of the allele
Shown in No.2.
3. InDel molecular labelings as claimed in claim 1 or 2, it is characterized in that, expand the primer of the InDel molecular labelings
Sequence is as shown in SEQ ID No.3-4.
4. InDel molecular labelings as claimed in claim 1 or 2, it is characterized in that, the InDel molecular labelings and maize immature embryos
Frequency of embryonic callus induction is significantly correlated, and allele is the inbred embryonic callus induction that 7bp is inserted
Rate is higher than the inbred that allele is that 7bp is lacked.
5. any described InDel molecular labelings of claim 1-4 are in identification maize immature embryos embryonic callus induction ability phase
Application in correlation gene GRMZM2G023133.
6. any described InDel molecular labelings of claim 1-4 are screening or identified maize immature embryos embryonic callus induction
Application in the high germ plasm resource of ability.
7. application of any described InDel molecular labelings of claim 1-4 in corn germplasm improvement.
8. a kind of method for detecting corn embryonic callus induction ability related gene GRMZM2G023133, it is characterized in that, use
Primer pair shown in SEQ ID No.3-4, PCR expands corn material genomic DNA to be detected, if it is possible to amplify its site
Fragment shown in flanking sequence SEQ ID No.2, then illustrate that there is embryo-derived callus in the corn material to be detected lures
Lead ability related gene GRMZM2G023133.
9. method as claimed in claim 8, it is characterized in that, the PCR programs are：94 DEG C of pre-degeneration 2min；98 DEG C of denaturation
10s；60 DEG C of annealing 30s；68 DEG C of extension 5s；Totally 35 circulations；68 DEG C re-extend 10min.
10. a kind of kit for detecting corn embryonic callus induction ability related gene GRMZM2G023133, its feature
It is, including the primer pair shown in SEQ ID No.3-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710287468.7A CN107058546B (en) | 2017-04-27 | 2017-04-27 | InDel molecular marker of corn embryogenic callus induction related gene GRMZM2G023133 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710287468.7A CN107058546B (en) | 2017-04-27 | 2017-04-27 | InDel molecular marker of corn embryogenic callus induction related gene GRMZM2G023133 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107058546A true CN107058546A (en) | 2017-08-18 |
| CN107058546B CN107058546B (en) | 2020-08-11 |
Family
ID=59604799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710287468.7A Active CN107058546B (en) | 2017-04-27 | 2017-04-27 | InDel molecular marker of corn embryogenic callus induction related gene GRMZM2G023133 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058546B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112626079A (en) * | 2020-12-16 | 2021-04-09 | 四川农业大学 | ZmSAUR15 gene and application thereof in improving corn embryogenic callus induction rate |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101821409A (en) * | 2007-08-29 | 2010-09-01 | 孟山都技术公司 | Methods and compositions for breeding for preferred traits |
-
2017
- 2017-04-27 CN CN201710287468.7A patent/CN107058546B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101821409A (en) * | 2007-08-29 | 2010-09-01 | 孟山都技术公司 | Methods and compositions for breeding for preferred traits |
| EP2476763A3 (en) * | 2007-08-29 | 2013-03-06 | Monsanto Technology LLC | Methods and compositions for breeding for preferred traits |
Non-Patent Citations (1)
| Title |
|---|
| 杨华: "玉米组蛋白去乙酰化酶ZmHDA101调控籽粒大小的分子机制研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112626079A (en) * | 2020-12-16 | 2021-04-09 | 四川农业大学 | ZmSAUR15 gene and application thereof in improving corn embryogenic callus induction rate |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107058546B (en) | 2020-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101138313B (en) | Maize inbred line resistant to MRDV bred by using molecule making | |
| CN103789306B (en) | The SNP marker and its method of a kind of rice blast resistance gene Pia and application | |
| Ji et al. | Pyramiding blast, bacterial blight and brown planthopper resistance genes in rice restorer lines | |
| CN106755480A (en) | A kind of SSR molecular marker I for identifying Gala apple Progeny plants and its application | |
| CN102181440B (en) | Molecular marker of brown planthopper-resistant major gene bph7 of rice and application thereof | |
| CN108588272A (en) | A kind of molecular labeling and its application with Plant Height in Wheat and spike length character main effect QTL compact linkage | |
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN108203737A (en) | The SNP marker of corn tassel row number related gene GRMZM2G098557 and application | |
| CN104711254B (en) | The low-phosphorous responsive genes ZmARF31 of corn INDEL molecular labelings and its application | |
| CN110499389A (en) | With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco | |
| CN105624280A (en) | SSR molecular markers for identifying resistance and susceptibility of apple on glomerella leaf spot as well as application of SSR molecular markers | |
| CN104232764B (en) | The SNP marker of the low-phosphorous responsive genes ZmARF31 of corn and application thereof | |
| CN107058546A (en) | Corn embryonic callus induction related gene GRMZM2G023133 InDel molecular labelings and application | |
| CN101487050B (en) | Molecular marker method for rice anti-rice stripe major gene loci qSTV11 | |
| CN111034612A (en) | Breeding method of scab and clavispora leaf spot resistant dense thorn type cucumber hybrid | |
| CN102766625A (en) | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof | |
| CN107058545A (en) | Corn embryonic callus induction related gene GRMZM2G020814 SNP marker and its application | |
| CN108130380A (en) | A kind of molecular breeding method of synchronous improvement cotton verticillium wilt resistance and fiber quality | |
| CN103882017B (en) | The molecule marker of cucumber fusarium axysporum disease-resistant gene Foc-4 and primer special thereof and application | |
| CN108285928A (en) | The InDel molecular labelings of corn tassel row number related gene GRMZM2G098557 and application | |
| CN108034654B (en) | SNP molecular marker related to rice seedling stage root length and application thereof | |
| CN106480179B (en) | The molecular labeling of rice paddy seed fast-germination QTL qGS11 and its application | |
| CN109880929A (en) | The molecular labeling of the main effect QTL site Apam-1 of adjusting and controlling rice bacterial brown streak resistance and its application | |
| CN110499388A (en) | Identify codominant marker's primer sets, discrimination method and its application of the anti-spotted wilt site RTSW allelic gene type of tobacco | |
| CN104762299A (en) | Rice seedling-stage salt-resistant gene qST2 and molecular marking method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |