CN107058371B - The method for improving Culm of Rice lodging tolerance using extensin - Google Patents
The method for improving Culm of Rice lodging tolerance using extensin Download PDFInfo
- Publication number
- CN107058371B CN107058371B CN201710034163.5A CN201710034163A CN107058371B CN 107058371 B CN107058371 B CN 107058371B CN 201710034163 A CN201710034163 A CN 201710034163A CN 107058371 B CN107058371 B CN 107058371B
- Authority
- CN
- China
- Prior art keywords
- rice
- extensin
- culm
- extl
- lodging tolerance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of methods for improving Culm of Rice lodging tolerance using extensin, are related to turning the technical field of molecular biology of extensin rice.This method is: OsEXTL gene cDNA is cloned from rice；Construct the genophore of the promoter containing Ubi, and 11 are spent in rice transformation, transgenic plant is obtained, transgenic paddy rice seed EXTL (oryza sativa EXTL) is deposited in China typical culture collection center on January 3rd, 2017, and deposit number is CCTCC NO:P201701.The present invention increases the expression quantity of OsEXTL gene in rice, and render transgenic Culm of Rice lodging tolerance improves 48%.
Description
Technical field
The present invention relates to the technical field of molecular biology for turning extensin rice more particularly to it is a kind of utilize extensin
The method for improving Culm of Rice lodging tolerance.
Background technique
Extensin (Extensin) is a kind of cell wall structure albumen, is generally made of a polypeptide chain, and is rich in hydroxyl
Proline residue [1] (Tierney et al., 1987).Extensin is widely present in plant cell wall, in entire plant
Boundary has expression [2] into high gymnosperm, angiosperm from single celled volvox, low bryophyte
(Merkouropoulos et al.,1999).Its proline residue can be by hydroxylating, and hydroxyproline and serine residue can quilts
Glycosylation, some type extensins also carry out intramolecular and intermolecular cross-linking reaction.It is raw that extensin is almost related to plant
The various aspects of long development, identification and fertilization [3] (Wu et al., 2001) including pollen, cell division and differentiation, cell are stretched
Long stopping [4] (Ito et al., 1998), aging and falls off [5] (Merkouropoulos et al., 2003), participates in life
Object reacts [6] (Showalter, 1993) etc. with abiotic stress.(2006) such as Wei [7] confirm the extensin in arabidopsis
The overexpression of Gene A tEXT1 limits the invasion of pathogen pseudomonas syringae.The mutation of arabidopsis AtEXT3, AtEXT18
Body normal plants be affected [8,9,10,11] (Hall et al., 2002；Cannon et al.,2008；Saha et
al.,2013；Choudhary et al.,2015).(2006) such as Roberts [12] overexpress AtEXT1 in arabidopsis, turn
Gene plant stem thickness increases, and the height of stem reduces.But it so far, there is no extensin to raising plant lodging tolerance
Report.
Bibliography:
1.Tierney M L, Varner J E.Review the extensins.Plant Physiol 1987；84:
1-2.
2.Merkouropoulos G, Barnett D C, Shirsat A H.The Arabidopsis extensin
Gene is developmentally regulated, is induced by wounding, methyl jasmonate,
abscisic and salicylic acid,and codes for aprotein with unusual motifs.Planta
1999；208(2):212-219.
3.Wu H, De G B, Mariani C, et al.Hydroxyproline-rich glycoproteins in
Plant reproductive tissues:structure, functions and regulation.Cellular and
Molecular Life Sciences 2001；58(10):1418-1429.
4.Ito M, Kodama H, Komamine A, et al.Expression of extensingenes is
dependent on the stage of the cell cycle and cellproliferation in suspension-
cultured Catharanthus roseus cells.PlantMolecular Biology 1998；36(3):343-351.
5.Merkouropoulos G, Shirsat A H.The unusual Arabidopsis extension gene
AtEXT1 is expressed throughout plant development and is induced by a variety
of biotic and abiotic stresses.Planta 2003；217(3):356-366.
6.Showalter A M.Structure and function of plant cell wall
proteins.Plant Cell 1993；5(1):9-23.
7.Wei,G.,and Shirsat,A.H.Extensin over-expression in Arabidopsis
limits pathogen invasiveness.Mol.Plant.pathol.2006；7,579-592.
8.Hall Q,Cannon MC.The cell wall hydroxyproline-rich glycoprotein RSH
is essential for normal embryo development in Arabidopsis.Plant Cell2002；14
(5):1161-72.
9.Cannon MC,Terneus K,Hall Q,Tan L,Wang Y,Wegenhart BL,et al.Self-
assembly of the plant cell wall requires an extensin scaffold.PNAS 2008；105
(6),2226-31.
10.Saha P,Ray T,Tang Y,Dutta I,Evangelous NR,Kieliszewski MJ,et
al.Self-rescue of an EXTENSIN mutant reveals alternative gene expression
programs and candidate proteins for new cell wall assembly in
Arabidopsis.Plant J,2013；75(1):104-16.
11.Choudhary P,Saha P,RayT,Tang YH,Yang D,Cannon MC.EXTENSIN18 is
required for full male fertility as well as normal vegetative growth in
Arabidopsis.Front Plant Sci 2015；6.
12.Roberts K,Shirsat AH.Increased extensin levels in Arabidopsis
affect inflorescence stem thickening and height.J Exp Bot 2006；57:537-45.
Summary of the invention
It is an object of the invention to overcome shortcoming and defect of the existing technology, a kind of utilization extensin raising is provided
The method of Culm of Rice lodging tolerance carries out genetic improvement to rice using transgenic technology, improves stalk energy resistant to lodging
Power does theoretical and technical exploration to improve plant mechanical support power.
The object of the present invention is achieved like this:
One, the method (abbreviation method) of Culm of Rice lodging tolerance is improved using extensin
This method includes the following steps:
1. cloning OsEXTL gene cDNA from rice
Coding sequence such as SEQ ID NO:1, cDNA length are 844bp；
2. constructing the genophore of the promoter containing Ubi, and 11 are spent in rice transformation, obtain transgenic plant, transgenosis
Rice paddy seed EXTL (oryza sativa EXTL) is deposited in China typical culture collection center (on January 3rd, 2017
Location: Wuhan, China Wuhan University postcode: 430072), deposit number is CCTCC NO:P201701；
3. transgenic paddy rice seed EXTL Post flowering 30 days of acquisition are carried out the measurement of stalk lodging tolerance.
The present invention has following advantages and good effect:
The expression quantity of increase OsEXTL gene in rice, render transgenic Culm of Rice lodging tolerance (Post flowering 30 days
Measurement) improve 48%.
Detailed description of the invention
Fig. 1 is the comparison picture for turning the lodging tolerance of OsEXTL trans-genetic hybrid rice stalk；
Fig. 2 is the building schematic diagram of plant expression vector.
Transgenic paddy rice seed EXTL (oryza sativa EXTL) is deposited in Chinese Typical Representative culture on January 3rd, 2017
(address: Wuhan, China Wuhan University postcode: 430072), deposit number is CCTCC NO:P201701 to object collection.
Specific embodiment:
It is described in detail with reference to the accompanying drawings and examples:
One, the clone of embodiment 1:OsEXTL gene cDNA
The cDNA that OsEXTL gene is cloned from rice, such as sequence 1, length 844bp；PCR product is by recycling, enzyme
It cuts, connects carrier.
--- synthetic primer expands the cDNA of OsEXTL (844bp includes CDS 519bp)
Forward primer: CGCGGATCCACGACCATTATTCCTCCTCCTC；
Reverse primer: CGGGGTACCGCCTGATAGAAAGCGACAACATG.
Two, embodiment 2: the building of expression vector
After the cDNA sequence of OsEXTL is connected carrier T, digestion is transferred to expression vector pUbi-ZH2, sees Fig. 2.
Three, embodiment 3: plant expression vector converts Agrobacterium
1, Agrobacterium activates
The Agrobacterium (EHA105) of preservation is drawn lines on solid LB media (added with antibiotic: Kan, if antibiosis is not added
Element is possible to cause the Ti-plasmids of these bacterial strains to lose, and Agrobacterium is caused to lack infectivity), antibiotic concentration are as follows: 50 μ g/
ML, 28 DEG C are cultivated 1-2 days, are then transferred on the new solid LB media added with antibiotic and are further cultured for 2 days；
2, the preparation of Agrobacterium competent cell
100 μ L are inoculated in 1mLLB fluid nutrient medium, 28 DEG C of shaken cultivations of 150rpm are stayed overnight；
Absorption 1mL bacterium solution, which is inoculated into 100mL fluid nutrient medium, cultivates to OD600=0.5；
Bacterium solution is set into 30min on ice, culture is made to be cooled to 0 DEG C；
4 DEG C, 5000rpm is centrifuged 30s, discards supernatant liquid；
Precipitating 60mL 0.1M CaCl2It suspends, ice bath 30min；
5000rpm is centrifuged 30s, discards supernatant liquid；
Contain the 20mMCaCl of 15% glycerol per effective 100 μ L2It suspends, for converting；
The competent cell prepared can use at once, can also be sub-packed in sterile centrifugation tube by every 200 μ L of pipe, in 4 DEG C
Save and used in 48 hours, when long-term storage must it is quick-frozen in liquid nitrogen after turn -80 DEG C of preservations, when use, takes out from -80 DEG C, sets
It is used after melting on ice.
3, DNA directly converts Agrobacterium
0.1~1 μ g of Plasmid DNA (5-10 μ L) is added in 200 μ L Agrobacterium competent cells, later ice bath 30min；
It is put into 7-8min in liquid nitrogen, is put into water-bath 5min in 37 DEG C of water-baths immediately after；
Centrifuge tube is taken out, places 2min on ice, is added 0.8mLLB, 28 DEG C, 3~4hr of 150rpm shaken cultivation；
Bacterium solution is taken out in coated plate on the LB plate of Kan antibiotic, is inverted culture, 2 days left sides under the conditions of 28 DEG C in the incubator
Right bacterium colony is visible.
4, recombinational agrobacterium is identified
Picking single colonie is inoculated in the LB liquid medium containing corresponding antibiotic, and 28 DEG C of shaken cultivations are stayed overnight；
It is a small amount of to extract Plasmid DNA, add GTE simultaneously plus 5 μ L lysozymes (50 μ g/mL, stock concentration are 50mg/mL or 10mg/
mL)；
Plasmid enzyme restriction or PCR identification.
Four, embodiment 4: the induction of Mature Embryos of Rice callus is broken up, takes root and method for transplanting
1, callus induces
By mature rice paddy seed decladding, aseptic water washing 3 times are first used, then with alcohol treatment 1 minute of 70%, frequently
It shakes；
It aseptic water washing 3 times, 30 seconds every time, shakes frequently；
0.1% mercuric chloride solution sterilizes 12 minutes (or 2.5%NaClO sterilizes 30min), shakes frequently；
It aseptic water washing 5 times or more, 30 seconds every time, shakes frequently；
Seed is placed on suck dry moisture in sterilizing filter paper, is then put on the induction medium；
28 DEG C, dark culture 4 weeks；
2, callus subculture
The embryo callus subculture for selecting glassy yellow, consolidation and relatively dry (is scattering into the callus on culture medium, not select from kind
The callus issued on son), dark lower culture 2 weeks, 28 DEG C of temperature is put on subculture medium；
3, preculture
The embryo callus subculture for selecting consolidation and relatively dry is put on pre-culture medium dark lower culture 4-14 days, 28 DEG C of temperature；
4, callus and Agrobacterium co-culture
1) Agrobacterium is cultivated
Preculture Agrobacterium two days, 28 DEG C of temperature on the LB culture medium with corresponding resistance selection；
Agrobacterium is transferred in the test tube with ground stopper or centrifuge tube equipped with suspension medium, Agrobacterium is resuspended, adjusts agriculture bar
The suspension of bacterium is to OD600For 0.8-1.0；
2) Agrobacterium is infected
The callus of preculture is transferred in the triangular flask to have sterilized；
Callus is impregnated 30 minutes in agrobacterium suspension；
(30min-1h) is dried up in transfer callus to the filter paper to have sterilized；
It is then placed on the co-cultivation base for being covered with one layer of filter paper and cultivates 3 days, 19-20 DEG C of temperature.
5, selection culture
The callus of co-cultivation is transferred in the triangular flask to have sterilized；
The water washing callus that sterilizes is to invisible Agrobacterium；
It is immersed in the aqua sterilisa of the carbenicillin containing 400ppm 30 minutes；
(1h or more) is blotted in transfer callus to the filter paper to have sterilized；
Shift selection culture 2 times, every time 2 weeks in callus to Selective agar medium.(first time carbenicillin screening concentration is
400ppm, second is 250ppm)；
6, differentiation culture
Kanamycin-resistant callus tissue is transferred on pre- differential medium at dark and is cultivated 5-7 days (can omit)；
In the callus to differential medium of the pre- differentiation culture of transfer, cultivated under illumination, 26 DEG C of temperature；
7, culture of rootage
Cut the root (staying 1-2mm) generated when differentiation；
It is then transferred in root media under illumination and cultivates 2 weeks, 26 DEG C of temperature；
8, it transplants
To height of seedling 10-12cm, root system occurs preferably, to open bottle cap, and the remaining medium washed off on root (is careful not to hurt
Root), in transplant flower pot.At initial several days, preservative film is coverd with, keeps moisture wet.
Five, embodiment 5: the identification of transgenic positive seedling
1, gene insertion identification
Detection primer: hygromycin universal primer and gene-specific primer；
2, expression identification
Gene specific primer.
Six, embodiment 6: paddy stalk measurement resistant to lodging
Assessment of indices resistant to lodging: the measurement of four section lodging index is carried out down with 30 days rice materials of Post flowering.Four sections lodge
Formula of index is as follows: lodging index=(fresh weight × plant height)/breaking force.Fresh weight: overground part pours in separately the above institute of four section base portions
There is weight (including stalk, blade, leaf sheath, tassel)；Plant height: four section base portions to fringe top length；Breaking force: by sample to be tested
Four horizontals are placed in the device that broadband degree is 5cm, using breaking force instrument (DIK 7401；Daiki,Osaka,Japan)
Breaking force measurement, the result is shown in Figure 1 are carried out to four sections.
<110>Hua Zhong Agriculture University
<120>method for improving Culm of Rice lodging tolerance using extensin
<140>
<141>
<160>3
<210>1
<211>844
<212>cDNA of OsEXTL gene
<400>
ACGACCATTATTCCTCCTCCTCTCTGGAGTCTAGTCTCCTCTCCTCACTCCTCACTCGCCCCACTCCG
CCGCTTCACTCGCGAGCTCGTCGTTGGCGCCGGCGGCAATGGCGTCCCCCCGCGCGCTCTCCCTCCTCCTCGTCCT
CCTGGGCATGGCCCTCGCGTCGTTCCCCTCCGCCGCCTCCGCCTCCCGCGACCTCCGCCCCCGCCGCGCGGGCTTC
GTCGTCCGCGGCCGCGTCTGGTGCGACACCTGCCTCGCCGGCTTCGAGACCCCCGCCTCCACCTACATCGCCGGAG
CGAAGGTAAAGGTTGAGTGCAGATCGAAATCCACTGGCGCCAAGACATGCAGCTTCGAGGGCCAGACTGACCACAC
TGGCACCTACAACATCCCTGTCAACGATGAGCATGAGCACGAGCTCTGCGAGTCTGTCCTTGTGAGCAGCCCGGAC
GCAAAGTGTGGCAAGATTGTTGCTGGACGGGAGAGGGCTCCTGTCTTCCTCACCAACAACAATGGTGTGACATCTA
ATGTTCGGTTGGCGAACGCTCTGGGCTTCCAGAAGGATGCTCCTCTTGCTGCGTGCGCACAAATCCTCAAGATGTA
CGAGGAAGTGGACGACCGCGTTTGAAGGATGTGAGTTATGTATCAATATTCGTACGTTGTTGAAATACTCTAAGAA
GACTTCTATATACCTTTTACTGAGAGCAAAACTATCAGCATCAGATGTTGCGTGCTTGATAAGTTGTGATATAGCT
TAGCACTTGAGTATGTTATATGTATGTTCGTCTGCAGCTGAACTGCAAAACTCATCAGTTACTAAATCGACATGTT
GTGCTTTCTATCAGGC；
<210>2
<211>31
<212>forward primer
<400>
CGCGGATCCACGACCATTATTCCTCCTCCTC；
<210>3
<211>32
<212>reverse primer
<400>
CGGGGTACCGCCTGATAGAAAGCGACAACATG。
Claims (1)
1. a kind of method for improving Culm of Rice lodging tolerance using extensin, it is characterised in that:
1. cloning OsEXTL gene cDNA coding sequence from rice as shown in SEQ ID NO:1, cDNA length is
844bp；
2. constructing the genophore of the promoter containing Ubi, and 11 are spent in rice transformation, obtain transgenic plant, transgenic paddy rice
Seed is rice EXTL (oryza sativa EXTL)；
3. carrying out within 30 days the measurement of stalk lodging tolerance after the plant blossom that the transgenic paddy rice seed EXTL of acquisition is grown.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710034163.5A CN107058371B (en) | 2017-01-18 | 2017-01-18 | The method for improving Culm of Rice lodging tolerance using extensin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710034163.5A CN107058371B (en) | 2017-01-18 | 2017-01-18 | The method for improving Culm of Rice lodging tolerance using extensin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107058371A CN107058371A (en) | 2017-08-18 |
| CN107058371B true CN107058371B (en) | 2019-11-05 |
Family
ID=59599256
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710034163.5A Active CN107058371B (en) | 2017-01-18 | 2017-01-18 | The method for improving Culm of Rice lodging tolerance using extensin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058371B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110343158B (en) * | 2019-08-06 | 2021-04-06 | 中国水稻研究所 | Rice half-leaf roll gene SRL10 and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102432679B (en) * | 2011-12-12 | 2014-03-05 | 华南农业大学 | Rice extensin OsPEX1 and application thereof |
-
2017
- 2017-01-18 CN CN201710034163.5A patent/CN107058371B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107058371A (en) | 2017-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110904122B (en) | Apple drought-resistant gene MdbHLH130 and application thereof | |
| CN109797157B (en) | Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application | |
| CN106868023B (en) | Cucumber CsERF004 gene and coding protein and application thereof | |
| CN113444731B (en) | MYB transcription inhibitory factor LrETC1 related to synthesis of lycium ruthenicum anthocyanin and application thereof | |
| CN103145817B (en) | Sickle-alfalfa chloroplast cold-response protein (MfcpCOR14) and coding gene and application thereof | |
| CN113621040B (en) | Du pear salt-tolerant gene PbHSF3A and application thereof in plant salt-tolerant genetic improvement | |
| CN109762795A (en) | A kind of relevant Sesame SiGolS2 of drought resisting and its application | |
| CN107058371B (en) | The method for improving Culm of Rice lodging tolerance using extensin | |
| CN101880674B (en) | Date tree aquaporin gene and application in improvement on plant drought resistance and salt resistance | |
| CN112175987B (en) | Application of cucumber light-harvesting chlorophyll a/b binding protein CsPS1 in resisting melon epidemic disease | |
| CN111778226B (en) | Plasma membrane H related to alkali stress resistance of rice+-ATPase proteins and uses thereof | |
| CN103951740B (en) | Bermuda grass CCAAT transcription factor CdtNF-YC1 as well as coding gene and application thereof | |
| CN103045637B (en) | Application of plant-root specifically-expressed Bt-cry6A crystal protein in prevention and treatment of root-knot nematodes | |
| CN105713078B (en) | Application of the drought resistant correlative protein in regulation plant drought resistance | |
| CN105175522B (en) | Crowtoe AP2/ERF transcription factors and its encoding gene and application | |
| CN105254730B (en) | A kind of albumen improving plant salt tolerance drought tolerance and its encoding gene and application | |
| CN103602688A (en) | Helianthus tuberosus L. Na<+>/H<+> reverse transport protein genes HtNHX1 and HtNHX2 and use thereof | |
| CN103421829A (en) | Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1 | |
| CN103451191B (en) | Fortunella crassfolia FcSILP gene and application thereof for improving plant adverse resistance | |
| CN102260339B (en) | Rice OsWRKY7 protein, and encoding gene and application thereof | |
| CN102417911B (en) | Method for over-expressing brassica napus BnLAS gene for improving plant drought resistance | |
| CN107602694B (en) | Trichoderma reesei metallothionein TrCRD2S, encoding gene and its application in heavy metal resistance plant is cultivated | |
| CN105462991A (en) | bZIP1 gene of oryza granulata | |
| CN111187784A (en) | Use of aminoacylase-1 | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |