CN107058374A - A kind of Chinese catalpa loses the construction method of transformation system - Google Patents
A kind of Chinese catalpa loses the construction method of transformation system Download PDFInfo
- Publication number
- CN107058374A CN107058374A CN201710331117.1A CN201710331117A CN107058374A CN 107058374 A CN107058374 A CN 107058374A CN 201710331117 A CN201710331117 A CN 201710331117A CN 107058374 A CN107058374 A CN 107058374A
- Authority
- CN
- China
- Prior art keywords
- embryo callus
- chinese catalpa
- hygromycin
- conversion
- cultivation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Developmental Biology & Embryology (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of construction method of Chinese catalpa genetic conversion system.Wherein include using the embryo callus of Chinese catalpa as transformation receptor, carry out the screening of the critical lethasl concentration of hygromycin, be aided with by agrobacterium-mediated transformation ultrasonication and carry out infecting conversion, resistance and regenerate the processes such as the detection of embryo callus and regeneration plant.The genetic transforming method of the present invention is first using the embryo callus of Chinese catalpa as acceptor, and the conversion colony for infecting material is big, and cells,primordial power of regeneration is strong；The succeeding preservation steady in a long-term of embryo callus can meet the demand for carrying out genetic transformation in the anniversary；It is aided with ultrasonication again and infects conversion Chinese catalpa embryo callus, transformation efficiency is high.Successfully carrier T region of DNA is incorporated into Chinese catalpa genome by the present invention, and designs specific primer detection transgenosis Chinese catalpa regeneration plant.Molecular genetic manipulation and detection of the present invention suitable for Chinese catalpa, and the transgenosis Chinese catalpa obtained by the transformation event is donor and then obtains various transgenosis new varieties.
Description
Technical field
The invention belongs to the construction method field of the genetic conversion system of plant, it is related to the structure that a kind of Chinese catalpa loses transformation system
Construction method.
Background technology
Chinese catalpa（Catalpa bungeiC.A.Mey）It is the deciduous tree of Bignoniaceae Catalpa, is Chinese precious to use material
One of seeds, in industrial cut stock, ornamental plantation, ecological protection, green planted city aspect plays an important role, and is referred to as " wooden king ".
Chinese catalpa, using with a long history, is Precious Timber Species and famous ornamental plantation seeds（Tang Ling etc., 2007）, its timber is not with
Warp and fracture, corrosion-resistant, easy processing, beautiful texture the features such as, it is special come producing high-grade commodity and Special Products.The tree-like grace of Chinese catalpa,
Leaf is close by close hair, the rough branch of skin, is conducive to sound insulation, noise abatement, noise control, lays the dust, and to a variety of toxic gases in environment, such as chlorine and
Sulfur dioxide etc. has stronger absorbability, is that China has the important afforestation being worth compared with high-environmental and ornamental tree species.Chinese catalpa
Well developed root system is set, belongs to deep-rootedness seeds, for prevention soil and water loss, retardance wind erosion, fixed dune, protecting the fields serves very well
Effect.Therefore Chinese catalpa has important value of exploiting and utilizing.
As follows about Chinese catalpa breeding research, situation about developing at present, selfing is not affine under Chinese catalpa nature, solid
Rate is low；Breeding for Chinese catalpa is more by way of cuttage and grafting, and its sport technique segment is more, and growing-seedling period is long, and long-term asexual numerous
Growing causes kind, type and clone unification, and due to its self-sterility, usually causes Chinese catalpa exists gaudy existing
As breeding and utilization and extention to Chinese catalpa excellent strain cause very big obstacle, in addition the excellent exploitation for exacerbating people of material
Utilize, cause the shortage of Chinese catalpa resource.In addition, regenerating system and the somatic embryo of Yunnan Chinese catalpa occur for the organ for having been set up Chinese catalpa
Generation system, somatic embryo occurs have the advantages that quick, positive controls for high proliferation rates and high regeneration rate, and Chinese catalpa improved Varieties can be made fast
Speed breeding.For a long time, the genetic improvement of Chinese catalpa is mainly carried out by way of crossbreeding, but many specific to forest
Biological characteristics, such as longer growth cycle and juvenile phase, height heterozygosity and tissue culture regeneration difficulty so that conventional breeding methods
Cycle is very long, and breed improvement is restricted.Using modern molecular biology and technique for gene engineering, be expected to can it is more quick,
Efficiently change the properties and characteristicses of target species, so as to greatly accelerate the speed of breeding, improve the efficiency of breeding.At present
The genetic conversion system of there is not been reported Chinese catalpa is built, and limits the development of Chinese catalpa molecular genetic manipulation.
The content of the invention
Using the Chinese catalpa somatic embryo for the efficient stable set up system occurs for the present invention, auxiliary by agrobacterium-mediated transformation
Genetic transformation is carried out to embryo callus with ultrasonication, related genetic transformation parameter is established, and then by foreign gene
It is transferred in Chinese catalpa genome, sets up effective Chinese catalpa genetic conversion system, can changes for the molecular genetic of Chinese catalpa character from now on
It is good to lay the foundation.
Therefore, the technical scheme that the present invention is provided is：
A kind of construction method of Chinese catalpa genetic conversion system, including：Using Chinese catalpa embryo callus as transformation receptor, its tide is established
The critical lethasl concentration of mycin, then pass sequentially through the preparation of engineering bacterium solution, the infecting of embryo callus, at ultrasonic assistant
Reason, co-cultivation and selection culture, transient expression detection and PCR detections.
1）The determination of the critical lethasl concentration of hygromycin of embryo callus：The embryo callus that Chinese catalpa rataria is induced
Culture statistics survival rate in the Selective agar medium of the hygromycin of additional various concentrations is inoculated into, the damp mould of embryo callus is obtained
The critical lethasl concentration of element；
2）The agriculture bacillus mediated ultrasonication that is aided with carries out infecting conversion：Use the Agrobacterium engineering bacterium solution pair containing target gene
Embryonal connective tissue is carried out infecting conversion, and Sonication assisted treatment is carried out while infecting；
3）Infect the co-cultivation and selection culture of the embryo callus of processing：By step 2）Infect embryo callus subculture after conversion
Tissue, which is placed in proliferated culture medium, to be co-cultured, and transposition carries out the selection training of transformant in Selective agar medium after co-cultivation
Support, unconverted tissue will be killed by antibiotic in selection incubation, and the resistant calli and regeneration plant survived can
Carry out the conversion detection of next step；
4）The PCR detections of the reporter gene transient expression and regeneration plant of transformed calli：To passing through step 3）After co-cultivation
Embryo callus carry out reporter gene transient expression detection, to step 3）Select to obtain resistance regeneration plant in incubation
Performing PCR augmentation detection is entered in strain；
Complete the structure that Chinese catalpa loses transformation system.
Preferably, in the construction method of the Chinese catalpa genetic conversion system, before genetic transformation is carried out, in addition to by
The acquisition and preservation of body material：
The young tender embryo of Chinese catalpa immature fruit is taken, successively after 75% alcohol, 2% liquor natrii hypochloritis sterilizing, children is stripped
Tender embryo is explant, embryo callus material succeeding preservation in 1/2MS culture mediums is obtained by a series of inductions, with this
It is used as genetic transformation acceptor.
Preferably, the step 1）Selective agar medium is the hygromycin that 1/2MS solid mediums add 10-80mg/L, will
The fritter embryo callus of 0.3-0.4cm square is seeded in the 1/2MS solid mediums of additional 10-80mg/L hygromycin,
Screen the critical lethasl concentration of embryo callus.
Preferably, in the screening process of the critical lethasl concentration of the hygromycin, embryo callus subculture group is determined by the culture of 3 weeks
The critical lethasl concentration knitted is 60mg/L hygromycin.The screening effect of hygromycin is reflected by the culture of 3 weeks.
Preferably, the Agrobacterium is infected in conversion process, the step 2）The Agrobacterium engineering bacterium solution prepared is resuspended
In 1/2MS fluid nutrient mediums, the acetyl fourth that bacterium solution OD600 values are 0.01-100 μm of ol/L of addition in 0.4-0.7, engineering bacterium solution
Ketone musk, embryo callus, which is placed in engineering bacterium solution, infects processing 10-30 minutes, while engineering bacterium solution and callus are placed in
In ultrasonication 1-5 minutes of 15 μm of amplitudes in 50ml centrifuge tubes, it is ensured that obtain preferable transformation efficiency.1/2MS liquid is trained
Foster base is plant culture, is adapted to the growth of plant tissue and cell, bacterium solution OD600 values be in order to determine the concentration of bacterium solution,
Infect efficiency is high in certain limit；Addition acetosyringone can improve the probability that induction Agrobacterium infects plant cell, natural shape
Injured plant tissue can secrete such material induction Agrobacterium infection under state, and inducing effect is best during usual 100 μm of ol/L；It is super
Sound and vibration width is also to determine that effect is preferable under 15um after relatively.
It is further preferred that the concentration OD600 values for infecting engineering bacterium solution in conversion process are 0.6-0.7, engineering bacteria
100 μm of ol/L acetosyringone is added in liquid, the time that engineering bacterium solution infects embryo callus is 20 minutes, what is infected
Simultaneously with the ultrasonication 3 minutes of 15 μm of amplitudes.
Preferably, the step 2）In engineering bacterium solution prepare and total time needed for infecting conversion processing is 2.5 days, 2 days
Preparation engineering bacterium solution, the 0.5 day time completes the conversion of infecting in superclean bench, and the embryo callus for completing to infect processing enters
Row is co-cultured.Prepared by the cultures of 2 days, agrobatcerium cell is in vigorous exponential phase, is conducive to raising to infect conversion
Efficiency.Thalline aging can be caused by crossing prolonged culture, and spending the short time, then bacterial concentration is low, infects transformation efficiency low.Preferably,
The step 3）Co-cultivation is by through step 2）Embryo callus after infecting is cultivated 2-5 days under dark condition so that T-
DNA section is imported into plant cell.Agrobacterium breeding is very fast under dark condition, it is easy to which by wound site, infection plant is thin
Born of the same parents.
It is further preferred that the co-cultivation time is 3 days, higher reporter gene transient expression efficiency is resulted in.
Co-cultivation 3 days is relatively good timing node, and the growth of overlong time Agrobacterium is excessively vigorous, and degerming, training is difficult to during selection culture
If the time of supporting is too short, Agrobacterium increment is not enough, infects transformation efficiency low.
Preferably, the screening of transformant is carried out in the selection incubation, is transferred to after co-cultivation slightly below damp mould
The critical lethasl concentration of element and it is used as with 400mg/L carbenicillins in the 1/2MS solid mediums of bacteria remover and carries out transformant
Hygromycin concentration in screening and culturing, culture medium≤through step 1）The critical lethasl concentration of embryo callus hygromycin of determination, institute
The critical lethasl concentration of hygromycin is stated for 60mg/L.
Preferably, during the co-cultivation of the Agrobacterium and embryo callus, condition of culture is：Under dark condition
Cultivated 2-5 days in 1/2MS solid mediums so that T-DNA sections are imported into plant cell.
Preferably, the screening of the critical lethasl concentration of the hygromycin, the environmental condition of selection culture are：Cultivation temperature 25 ±
2 DEG C, intensity of illumination 1000Lx, light application time 16h/d；The environmental condition of the co-cultivation：25 ± 2 DEG C of temperature, interlunation
24h/ days.On this condition, Vitro Plant tissue growth situation is best.
Preferably, the step 4）The transient expression detection of reporter gene is by the embryo callus rinsing after co-cultivation
It is placed in GUS dyeing liquors and is dyed after clean, PCR detections is the specific primer antagonism regeneration plant with target gene
Genomic DNA carry out Amplification Analysis its whether integrate.
The present invention provides at following beneficial effect：
The invention provides a kind of construction method of genetic conversion system of Precious Timber Species Chinese catalpa.This method is with Chinese catalpa embryo
Callus is acceptor, is aided with ultrasonication by agriculture bacillus mediated and sets up stable genetic conversion system.It is cured with embryo
Injured tissue is that transformed acceptor cell enormous amount, cells,primordial differentiation and regeneration ability are strong as the advantage of transformation receptor, conversion
The somatic embryo that cell is produced directly can turn into complete regenerated plant by differentiation and development.The genetic transformation set up by the present invention
System, molecular genetic manipulation, Germplasm enhancement available for Chinese catalpa provide novel species material, are also other forest commerical tree species
Molecular breeding provide experiment reference frame.
2nd, the present invention is used as acceptor, compared to herbaceous plant, xylophyta using woody plant material and embryo callus
Somatic embryo Regeneration System is difficult, and genetic transformation efficiency is low, and the present invention is setting up stable Chinese catalpa body embryo generation system
On the basis of, converted using the embryo callus that differentiation and regeneration ability is strong as acceptor, it is expected to improve its genetic transformation efficiency.）
3rd, genetic transforming method of the invention infects the conversion colony of material first using the embryo callus of Chinese catalpa as acceptor
Greatly, cells,primordial power of regeneration is strong.
Brief description of the drawings
The invention will be further described with reference to the accompanying drawings and examples：
Fig. 1（1-A, 1-B）Genetic transformation acceptor --- Chinese catalpa embryo callus；
Fig. 2（2-A, 2-B, 2-C, 2-D, 2-E, 2-F）The critical lethasl concentration screening of hygromycin of Chinese catalpa embryo callus；
The T-DNA section structures of Fig. 3 plant expression carrier plasmids；
Fig. 4（4-A, 4-B, 4-C）In transforming tissueGUSThe expression of reporter gene；
Fig. 5 turnsAHAThe PCR detections of gene Chinese catalpa resistance regeneration plant；
Fig. 6AHAThe PCR primer sequence alignment of genetic transformation strain；
Wherein：The mgL of Fig. 2-A hygromycin concentration 0-1, the mgL of 2-B hygromycin concentration 10-1, the mg of 2-C hygromycin concentration 20
L-1, the mgL of 2-D hygromycin concentration 40-1, the mgL of 2-E hygromycin concentration 60-1, the mgL of 2-F hygromycin concentration 80-1；
Fig. 4-A are negative control, and 4-B is Agrobacterium-mediated transformation, and 4-C is ultrasonic assistant Agrobacterium-mediated transformation；
In Fig. 5：Swimming lane 1-9 is resistance regeneration plant, and 10 be wild type negative control, and 11 be plasmid positive control, and M is DL2000
Molecular weight Marker.
Embodiment
The present invention is further illustrated with reference to embodiment, but the scope of protection of present invention is not limited to implement
The scope of example statement.
The present invention one of embodiment in, as preferably carry out Chinese catalpa genetic conversion system build before,
Also include：The acquisition and preservation of embryo callus, take the immature seed of Chinese catalpa, successively the hypochlorous acid through 75% alcohol, 2%
After sodium solution sterilizing, young tender embryo is stripped for explant, and obtain embryo callus material by a series of inductions trains in 1/2MS
Support succeeding preservation in base（Specific method is delivered in a separate paper）, in this, as genetic transformation acceptor.
In one of example of the present invention, preferably, in the overlooking lethasl concentration screening process of the hygromycin, will
The fritter embryo callus of 0.3-0.4cm square is seeded in the 1/2MS solid mediums of additional 10-80mg/L hygromycin,
Screen the critical lethasl concentration of embryo callus.
In one of example of the present invention, preferably, the Agrobacterium is infected in conversion process, the agriculture prepared
Bacillus engineering bacterium solution is resuspended in 1/2MS fluid nutrient mediums, and bacterium solution OD600 values are 0.4-0.7, adds 0.01- in engineering bacterium solution
100 μm of ol/L acetosyringone, embryo callus, which is placed in engineering bacterium solution, infects processing 10-30 minutes, while by engineering
Bacterium solution and callus are placed in 50ml centrifuge tubes, in ultrasonication 1-5 minutes of 15 μm of amplitudes, it is ensured that obtained and preferably turned
Change efficiency.
In one of example of the present invention, preferably, the co-cultivation of the Agrobacterium and embryo callus
Cultivated 2-5 days in 1/2MS solid mediums under Cheng Zhong, dark condition so that T-DNA sections are imported into plant cell.
In one of example of the present invention, preferably, the screening of transformant is carried out in the selection incubation,
It is transferred in the slightly below Selective agar medium of the critical lethasl concentration of hygromycin and is screened after co-cultivation, it is relatively many to obtain
Resistant calli and regeneration plant.
In one of example of the present invention, preferably, the overlooking lethasl concentration screening of the hygromycin, selection culture
Environmental condition be：25 ± 2 DEG C of cultivation temperature, intensity of illumination 1000Lx, light application time 16h/d；The environment bar of the co-cultivation
Part：25 ± 2 DEG C of temperature, 24h/ days interlunation.
In one of example of the present invention, the construction method of the Chinese catalpa genetic conversion system specifically includes following step
Suddenly：
（1）The acquisition of Chinese catalpa embryo callus
Take Chinese catalpa 60 days fruit ages immature seed, sequentially pass through 75% alcohol, 2% liquor natrii hypochloritis sterilizing after, strip
The tender embryo of children is explant, obtains embryo callus succeeding preservation in 1/2MS culture mediums by a series of inductions, is used as something lost
Pass the acceptor material of conversion.
（2）The critical lethasl concentration screening of hygromycin
In the 1/2MS solid state rheologies that the Chinese catalpa embryo callus of the acquisition is inoculated in additional various concentrations hygromycin, training
Screening and culturing 3 weeks under conditions of foster 25 ± 2 DEG C of temperature, intensity of illumination 1000Lx, light application time 16h/d.The screening and culturing medium
For 1/2MS solid-state minimal mediums, additional 10-80mg/L hygromycin, critical lethasl concentration preferably is 60mg/L.
（3）It is agriculture bacillus mediated to infect conversion embryo callus
The critical lethasl concentration of hygromycin of Chinese catalpa embryo callus is determined, is carried out by the agriculture bacillus mediated ultrasonication that is aided with
Conversion processing is infected, the Agrobacterium engineering bacterium solution is resuspended in 1/2MS fluid nutrient mediums, bacterium solution OD600 values are 0.4-0.7,
0.01-100 μm of ol/L acetosyringone is added in engineering bacterium solution, embryo callus, which is placed in engineering bacterium solution, infects processing
10-30 minutes, while engineering bacterium solution and callus are placed in 50ml centrifuge tubes, in the ultrasonication 1-5 of 15 μm of amplitudes
Minute.
It is preferred that 1/2MS fluid nutrient mediums engineering bacterium solution OD600 values are resuspended is to add 100 μ in 0.6-0.7, engineering bacterium solution
Mol/L acetosyringone, embryo callus infects processing 20 minutes, the ultrasonication of 15 μm of amplitudes 3 minutes.
（4）Co-culture and selection culture
The embryo callus infected is co-cultured, the co-cultivation is under dark condition, 1/2MS solid mediums
Middle culture 2-5 days.It is preferred that the co-cultivation time be 3 days.
After co-cultivation carry out selection culture, the selection culture be the embryo callus after co-cultivation is transferred to it is additional
Slightly below the critical lethasl concentration of hygromycin and 400mg/L carbenicillins are as in the 1/2MS solid-state Selective agar mediums of bacteria remover
Screening transformant is carried out, screening efficiency can be improved.It is preferred that hygromycin selection pressure be 40mg/L.
（5）The PCR detections of reporter gene transient expression and regeneration plant
Embryo callus after co-cultivation, takes part sample to carry out the transient expression inspection of reporter gene after being thoroughly rinsed
Survey, is used as negative control, GUS prescription of its dyeing liquor is with reference to Jefferson etc. not infect the embryo callus of conversion（1987）
Method is modified slightly.
To selection culture obtain resistance regeneration plant enter performing PCR augmentation detection, using the genomic DNA of regeneration plant as
Template, the specific primer of application target gene enters performing PCR augmentation detection, such asAHA（Different rhizoma arisaematis mannose binding lectin base
Cause）Gene,LeaGene（Zinc late-embryogenesis abundant protein）Transformation tissue culture plant.
Embodiment 1
MS minimal mediums can refer to document（Murashige T and Skoog F., 1962）Prepare.GUS prescription of its dyeing liquor
Reference literature（Jefferson et.al.,1987）Prepare.
In the construction method of the genetic conversion system of Chinese catalpa of the present invention, comprise the steps of：
（1）The acquisition of Chinese catalpa embryo callus
Take Chinese catalpa 60 days fruit ages immature seed, sequentially pass through 75% alcohol, 2% liquor natrii hypochloritis sterilizing after, strip
The tender embryo of children is explant；Described explant is placed in a series of solid mediums and induced, faint yellow embryo callus subculture is obtained
Tissue（Fig. 1（1-A, 1-B））, in this, as the acceptor material of genetic transformation.
（2）The screening of the critical lethasl concentration of hygromycin
The Chinese catalpa embryo callus of the acquisition is inoculated in the 1/2MS solid state rheologies of additional 10-80mg/L concentration hygromycin
In, 25 ± 2 DEG C of cultivation temperature, intensity of illumination 1000Lx, screening and culturing 3 weeks under conditions of light application time 16h/d.Control embryo is cured
Injured tissue was cultivated in the culture medium without hygromycin after 3 weeks（Fig. 2）, institute is a large amount of in a organized way to breed, and it is same that body embryo starts differentiation
When formed with the developments of Secondary embryos；In 10 mg/L（Fig. 2-B）Hygromycin selection media in, culture 3 weeks after have 49%
Embryo callus survival propagation, then browning is dead for remaining tissue；40 mg/L（Fig. 2-D）Locate in Hygromycin selection media
The material survival for having 9% after 3 weeks is managed, but growth is serious bad；60 mg·L-1（Fig. 2-E）3 are handled in Hygromycin selection media
The material survival in week only 5%, almost without growth；80 mg/L（Fig. 2-F）And the whole brownings of material of concentrations above processing are dead.
Thereby determine that, the critical lethasl concentration of hygromycin of Chinese catalpa embryo callus is 60 mg/L.
（3）It is agriculture bacillus mediated to infect conversion embryo callus
The critical lethasl concentration of hygromycin of Chinese catalpa embryo callus is determined, is carried out by the agriculture bacillus mediated ultrasonication that is aided with
Conversion processing is infected, respectively using containingAHAGene（Different rhizoma arisaematis mannose-binding lectin gene）、LeaGene（Late period embryo
Tire rich protein）Plant expression vector（Fig. 3）Genetic transformation is carried out to Chinese catalpa embryo callus.Pass through infecting for 17 batches
Engineering bacterium solution OD600 values are resuspended for 0.6-0.7 in conversion and resistance screening, 1/2MS fluid nutrient mediums preferably, add in engineering bacterium solution
Plus 100 μm of ol/L acetosyringone, embryo callus, which infects, to be handled 20 minutes, the ultrasonication of 15 μm of amplitudes 3 minutes,
40mg/L hygromycin and 400mg/L carbenicillins are placed in as the selection culture of bacteria remover after being co-cultured 3 days under dark condition
Screened in base, the detection of later stage transient expression shows that genetic transformation efficiency can be greatly improved.
(4) the PCR detections of reporter gene transient expression and regeneration plant
Embryo callus after co-cultivation, takes part sample to carry out the transient expression inspection of reporter gene after being thoroughly rinsed
Survey, is used as negative control, GUS prescription of its dyeing liquor is with reference to Jefferson etc. not infect the embryo callus of conversion（1987）
Method is modified slightly.
Found in transformation experiment, only pass through the agriculture bacillus mediated apposition growth for infecting Agrobacterium during conversion, co-cultivation
In confused situation aobvious, almost invisible, transformation efficiency is relatively low, and the tissue block of gus reporter gene expression is less, and expression rate is only
53.8% and patch is smaller；And by 15 μm of amplitude ultrasonications of 3 minutes while infecting, during co-cultivation substantially
It can be seen that the growth of the Agrobacterium of attachment, it should be on smooth embryo callus surface to produce wound by ultrasonication,
The deposit efficiency of Agrobacterium is greatly improved, and expression of the gus reporter gene in callus also demonstrates the lifting of transformation efficiency,
Reach 71.7%（Fig. 4 is noted：4-A is negative control, and 4-B is Agrobacterium-mediated transformation, and 4-C is that ultrasonic assistant is agriculture bacillus mediated
Method is converted, table 1）.
To selection culture obtain resistance regeneration plant enter performing PCR augmentation detection, using the genomic DNA of regeneration plant as
Template, wherein application target geneAHASpecific primer enter performing PCR augmentation detection, primer sequence is as follows：
SEQUENCE LISTING1：AHA-s：GGGCACCAACCACCTGCTGTCCG
SEQUENCE LISTING2：AHA-a：ACGCGACAATGGGGCGCTTCGAG
As a result show that 5 resistance regeneration plant samples obtain about 770bp length specificity fragments, to the PCR primer of AHA transformants
Forward and reverse sequencing is carried out, sequencing result and AHA gene orders are subjected to sequence alignment by DNAman softwares, as a result shown
Sequence identity is 95%, thereby determines that target gene is had been integrated into Chinese catalpa genome, sets up the genetic conversion system of Chinese catalpa.
Embodiment 2
MS minimal mediums can refer to document（Murashige T and Skoog F., 1962）Prepare.GUS prescription of its dyeing liquor
Reference literature（Jefferson et.al.,1987）Prepare.
In the construction method of the genetic conversion system of Chinese catalpa of the present invention, comprise the steps of：
（1）The acquisition of Chinese catalpa embryo callus
Take Chinese catalpa 60 days fruit ages immature seed, sequentially pass through 75% alcohol, 2% liquor natrii hypochloritis sterilizing after, strip
The tender embryo of children is explant；Described explant is placed in a series of solid mediums and induced, faint yellow embryo callus subculture is obtained
Tissue（Fig. 1）, in this, as the acceptor material of genetic transformation.
（2）The critical lethasl concentration screening of hygromycin selection
The Chinese catalpa embryo callus of the acquisition is inoculated in the 1/2MS solid state rheologies of additional 10-80mg/L concentration hygromycin
In, 25 ± 2 DEG C of cultivation temperature, intensity of illumination 1000Lx, screening and culturing 4 weeks under conditions of light application time 16h/d.Control embryo is cured
Injured tissue was cultivated in the culture medium without hygromycin after 4 weeks, and institute is a large amount of in a organized way to breed, and it is simultaneously adjoint that body embryo starts differentiation
The development for having Secondary embryos is formed；In 10 mg/L Hygromycin selection media, culture has 50% embryo callus after 4 weeks
Survival propagation, then browning is dead for remaining tissue；The material for having 10% after 4 weeks is handled in 40 mg/L Hygromycin selection medias to deposit
It is living, but growth is serious bad；The material that 4 weeks only 4% are handled in 60 mgL-1 Hygromycin selection medias is survived, almost without
Growth；80 mg/L and the whole brownings of the material of concentrations above processing are dead（Fig. 2）.Thereby determine that, Chinese catalpa embryo callus
The critical lethasl concentration of hygromycin is 60 mg/L.
（3）It is agriculture bacillus mediated to infect conversion embryo callus
The critical lethasl concentration of hygromycin of Chinese catalpa embryo callus is determined, is carried out by the agriculture bacillus mediated ultrasonication that is aided with
Conversion processing is infected, respectively using containingAHAGene（Different rhizoma arisaematis mannose-binding lectin gene）、LeaGene（Late period embryo
Tire rich protein）Plant expression vector（Fig. 3）Genetic transformation is carried out to Chinese catalpa embryo callus.Pass through infecting for 17 batches
Engineering bacterium solution OD600 values are resuspended for 0.5-0.6 in conversion and resistance screening, 1/2MS fluid nutrient mediums preferably, add in engineering bacterium solution
Plus 80 μm of ol/L acetosyringone, embryo callus, which infects, to be handled 30 minutes, the ultrasonication of 15 μm of amplitudes 3 minutes,
50mg/L hygromycin and 400mg/L carbenicillins are placed in as the selection culture of bacteria remover after being co-cultured 4 days under dark condition
Screened in base, the detection of later stage transient expression and PCR detections show that genetic transformation efficiency can be greatly improved.
(4) the PCR detections of reporter gene transient expression and regeneration plant
Embryo callus after co-cultivation, takes part sample to carry out the transient expression inspection of reporter gene after being thoroughly rinsed
Survey, is used as negative control, GUS prescription of its dyeing liquor is with reference to Jefferson etc. not infect the embryo callus of conversion（1987）
Method is modified slightly.
Found in transformation experiment, only pass through the agriculture bacillus mediated apposition growth for infecting Agrobacterium during conversion, co-cultivation
In confused situation aobvious, almost invisible, transformation efficiency is relatively low, and the tissue block of gus reporter gene expression is less, and expression rate is only
50.8% and patch is smaller；And by 15 μm of amplitude ultrasonications of 3 minutes while infecting, during co-cultivation substantially
It can be seen that the growth of the Agrobacterium of attachment, it should be on smooth embryo callus surface to produce wound by ultrasonication,
The deposit efficiency of Agrobacterium is greatly improved, and expression of the gus reporter gene in callus also demonstrates the lifting of transformation efficiency,
Reach 73.7%（Fig. 4, table 1）.
To selection culture obtain resistance regeneration plant enter performing PCR augmentation detection, using the genomic DNA of regeneration plant as
Template, wherein application target geneAHASpecific primer enter performing PCR augmentation detection, primer sequence is as follows：
SEQUENCE LISTING1：AHA-s：GGGCACCAACCACCTGCTGTCCG
SEQUENCE LISTING2：AHA-a：ACGCGACAATGGGGCGCTTCGAG
As a result show that 5 resistance regeneration plant samples obtain about 770bp length specificity fragments（Fig. 5：Note：Swimming lane 1-9 is resistance
Regeneration plant, 10 be wild type negative control, and 11 be plasmid positive control, and M is DL2000 molecular weight Marker）, AHA is converted
The PCR primer of strain carries out forward and reverse sequencing, and sequencing result and AHA gene orders are carried out into sequence ratio by DNAman softwares
Right, it is 95% as a result to show sequence identity（Fig. 6）, thereby determine that target gene is had been integrated into Chinese catalpa genome, set up Chinese catalpa
Genetic conversion system.
Module number and treatment scale described herein are the explanations for simplifying the present invention.To a kind of present invention-Chinese catalpa
The application of the construction method of genetic conversion system, modifications and variations is set to will be readily apparent to persons skilled in the art.
The difference of table 1 infects method for transformationGUSThe expression rate of reporter gene
Although embodiment of the present invention is disclosed as above, it is not restricted in specification and embodiment listed fortune
With it can be applied to various suitable the field of the invention completely, for those skilled in the art, can be easily real
Now other modification, therefore under the universal limited without departing substantially from claim and equivalency range, the present invention is not limited to
Specific details and shown here as the embodiment with description.
SEQUENCE LISTING
<110>SanXia University
<120>A kind of Chinese catalpa loses the construction method of transformation system
<130> 1
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213>Rhizoma arisaematis（Arisaema heterophyllum）
<400> 1
gggcaccaac cacctgctgt ccg 23
<210> 2
<211> 23
<212> DNA
<213>A kind of Chinese catalpa loses the construction method of transformation system
<400> 2
acgcgacaat ggggcgcttc gag 23
SEQUENCE LISTING
<110>SanXia University
<120>A kind of Chinese catalpa loses the construction method of transformation system
<130> 1
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213>Rhizoma arisaematis（Arisaema heterophyllum）
<400> 1
gggcaccaac cacctgctgt ccg 23
<210> 2
<211> 23
<212> DNA
<213>A kind of Chinese catalpa loses the construction method of transformation system
<400> 2
acgcgacaat ggggcgcttc gag 23
Claims (9)
1. a kind of Chinese catalpa loses the construction method of transformation system, it is characterised in that comprise the following steps：
1）The determination of the critical lethasl concentration of hygromycin of embryo callus：The embryo callus inoculation that Chinese catalpa rataria is induced
The culture statistics survival rate into the Selective agar medium of the hygromycin of additional various concentrations, the hygromycin for obtaining embryo callus faces
Boundary's lethasl concentration；
2）The agriculture bacillus mediated ultrasonication that is aided with carries out infecting conversion：Use the Agrobacterium engineering bacterium solution pair containing target gene
Embryonal connective tissue is carried out infecting conversion, and Sonication assisted treatment is carried out while infecting；
3）Infect the co-cultivation and selection culture of the embryo callus of processing：By step 2）Infect embryo callus subculture after conversion
Tissue, which is placed in proliferated culture medium, to be co-cultured, and transposition carries out the selection training of transformant in Selective agar medium after co-cultivation
Support, unconverted tissue will be killed by antibiotic in selection incubation, and the resistant calli and regeneration plant survived can
Carry out the conversion detection of next step；
4）The PCR detections of the reporter gene transient expression and regeneration plant of transformed calli：To passing through step 3）After co-cultivation
Embryo callus carry out reporter gene transient expression detection, to step 3）Select to obtain resistance regeneration plant in incubation
Performing PCR augmentation detection is entered in strain；
Complete the structure that Chinese catalpa loses transformation system.
2. according to the method described in claim 1, it is characterised in that：The step 1）Selective agar medium is 1/2MS solid state rheologies
Base adds 10-80mg/L hygromycin.
3. method according to claim 2, it is characterised in that：The step 1）The critical cause of hygromycin of embryo callus
Incubation time is 3 weeks in the determination of dead concentration.
4. according to the method described in claim 1, it is characterised in that：The step 2）The Agrobacterium engineering bacterium solution prepared is resuspended
In 1/2MS fluid nutrient mediums, bacterium solution OD600 values are 0.01-100 μm of ol/L acetyl cloves of addition in 0.4-0.7, engineering bacterium solution
Ketone, embryo callus, which is placed in engineering bacterium solution, infects processing 10-30 minutes, by engineering bacterium solution and callus while infecting
It is placed in 50ml centrifuge tubes and carries out ultrasonically treated, 15 μm of ultrasonic amplitude, sonication treatment time 1-5 minutes.
5. method according to claim 4, it is characterised in that：The step 2）In engineering bacterium solution prepare and infect conversion
Total time needed for processing is 2.5 days, wherein 2 days preparation engineering bacterium solutions, the 0.5 day time completes infecting in superclean bench and turned
Change, the embryo callus for completing to infect processing is co-cultured.
6. according to the method described in claim 1, it is characterised in that：The step 3）Co-cultivation is by through step 2）After infecting
Embryo callus is cultivated 2-5 days under dark condition, and selection culture is made in addition hygromycin and 400mg/L carbenicillins
To carry out the screening and culturing of transformant in the 1/2MS solid mediums of bacteria remover, hygromycin concentration in culture medium≤through step 1）
The critical lethasl concentration of embryo callus hygromycin of determination, the critical lethasl concentration of hygromycin is 60mg/L.
7. according to the method described in claim 1, it is characterised in that：The step 3）The middle co-cultivation time is 3 days, selection culture
Time is more than 4-8 weeks until obtaining resistant calli and regeneration plant.
8. according to the method described in claim 1, it is characterised in that：The step 3）Co-cultivation is the dark bar at 23-27 DEG C
Cultivated under part, the condition of selection culture is：23-27 DEG C of temperature, intensity of illumination 1000Lx, light application time 16h/d.
9. according to the method described in claim 1, it is characterised in that：The step 4）Reporter gene transient expression detection be by
It is placed in GUS dyeing liquors and is dyed after embryo callus rinsed clean after co-cultivation, PCR augmentation detections is with purpose
The genomic DNA of the specific primer antagonism regeneration plant of gene carries out Amplification Analysis, and whether it integrates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710331117.1A CN107058374A (en) | 2017-05-11 | 2017-05-11 | A kind of Chinese catalpa loses the construction method of transformation system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710331117.1A CN107058374A (en) | 2017-05-11 | 2017-05-11 | A kind of Chinese catalpa loses the construction method of transformation system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107058374A true CN107058374A (en) | 2017-08-18 |
Family
ID=59596873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710331117.1A Pending CN107058374A (en) | 2017-05-11 | 2017-05-11 | A kind of Chinese catalpa loses the construction method of transformation system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058374A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110305894A (en) * | 2019-06-29 | 2019-10-08 | 江苏省中国科学院植物研究所 | A kind of Chinese catalpa genetic transforming method rapidly and efficiently |
| CN115836647A (en) * | 2023-02-22 | 2023-03-24 | 中国林业科学研究院 | Method for regenerating catalpa bungei young embryo sterile induction plant |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5480789A (en) * | 1991-04-01 | 1996-01-02 | Florigene Europe B.V. | Genetically transformed rose plants and methods for their production |
| CN103088059A (en) * | 2013-01-31 | 2013-05-08 | 南京林业大学 | Efficient genetic transformation method of hybridized tulip tree |
| CN104561088A (en) * | 2014-10-23 | 2015-04-29 | 江苏师范大学 | Genetic transformation method for obtaining pinellia ternate transgenic callus |
| CN106561452A (en) * | 2016-10-21 | 2017-04-19 | 三峡大学 | Method for establishing catalpa bungei embryonal cell suspension system |
-
2017
- 2017-05-11 CN CN201710331117.1A patent/CN107058374A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5480789A (en) * | 1991-04-01 | 1996-01-02 | Florigene Europe B.V. | Genetically transformed rose plants and methods for their production |
| CN103088059A (en) * | 2013-01-31 | 2013-05-08 | 南京林业大学 | Efficient genetic transformation method of hybridized tulip tree |
| CN104561088A (en) * | 2014-10-23 | 2015-04-29 | 江苏师范大学 | Genetic transformation method for obtaining pinellia ternate transgenic callus |
| CN106561452A (en) * | 2016-10-21 | 2017-04-19 | 三峡大学 | Method for establishing catalpa bungei embryonal cell suspension system |
Non-Patent Citations (1)
| Title |
|---|
| 梁宏伟等: "根癌农杆菌介导hGLP1基因转化摩尔多瓦葡萄的研究", 《西北农业学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110305894A (en) * | 2019-06-29 | 2019-10-08 | 江苏省中国科学院植物研究所 | A kind of Chinese catalpa genetic transforming method rapidly and efficiently |
| CN110305894B (en) * | 2019-06-29 | 2023-01-31 | 江苏省中国科学院植物研究所 | Rapid and efficient catalpa bungei genetic transformation method |
| CN115836647A (en) * | 2023-02-22 | 2023-03-24 | 中国林业科学研究院 | Method for regenerating catalpa bungei young embryo sterile induction plant |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105112422B (en) | Gene miR408 and UCL is cultivating the application in high-yield rice | |
| CN104877993B (en) | Two kinds of plant eIF4A genes and its application for the water-fast cercosporiosis of rice poisonous plant body of prepare transgenosis | |
| CN113249229B (en) | Pseudocercosporus endophytic fungus P-B313 and application thereof | |
| CN109735562A (en) | A kind of construction method of the effective root system transgenic system of economic plants | |
| CN109385431A (en) | The application of OsERF2 gene regulation rice grain size | |
| CN108300735A (en) | A kind of Lilium tenuifolium efficient genetic trasformation system based on somatic embryo occur | |
| CN110295183A (en) | A method of citrus is improved to canker resistance based on CsPrx25 overexpression | |
| CN106480163A (en) | A kind of joint Fructus Mali pumilae callus cell culture and the method for genetic transformation identification Fructus Mali pumilae disease-resistant gene | |
| CN106636185B (en) | It is a kind of for potato haulm segment body embryo highly efficient regeneration and the culture medium and method of genetic transformation | |
| CN107058374A (en) | A kind of Chinese catalpa loses the construction method of transformation system | |
| CN106591145A (en) | Plectosphaerella sp. EF01 separated from root tuber of radix tetrastigme and application of Plectosphaerella sp. EF01 | |
| CN107406844A (en) | The transgenic rice plant of improvement | |
| CN107805632A (en) | OsMKK6 albumen and encoding gene are in the regulation and control developmental application of vegetable seeds | |
| CN107475287B (en) | Eggplant genetic transformation method | |
| CN107501399A (en) | Vitis davidii Foex transcription factor VdWRKY70 and its application in plant resistance to environment stress kind is cultivated | |
| CN102893869B (en) | Root tip detoxification and rapid propagation technology of strawberries | |
| CN107190019A (en) | A kind of agriculture bacillus mediated sinocalamus latiflorus method for transformation | |
| CN108588002A (en) | Obtain method of the millet for the embryo callus and genetic transformation of genetic transformation | |
| CN109022482A (en) | The method of TRV carrier mediated Gene Silencing systemic infection tree peony seedling | |
| Distabanjong et al. | Production of phytoplasma-free plants in sugarcane (Saccharum spp.) using temporary immersion bioreactor | |
| CN108396035A (en) | A kind of agriculture bacillus mediated rice transformation method | |
| CN104017823B (en) | Screening method for fast and effectively reducing false positive rate of peanut genetic transformation plant | |
| CN100334203C (en) | Establishent of acacia crassicarpa high efficiency transforming system induced by agricultural bacillus | |
| CN106171981A (en) | The preparation method of a kind of cross-pollinatd plant callus high frequency regeneration system and the application in genetic transformation thereof | |
| CN113755521A (en) | Construction method of agrobacterium-mediated strawberry sweet-charming genetic transformation system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |