CN107058342B

CN107058342B - Regulate and control clone and the application of the key gene SlALMT9 of tamato fruit apple acid accumulation

Info

Publication number: CN107058342B
Application number: CN201710475130.4A
Authority: CN
Inventors: 叶志彪; 叶杰; 李汉霞; 张余洋
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2017-06-21
Filing date: 2017-06-21
Publication date: 2019-11-08
Anticipated expiration: 2037-06-21
Also published as: CN107058342A

Abstract

The invention belongs to field of plant genetic project technology.Clone and application more particularly to the key gene SlALMT9 of regulation tamato fruit apple acid accumulation.The cDNA sequence for the SlALMT9 gene that the present invention clones is as shown in sequence table SEQ ID NO:1, and for the protein sequence of gene coding as shown in SEQ ID NO:2, which includes the promoter sequence in function mutation site as shown in SEQ ID NO:3.SlALMT9 gene has significant function in terms of regulating and controlling tamato fruit apple acid accumulation, while the gene can mediate root system secretion malic acid to resist influence of the aluminium poison to root system of plant in acid soil.Therefore, which can improve in Tomato Quality and be applied in terms of resistance to.

Description

Regulate and control clone and the application of the key gene SlALMT9 of tamato fruit apple acid accumulation

Technical field

The invention belongs to field of plant genetic project technology.Regulate and control the pass of tamato fruit apple acid accumulation more particularly to one The clone of key gene SlALMT9, Function Identification and application.Group's separation analysis is combined by whole-genome association (GWAS) The SlALMT9 that method (BSA) navigates to has significant function in terms of regulating and controlling tamato fruit apple acid accumulation, while the gene can To mediate root system secretion malic acid to resist influence of the aluminium poison to root system of plant in acid soil.Therefore, which can be in tomato Quality-improving is especially applied in terms of resistance to.

Technical background

It either eats tomato raw or processing tomato, the flavor of fruit is even more important to consumer.Tamato fruit flavor product Matter is mainly determined that wherein malic acid is organic as highest two kinds of content in tamato fruit by sugar acid content in fruit and sugar-acid ratio One of acid directly affects the flavor of fruit.Compared with citric acid, malic acid has tart flavour soft tasty and refreshing, the features such as heat is low, more Meet the requirement (Wu Junlin etc., 2014) of high-grade cooking culture.Meanwhile malic acid is as product in important metabolism, is three Important intermediate and CO during carboxylic acid recycle (TCA circulation) and its branch glyoxalic acid cyclic metabolism₂Fixed reaction Intermediate product participates in bioenergetic metabolism.In addition, plant can secrete malic acid by root system to increase in acid soil The resistance (Hoekenga et al.2006) of aluminium poison.Malic acid is also the important component of malate aspartate shuttle, ginseng With maintain osmotic pressure and charge balance, and then regulate and control the switch of plant stomata.For humans and animals, malic acid can be effective Locomitivity is improved, with antifatigue, cardioprotection, the metabolism of promotion carboxylate, promotion mitochondrial respiratory, improves memory energy Power, reduces the physiological functions such as anticancer drug toxic side effect at the activity for enhancing calcium.Therefore, malic acid content in tamato fruit is improved It is one of domestic and international main breeding objective.

Malic acid only has left-handed spiral configuration with the presence of 3 kinds of forms, i.e. D-malic acid, DL-malic acid and L MALIC ACID L MALIC ACID just has bioactivity.It is all the L MALIC ACID for having bioactivity present in most animals and plants.Fruit is thin The accumulation of malic acid is interacted regulation by subcellular organelle each in cell in born of the same parents, at the same external environment for example moisture, mineral nutrition, Temperature also influences the accumulation of malic acid in fruit.Forefathers are studies have shown that the main reason for malic acid content generates difference in fruit It is caused by own metabolism difference, main includes the synthesis and degradation (Sweetman et al.2009) of malic acid.It is first First, the phosphoenolpyruvate (PEP) that glycolysis generates is reversible under the action of phosphoenolpy ruvate carboxy kinase (PEPC) Oxaloacetic acid is formed, subsequent oxaloacetic acid is in the lower formation malic acid of malic dehydrogenase (NAD-cytMDH), this process It is completed in cytoplasm.During developmental stages of grape berry, to PEPC in transcriptional level and enzyme activity horizontal analysis, the results showed that PEPC has a significant impact malic acid content.Overexpression MdcyMDH gene results in malic acid, fructose and sucrose in apple The increase of content, while the up-regulated expression of malic acid related gene is also resulted in, illustrate that NAD-cytMDH directly takes part in apple The synthesis of acid.In the fruit maturation later period, fruit will appear the transformation for running up to sucrose accumulation from organic acid, this transition process It is to be realized by gluconeogenesis approach.More crucial enzyme includes phosphoenolpy ruvate carboxy kinase during anaerobic digestion (PEPCK) and malate dehydrogenase (NADP-cytME).Research shows that mainly due to PEPCK in the cultivation apple of low malic acid content Caused by active reduction.NADP-cytME is had also discovered in some species takes part in malic acid in the fruit development later period simultaneously Degradation.Although the research of the approach and its related gene of malic acid synthesis and degradation is clearer, as malic acid is this kind of The accumulation of metabolin can not only be explained with the function of structural gene completely.

Most saccharic acid is accumulated in vacuole in fruit, thus in vacuole malic acid storage to apple in fruit Acid accumulation is particularly important.The malic acid synthesized in cytoplasm exists in the form of dianion, and is transported in vacuole, Its efficiency transported is influenced by the potential gradient of pH in vacuole and tonoplast both sides.Transhipment of the malic acid to vacuole is to pass through Transport protein on tonoplast is realized.In model plant arabidopsis, in vacuole protein called membrane transporters (AttDT) mediated cytosolic Malic acid the content of malic acid in blade is influenced to vacuolar transport.In the recent period, also some researches show that another kind of malic acid to turn Transport the transhipment of malic acid in albumen (ALMT) energy mediated plant.ALMT protein family is the distinctive albuminoid of plant, N-terminal 5~7 transmembrane regions are generally comprised, C-terminal then forms hydrophilic tail portion (Delhaize et al.2007).In acid soil ring In border (pH < 5.5), aluminium ion (Al³⁺) can be released from silicate or oxide, it is dissolved into the soil liquid, to lure The expression of ALMT gene is led, and then the transport for activating malic acid outside is malicious to resist aluminium.In crops such as wheat, arabidopsis, wild cabbages In cloned similar ALMT gene in succession.But similar malic acid transport protein is in the important garden crop such as tomato Also it is rarely reported.

Tomato is the mode crop for studying berries fruit development, cultivar as important garden crop S.lycopersicum LA1706 and two wild species S.pimpinellifolium LA1589 and S.pennellii The genome sequencing result of LA0716 has delivered (Tomato Genome Consotium2012；Bolger et al.2014).A large amount of genome, transcript profile, metabolism group information can use (http://solgenomics.net/, http://ted.bti.cornell.edu/).But utilize application of the association analysis data mining duty gene in tomato just Starting.The association analysis that the Core Germplasms that this project resurveys sequence using 360 parts carry out full-length genome navigates to a regulating apple The QTL of acid content, and verifying has been carried out to this site by linkage mapping and further determined candidate gene SlALMT9.Into One step using the technological means such as bioinformatics and molecular biology to the mechanism of action of the function of the gene and mutational site into Row parsing.The gene cloned in the invention will lay the foundation for tomato in China quality genetic improvement and Aluminum Tolerance in Plants breeding.

Summary of the invention

It is an object of the invention to overcome the deficiencies of existing technologies, the pass of a regulation tamato fruit apple acid accumulation is provided The clone of key gene SlALMT9 and application.The regulation tamato fruit that the present invention is obtained by GWAS combination BSA technology clone The key gene (SlALMT9) of apple acid accumulation, (segment is named as a crucial insertion/deletion in the gene promoter Indel_3) segment is the main reason for leading to malic acid content difference in natural population.Using transgenic technology, to SlALMT9 Function of the gene in terms of tamato fruit malic acid regulation is verified.For function mutation site indel_3, present invention exploitation One molecular labeling is used for the assisted Selection of Tomato Quality breeding (malic acid).

The present invention is implemented as follows:

The present invention by the tomato Core Germplasms collected using 272 parts of global ranges and high malic acid material TS-40 with it is low Malic acid material TS-66 constructs a F2 segregating population (specific implementation step is shown in embodiment 1), using GWAS combination BSA technology, Clone obtains SlALMT9 gene from tomato.SlALMT9 belongs to the malic acid transport protein family of aluminium activation, in apple The malic acid controlling gene Ma of report belongs to the same family, the cDNA sequence of the gene as shown in sequence table SEQ ID NO:1, It includes 1680 base-pairs；For the amino acid sequence that it is encoded as shown in SEQ ID NO:2, it encodes 559 amino acid；The base Because promoter sequence is as shown in SEQ ID NO:3, it includes the insertion/deletion of 3 bases.The present invention utilizes clone's The different genotype of SlALMT9 gene converts tomato, and function mutation site has been determined according to the variation of malic acid content in fruit indel_3.For the function mutation site, devises a CAPS and mark gene for detecting SlALMT9 in tomato material Type, and then the assisted Selection of the quality breeding for tomato.

More detailed technical solution is shown in that " specific embodiment " is described.

Detailed description of the invention

Sequence table SEQ ID NO:1 is the cDNA sequence of SlALMT9 gene.Sequence length is 1680bp, pair of the gene The amino acid sequence answered is as shown in 1-1680 bit sequence in sequence table SEQ ID NO:1.

Sequence table SEQ ID NO:2 is the protein sequence of SlALMT9 gene coding.Encode 559 amino acid residues.

Sequence table SEQ ID NO:3 is the nucleotide sequence of indel_3-based CAPS label, and sequence length is 748bp。

Fig. 1: being the content of malic acid in tomato natural population and hybrid Population fruit.Description of symbols: a in Fig. 1 Figure is the distribution of malic acid content in tomato natural population；B figure in Fig. 1 is hybrid Population parent and F₁Malic acid in fruit Content；C figure is hybrid Population F in Fig. 1₂The distribution of malic acid content in filial generation fruit.

Fig. 2: being the key gene of GWAS combination BSA positioning regulation tamato fruit malic acid content.Description of symbols: figure A figure in 2 is the Manhattan figure of whole-genome association；B figure in Fig. 2 is No. six and dyes upper candidate section (41.3M- Association analysis 41.4M).Position shown in red boxes is candidate SlALMT9 gene；C figure in Fig. 2 is full-length genome The Δ SNP index of BSA sequencing result is analyzed；D figure in Fig. 2 is the Δ SNP of the upper candidate section (36M-45.6M) of No. six dyeing Index analysis.

Fig. 3: being the structural analysis of SlALMT9 gene.Description of symbols: a figure in Fig. 3 is SlALMT9 base in NCBI Because of conserved structure domain analysis；B figure in Fig. 3 is the cDNA of PCR amplification SlALMT9 gene, illustrate Solyc06g072910 with Solyc06g072920 is a gene.

Fig. 4: being the structure variation of different genotype tomato materials A LMT9 gene.Description of symbols: a figure in Fig. 4 is Wild-type tomato ALMT9 gene structure；B figure in Fig. 4 is low malic acid cultivated tomato ALMT9 gene structure；C figure in Fig. 4 is High malic acid cultivated tomato ALMT9 gene structure.

Fig. 5: being the building of different genotype ALMT9 expression vector.Description of symbols: a figure in Fig. 5 is PHELLSGATE8 carrier figure；B figure in Fig. 5 is different SlALMT9 genotype；C figure in Fig. 5 is building different genotype The genetic transformation carrier of ALMT9.

Fig. 6: the influence of different genotype ALMT9 gene pairs tamato fruit malic acid content.

The building of Fig. 7: CRISPR/Cas9 binary vector pTX.Description of symbols: a figure in Fig. 7 is pBin19 carrier Figure；B figure in Fig. 7 is the schematic diagram of pTX-SlALMT9 carrier.

Fig. 8: being the influence that ALMT9 gene pairs tamato fruit malic acid content is knocked out using CRISPR/Cas9 technology.Attached drawing Description of symbols: a figure in Fig. 8 is the schematic diagram that double target spot sgRNA (red arrow) knock out ALMT9 gene；B figure in Fig. 8 is Three CRISPR/Cas9 knock out T₀In strain at ALMT9 Gene Double target spot sequence variation；C figure in Fig. 8 is to utilize CRISPR/Cas9 knocks out T₀Fruit malic acid content in strain.

Fig. 9: being aluminum ions response under ALMT9 gene pairs acid condition.Description of symbols: a figure in Fig. 9 is excess SlALMT9 genes amplification tomato plant is expressed to the tolerance of aluminium poison；B figure in Fig. 9 is overexpression SlALMT9 genes amplification The secretion of Tomato Root System malic acid.

Molecular diversity analysis of Figure 10: the ALMT9 gene in tomato domestication and improved, process.Description of symbols: figure A figure in 10 is wild-type tomato (PIM), ALMT9 gene promoter and coding in cherry and tomato (CER) Ji great Guo tomato (BIG) Area's nucleotide diversity (π), gray line mark is that insertion/deletion marks [indel_3 (GTC/-)] in promoter, in second Containing the nonsynonymous mutation SNP6 (A/ in the LTR retrotransposon (CopiaSL_37) and the 5th exon in son G)；B figure in Figure 10 is wild-type tomato and cherry and tomato (blue line), cherry and tomato and big fruit tomato (red line) nucleotide diversity (π) frequency analysis.

Figure 11: being for the CAPS label of function mutation insertion/deletion label indel_3 exploitation and its in tomato business product Application in kind.Description of symbols: a figure in Figure 11 is will to include first using SlALMT9 gene promoter special primer The sequence amplification of indel_3 comes out, and is then identified using II digestion of Hin1, SlALMT9 gene is divided into three kinds of genotype ALMT9/ALMT9 (two band of 542bp and 242bp), ALMT9/almt9 (tri- band of 784bp, 542bp and 242bp) and Almt9/almt9 (mono- band of 784bp)；B figure in Figure 11 is that the malic acid of fruit in different ALMT9 genotype tomato materials contains Amount；C figure in Figure 11 is shown can be well by 73 parts of tomato commercial varieties using indel_3-based CAPS label (F₁Hybrids genotype) is corresponding with malic acid content.

Specific embodiment

More detailed description is made to the present invention below in conjunction with specific embodiment.According to description below and these implementations Example, those skilled in the art can determine essential characteristic of the invention, and without departing from spirit and scope of the invention the case where Under, various changes and modifications can be made to the present invention, so that it is applicable in various uses and condition.

Embodiment 1: tomato material fruit apple acidity test of the present invention

The reagent that apple acidity test is used includes；Solution 1:200mM Tricine-KOH PH 9.0-10 (17.9g/ 500ml adjusts pH value with KOH powder)；7.5 solution of solution 2:50mM Tris-HCl PH；Solution 3:20mMNAD+；54.3mg It is dissolved in 3.785ml solution 2；Solution 4:5X MTT (thiazolyl blue)；36.3mg is dissolved in 10.43ml solution 2；Solution 5: 100X PES (Sigma, P4544)；4.68mg is dissolved in 0.5ml solution 2；Solution 6: malic dehydrogenase (MDH, purchased from upper Hai Shenggong bioengineering Services Co., Ltd, article No. M0373), it is spare to be made into 0.25U/l；Standard solution: ddH is used₂O is prepared 0.5g/l malic acid standard solution (being purchased from Sigma company, article No. MW 134.09) is spare.

Tomato sample fruit malic acid extraction step is divided into the present invention: 1. with liquid nitrogen by fruit sample grind into powder, Each 3 pipe of sample packing, 100-200mg claim sample with assay balance, record the weighed weight of sample；2. adding in every pipe sample Enter trichloroacetic acid (TCA) 1ml that mass volume ratio is 6%, is vortexed and mixes, in extracting 30min on ice；3.4 DEG C, 12,000r/ Min is centrifuged 15min；4. supernatant to be transferred to new 1.5ml centrifuge tube, it is put into -80 DEG C, it is to be measured.

The present invention uses microplate reader Infinite M200 (being purchased from Tecan company, Switzerland) measurement tamato fruit The content of middle malic acid.According to the form below adds various solution:

A0 is read under 5min after sample blending (after stablizing), 570nm, MDH enzyme solutions (0.25U/ μ l) 10 μ l is added, mixes Even, 30 DEG C of placement 30-50min read A1, calculate malic acid content according to curve.

Embodiment 2: the positioning of SlALMT9 gene of the present invention

The present invention is right in 272 tomato varieties using the 5.5M high quality SNP (MAF > 0.05) of the exploitation such as Lin (2014) Fruit malic acid is associated analysis.GWAS uses the compression mixed linear model (cMLM) in TASSEL4.052 software. The P-value threshold value of SNP is set as 1.8 × 10-7 (P=1/n in GWAS；The SNP sum that n=is used).The present invention is based on tomato bases Because group sequence version SL 2.40 (http://solgenomics.net/) identifies the physical location of SNP (see Fig. 2 a, b).Mirror It in fixed unique candidate section, shares 24 genes and is located at LeadSNP upstream and downstream 50kb, wherein closest to two of LeadSNP ALMT gene is considered as most probable candidate gene (table 1).

Table 1 and the gene in the significant relevant each 50kb of LeadSNP upstream and downstream of fruit malic acid content

In the present invention, applicant with S.lycopersicum var.cerasiforme CR250 tomato TS40 (quoted from U.S. Tomato Germplasms center, i.e. TGRC:http: //tgrc.ucdavis.edu/) it is female parent, with low malic acid content S.lycopersicum var.cerasiforme LA1388 tomato TS66 (quoted from U.S. Tomato Germplasms center, Http:// tgrc.ucdavis.edu/) it is that male parent is hybridized, F1 fruit sample and seed are obtained, allows and F1 plant selfing and receives F2 is obtained for seed (for conventional method).Then sowing F2 group carries out apple acidity test to 350 filial generations of F2 group, each Three repetitions of single plant.Each single plant base is extracted from fresh tomato leaf using routine CTAB method (Roger&Bendich, 1988) simultaneously Because of a group DNA.Each 40 parts of individual material sample for picking out extreme high, extremely low malic acid content, use NanoDrop 2000 The DNA obtained in extreme 40 parts of high, extremely low materials is subjected to mixed in equal amounts respectively to after the concentration mensuration of wherein DNA.It is right Two extreme apple acid-mixed ponds (pond HM and the pond LM) are sequenced, and each mixed pond includes 40 extreme malic acid single plants, Mei Gechi Sequencing depth be 40 ×.The pond HM is averaged malic acid content as 12.84mol/g fresh wt-1, is that the pond LM malic acid averagely contains Measure four times or more of (3.08mol/g fresh wt-1).It will be short using Burrows-Wheeler Aligner (BWA) 47 Reads and reference genome (releaseSL2.40) compare, and identify SNP using SAMtools48.Select two parental genes The SNP of value >=20 SNP quality is used to further analyze simultaneously for value >=20 base quality between group.It is based on The SNP quantity that these standards and reading depth are 4 to 200, is with reference to genotype, respectively to high apple acid-mixed pond with parent TS40 Genotype frequency index (index) analysis is carried out with low apple acid-mixed pond.The SNP index in high apple acid-mixed pond subtracts low apple The SNP index in acid-mixed pond obtains Δ SNP index.On each chromosome, using 1M length as sliding window, step is 10kb length is slided from small to large by coordinate, calculates the average value of every Mb window interior index.The present invention, which also calculates, not to be had The statistics confidence interval of Δ SNP index under the null hypothesis of QTL.For each position, obtained according to the method for the descriptions such as Takagi 95% confidence interval of Δ SNP index.Based on the difference of the gene frequency between two ponds, tamato fruit malic acid content Candidate section is located in the section (36Mb-45.6Mb) of a 9.6Mb on No. 6 chromosomes, determines in GWAS with applicant Section it is consistent (Fig. 2 c, d).

There is a significant peak value and illustrates that there are a main effect QTLs to regulate and control tomato fruit in this site in Δ SNP index The accumulation of malic acid in reality (see Fig. 2).The present invention further confirms that applicant is logical to the linkage mapping of TS-40 × TS-66 group Cross it is that GWAS is obtained the result shows that, there are the candidate genes of regulating fruit malic acid content natural trend on the 6th chromosome SlALMT。

The sequence of embodiment 3:SlALMT9 gene is analyzed

According in NCBI to the ALMT gene (Solyc06g072910 and Solyc06g072920) of candidate region two into Row Blastp, thus it is speculated that the two ALMT genes may be a gene.Further design respectively include Solyc06g072910 and The PCR primer of Solyc06g072920 overall length: Solyc06g072910 (forward primer: 5'CGGAAATCGACCTGATTCCTA 3', reverse primer: 5'ATAATTGAACATCTTGTAAtGGC 3')；Solyc06g072920 (forward primer: 5' ATGGCCATTACAAGATGTTCAAT 3', reverse primer: 5'GATGAGCATTCGCACAAATAGAA3'), with tamato fruit CDNA is that template carries out PCR amplification: PCR reaction system: 20 μ L of total volume.10×PCR Buffer 2.0μL,dNTP (10mmol/ μ L) 0.4 μ L, positive each 0.4 μ L of anti-primer, DNA profiling (100-200ng/ μ L) 1.0 μ L, Taq enzyme (5U/ μ L) 0.1 μ L, supplying 20 μ L with ddH2O, (primer is synthesized by Beijing Tian Yihuiyuan Biotechnology Co., Ltd, Buffer, dNTP and Taq enzyme purchase From Beijing Quanshijin Biotechnology Co., Ltd)；PCR response procedures: 94 DEG C of initial denaturation 3min, 94 DEG C of denaturation 30s, 56 DEG C are annealed 30s, 72 DEG C of extension 1min30s carry out 35 circulations, 72 DEG C of extensions 10min, 4 DEG C of preservation 10min；Detected through gel electrophoresis: PCR Product is with 1% agarose added with EB (ethidium bromide), electrophoresis 30min, final result are coagulating under 100-120V voltage conditions It is shown in glue imaging system.As a result prove that the two ALMT genes are strictly a gene, inside is containing in a 3708bp SlALMT9, GenBank accession number:KY094467 are named as (see Fig. 3) containing son.The present invention, which transfers, resurveys ordinal number According to the sequence of SlALMT9 gene in middle candidate region (chromosome 6:41,3Mb-41,4Mb), Geneious software is further utilized In MUSCEL Alignment analyze SlALMT9 gene in different materials (wild-type tomato, cherry and tomato, big fruit tomato) As a result sequence variations are shown in Fig. 4.

Embodiment 4: the vector construction and genetic transformation of different genotype SlALMT9

The present invention for SlALMT9 gene promoter insertion/deletion label indel mutation and the 5th exon it is non- SlALMT9 gene is divided into 5 kinds of genotype (see Fig. 5 b) by same sense mutation.Wherein: genotype I includes low malic acid tomato material (TS66) 2.7-kb promoter adds the overall length gDNA of 6.3-kb；Genotype II includes low malic acid tomato material (TS66) 2.7-kb promoter increases the full-length cDNA of malic acid tomato material (TS40) 1.8-kb；Genotype III includes high malic acid tomato The 2.7-kb promoter of material (TS40) adds the full-length cDNA of low malic acid tomato material (TS66) 1.8-kb；Genotype IV includes The 2.7-kb promoter of high malic acid tomato material (TS40) adds the overall length gDNA of 6.3-kb；Genotype OX includes 35S promoter Increase the 6.3-kb overall length gDNA of malic acid material (TS40).Genotype I and IV is to utilize promoter specific forward primer 5' TGCATCCAACGCGTTGGGAGCTC TGCGTTTGATCTTCTGCTCATT 3' and full length gene specific reverse primer 5' TCTCATTAAAGCAGGACTCTAGA CTAGAAGTTCGCTGCCTCTGCTG3', respectively with the material of different malic acid contents The gDNA of sample TS66 and TS40 (quoted from U.S. Tomato Germplasms center, http://tgrc.ucdavis.edu/) are mould Plate carries out PCR amplification acquisition with Phanta enzyme (being purchased from Nanjing Vazyme Biotechnology Co., Ltd.).Genotype II and III is Utilize promoter special primer: forward primer 5'TGCATCCAACGCGTTGGGAGCTC TGCGTTTGATCTTCTGCTCATT 3', reverse primer 5'CTCAATGGCGCCGCCAT TTTGTTATGTGAGATGAACTACC 3' and full length gene specifically draw: just To primer 5'TCATCTCACATAACAAA ATGGCGGCGCCATTGAGCCAAAACT 3', reverse primer 5' TCTCATTAAAGCAGGACTCTAGA CTAGAAGTTCGCTGCCTCTGCTG 3', respectively with the material of different malic acid contents The gDNA and cDNA of sample TS66 and TS40 (quoted from U.S. Tomato Germplasms center, http://tgrc.ucdavis.edu/) For template, PCR amplification acquisition is carried out with Phanta enzyme (being purchased from Nanjing Vazyme Biotechnology Co., Ltd.).Genotype OX is Utilize full length gene special primer: forward primer 5'CATTTGGAGAGGACACGCTCGAGATGGCGGCGCCATTGAGCCAAA ACT 3', reverse primer 5'TCTCATTAAAGCAGGACTCTAGA CTAGAAGTTCGCTGCCTCTGCTG 3', with high apple The gDNA of the sample of material TS40 (quoted from U.S. Tomato Germplasms center, http://tgrc.ucdavis.edu/) of acid content For template, PCR amplification acquisition is carried out with Phanta enzyme (being purchased from Nanjing Vazyme Biotechnology Co., Ltd.).All PCR Product is detected through 1% Ago-Gel, with QIAquick Gel Extraction Kit (being purchased from Beijing Quanshijin Biotechnology Co., Ltd) recycling purpose Segment.It is unloaded (Fig. 5 a) with SacI+XbaI double digestion pHELLSGATE8, gel extraction carrier framework and with genotype I, II, III SlALMT9 genetic fragment progress homologous recombination with IV obtains the recombinant expression carrier of different genotype SlALMT9 gene GATE8-SlALMT9 I, GATE8-SlALMT9 II, GATE8-SlALMT9 III and GATE8-SlALMT9 IV (Fig. 5 c).Use XhoI+ XbaI double digestion pHELLSGATE8 is unloaded (Fig. 5 a), gel extraction carrier framework and the SlALMT9 genetic fragment with genotype OX It carries out homologous recombination and obtains recombinant expression carrier GATE8-SlALMT9OX (Fig. 5 c).Homologous recombination reaction system: by the 1 bis- enzymes of μ l The pHELLSGATE8 plasmid of tangent linearization and the mixing of 1 μ l different genotype amplified fragments, are added the ExnaseTM II, 2 μ l of 1 μ l 5xCE II buffer, finally with ddH2O polishing to 10 μ l.Ice bath 5min, heat shock method convert T1 immediately after 37 DEG C of reaction 30min Competent cell (is purchased from Beijing Quanshijin Biotechnology Co., Ltd), carries out bacterium colony PCR to monoclonal and identifies positive colony, uses To primer be: forward primer 5'TGCATCCAACGCGTTGGGAGCTC TGCGTTTGATCTTCTGCTCATT 3' reversely draws Object 5'TCTCATTAAAGCAGGACTCTAGA CTAGAAGTTCGCTGCCTCTGCTG3'.Extract PCR positive colony plasmid into (kit that a small amount of methods extract plasmid is purchased from Beijing Quanshijin Biotechnology Co., Ltd to row sequence verification, and specific procedure is shown in this The specification of kit；Sequencing is completed by Tian Yihuiyuan company).Vector construction process is shown in Fig. 5, which is Spectinomycin (Spec).The expression vector GATE8-SlALMT9 of different genotype is transferred to low malic acid tomato material TS66 (to draw From U.S. Tomato Germplasms center, http://tgrc.ucdavis.edu/), method of the Transformation Program referring to Zhang Junhong report (Zhang Junhong, 2006), obtains transgenic plant.To positive transgenic plant malic acid content measurement discovery III, IV, OX base Because type Transgenic Tomato Plants fruit malic acid content dramatically increases.

Embodiment 5:SlALMT9 gene C RIPSR/Cas9 gene knockout

The CRISPR/Cas9 binary vector (pTX) that the present invention uses is transformed by pBin19.Specifically, In On pBin19 carrier (GenBank accession number:U09365.1) add tomato U6 promoter (Sequence ID: ) and the sequence of 2 × 35S zCas9 (Xing etc., 2014) (see Fig. 7) X51447.1.That is 1- in sequence table SEQ ID NO:1 First exon of SlALMT9 gene shown in 348bp.According to first exon sequence of SlALMT9 gene, utilize CRIPSR/Cas9 target spot predicts that online software (http://crispr.dbcls.jp/) designs the gene knockout of double target spots (see figure 7) two sgRNA primers, are designed are as follows: forward primer: 5'CGAATCTAACAGTGTAGTTTGGCGTCGAACCCGAAGGATTTG TTTTAGAGCTAGAAATAGCAAGT 3', reverse primer: 5'GCTATTTCTAGCTCTAAAACTTCGAGGATCCTTACGAC The sequence that CCCAAACTACACTGTTAGATTCGC 3'(boldface letter underlines place is double target spots of SlALMT9 gene knockout). The method of genetic transformation is the same as the embodiment of the present invention 4.It is same by extracting to each T0 for the genotyping of transgenic line T0 is all possible etc. as caused by chimera to capture for the hybrid dna sample of three different tomato plant blades of single plant Position mutation.Utilize the special primer (forward primer: 5'CGGCCTCGATATTGGGACTAACTCT 3', reverse primer: 5' of Cas9 CTTATCTGTGGAGTCCACGAGCTTC 3'), positive detection is carried out to each plant by carrying out PCR amplification to Cas9.Tool Body PCR reaction system: 20 μ L of total volume.10 × PCR Buffer 2.0 μ L, dNTP (10mmol/ μ L) 0.4 μ L, positive anti-primer are each 0.4 μ L, DNA profiling (100-200ng/ μ L) 1.0 μ L, Taq enzyme (5U/ μ L) 0.1 μ L, complementing to 20 μ L with ddH2O, (primer is by north The synthesis of capital Tian Yihuiyuan Biotechnology Co., Ltd, Buffer, dNTP and Taq enzyme are purchased from the limited public affairs of Beijing Quan Shijin biotechnology Department)；PCR response procedures: 94 DEG C of initial denaturations 3min, 94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 1min carry out 35 Circulation, 72 DEG C of extensions 10min, 4 DEG C of preservation 10min；Detected through gel electrophoresis: 1% fine jade of the PCR product added with EB (ethidium bromide) Lipolysaccharide electrophoresis 30min, final result under 100-120V voltage conditions are shown on gel imaging system.Using on the left of sgRNA1 Forward primer: the reverse primer on the right side of 5'TTAATCTTGTTGCTTCTATGGTAGTT 3' and sgRNA2: 5' GCTGACCACAATCACAACCTCCT 3'(Fig. 8), further genotype is carried out to CRISPR/Cas9 gene knockout positive strain Association analysis.(this " ibid " refers to that the present embodiment also refers to other implementation with described in the present embodiment for PCR reaction system and program Example please demonstrate).

Embodiment 6:SlALMT9 gene and the tomato relevance verification of resistance to aluminium

The present embodiment with low malic acid tomato material (TS66), two SlALMT9 overexpression transgene tomato strains and High malic acid tomato material (TS40) is experimental material, utilizes the addition various concentration in mill water culture nutrient solution (Wang etc., 2001) AlCl3, the secretion of malic acid in the elongation and root system of different tomato material roots is measured to implement.Specifically, by tomato Seed (such as TS66, OX1, OX3 and TS40) is sowed in the culture dish of wet filter paper, is germinateed 3 days under dark condition.Then, will Seedling is transferred on the foam being immersed in the plastic casing containing 1/5 part of nutritive solution of 2L (Wang et al.2001).25 DEG C, relative humidity 70-80%, grown under the dark condition of illumination/12 hour within 12 hours after a week, by seedling be transferred to containing In the hydroponic box for the pancebrin that 40LpH is 6.5, replacement in nutrient solution every 3 days is primary.After a week, by AlCl3 (0 μM, 10 μM, 20 μM) be added in the nutrient solution of pH 4.2, a root long degree, which is measured, using ruler is denoted as L1.Ruler measurement one is reused after 10 days Secondary root long degree is denoted as L2.Opposite root growth calculation formula (L2-L1) 10 Μ m, the increment of 20 μM/(L2-L1) 0 μM of calculating root. Three repetitions are designed to every kind of processing of different tomato materials, each repetition includes at least three plant.The apple of the tomato tip of a root Sour outlet measuring method is as follows: by the tip of a root of 4 2cm long oscillation incubation 5 hours in the 1mM CaCl 2 (pH 4.2) of 1ml, The tip of a root is rinsed three times with 2 solution of CaCl, and the tip of a root is then put into identical 2 solution of CaCl (control) of 1ml or processing solution (AlCl3 is added in 1mM CaCl 2 at pH 4.2), 37 DEG C continue to incubate for 3 hours.It collects and is dried liquid, residue is taken to measure Malic acid, measuring method side is referring to embodiment 1.

Embodiment 7: for the exploitation and application of SlALMT9 gene indel_3 CAPS label

The exploitation of molecular labeling SlALMT9indel_3: relying on the indel_3 mutation for being located at SlALMT9 gene promoter, The CAPS label that the present invention develops a based on PCR is true in turn for detecting the genotype of SlALMT9 gene in tomato variety Determine the content of malic acid.It is described that specific step is as follows, carries out PCR reaction using following primer, amplification includes SlALMT9indel_ 3 784bp segment, (segment is located in SlALMT9 gene promoter, and sequence is shown in sequence table SEQ ID NO:3), amplimer Pair DNA sequence dna it is as follows: forward primer: 5'-TGGATGTAATAAAAACAAGGGAA-3' and reverse primer: 5'- TATCCATAAAATAGCGAAATAGAAAC-3'.PCR program: (1) 94 DEG C 3 minutes；(2) 94 DEG C 30 seconds, 56 DEG C 30 seconds, 72 DEG C 50 seconds 34 circulations；(3) 72 DEG C 10 minutes.PCR product then passes through Hin1 II (Thermo Scientific) at 37 DEG C Digestion 2 hours.PCR reaction system is 10 μ l, comprising: the PCR product of 3 μ l, 10 × buffer G, the Hin1 II of 0.3 μ l of 1 μ l (5U/l), the ddH2O of 5.7l；With the DNA fragmentation of 1% agarose gel electrophoresis 25 minutes separation different lengths, pass through ultraviolet light Clip size is observed, acquired label is named as indel_3-based CAPS and marked by applicant, the nucleotides sequence of the label Column are as shown in SEQ ID NO:3.

The present invention can be well by 73 parts of business tomato variety (F1 using the indel_3-based CAPS label of preparation Hybrid) genotype and malic acid content correspond to situation and distinguish, testing result is shown in Fig. 9.

Molecular labeling prepared by the present invention can be used in the assisted Selection of tomato breeding.

Leading reference:

1. the .L- malic acid Advances in Biosynthesis Food Science such as Wu Jun woods, 2014,35 (3): 238-242.

2. clone and the functional analysis of the red tomato Aux/IAA gene of person of outstanding talent, doctoral thesis, middle National IP Network: http: // epub3.cnki.net.

3.Bolger A et al.The genome of the stress-tolerant wild tomato species Solanum pennellii.Nat Genet,2014,doi:10.1038/ng.3046.

4.Delhaize E,Gruber BD,Ryan PR.The roles of organic anion permeases in aluminium resistance and mineralnutrition.FEBS Lett,2007,581:2255-2262.

5.Emmerlich V et al.The plant homolog to the human sodium/ dicarboxylic cotransporter is the vacuolar malate carrier.Proc Natl Acad Sci U S A,2003,100:11122-11126.

6.Hoekenga OA et al.AtALMT1,which encodes a malate transporter,is identified as one of several genes critical for aluminum tolerance in Arabidopsis.Proc Natl Acad Sci U S A,2006,103:9738-9743.

7.Lin,T.et al.Genomic analyses provide insights into the history of tomato breeding.Nat.Genet.(2014).

8.Roger S O,BendichAJ.1988.Extraction of DNA from plant tissue.Plant Mol Biol,A6:1–10.

9.Sweetman C et al.Regulation of malate metabolism in grape berry and other developing fruits.Phytochemistry,2009,70:1329-1344.

10.Tomato Genome C.The tomato genome sequence provides insights into fleshy fruit evolution.Nature,2012,485:635-641.

11.Wang,Y.H.,Garvin,D.F.&Kochian,L.V.Nitrate-induced genes in tomato roots.Array analysis reveals novel genes that may play a role in nitrogen nutrition.Plant Physiol.127,345-359(2001).

12.Xing,H.L.,Dong,L.,Wang,Z.P.,Zhang,H.Y.,Han,C.Y.,Liu,B.,Wang,X.C., and Chen,Q.J.(2014).A CRISPR/Cas9 toolkit for multiplex genome editing in plants.BMC plant biology 14:327。

SEQUENCE LISTING

<110>Hua Zhong Agriculture University

<120>regulate and control clone and the application of the key gene SlALMT9 of tamato fruit apple acid accumulation

<130>

<141> 2016-12-16

<160> 3

<170> PatentIn version 3.1

<210> 1

<211> 1680

<212> DNA

<213>tomato (Lycopersicon esculentum)

<220>

<221> gene

<222> (1)..(1680)

<223>

<220>

<221> CDS

<222> (1)..(1680)

<223>

<400> 1

atg gcg gcg cca ttg agc caa aac ttt aac gaa acg agc aaa gag aga 48

Met Ala Ala Pro Leu Ser Gln Asn Phe Asn Glu Thr Ser Lys Glu Arg

1 5 10 15

ttg att ccc aaa tat tca gag tat gga ttg gat cca tca ttt tac gtc 96

Leu Ile Pro Lys Tyr Ser Glu Tyr Gly Leu Asp Pro Ser Phe Tyr Val

20 25 30

gaa ccc gaa gga ttt tgg cgt cga tta tgt aat aga att aag aaa tca 144

Glu Pro Glu Gly Phe Trp Arg Arg Leu Cys Asn Arg Ile Lys Lys Ser

35 40 45

ggt agt aat gtt aaa cag ggc tat atc aag gca att gat atg ggt cgt 192

Gly Ser Asn Val Lys Gln Gly Tyr Ile Lys Ala Ile Asp Met Gly Arg

50 55 60

aag gat cct cga aag gtc att ttt gct gtt aaa atg ggt tta act ctt 240

Lys Asp Pro Arg Lys Val Ile Phe Ala Val Lys Met Gly Leu Thr Leu

65 70 75 80

tcc ctt gtt tcg gtt gtc att ttc ttc aaa gag ccc tta tcc tat att 288

Ser Leu Val Ser Val Val Ile Phe Phe Lys Glu Pro Leu Ser Tyr Ile

85 90 95

ggt aca tat tcc att tgg gcc atc ctc act gtt gtc gtc gta ttc gag 336

Gly Thr Tyr Ser Ile Trp Ala Ile Leu Thr Val Val Val Val Phe Glu

100 105 110

ttc agc ata ggt gcg aca ctc aac aaa gga ttc aac agg gct ttg ggg 384

Phe Ser Ile Gly Ala Thr Leu Asn Lys Gly Phe Asn Arg Ala Leu Gly

115 120 125

aca ttg tct gcc gca gga cta gct gta ggc att gct gaa tta tct gtt 432

Thr Leu Ser Ala Ala Gly Leu Ala Val Gly Ile Ala Glu Leu Ser Val

130 135 140

atg gct gga aaa tgg cag gag gtt gtg att gtg gtc agc att ttt gtt 480

Met Ala Gly Lys Trp Gln Glu Val Val Ile Val Val Ser Ile Phe Val

145 150 155 160

gca ggt ttt ctt gca acg tac ttg aaa ttg cat cct gca atg aag caa 528

Ala Gly Phe Leu Ala Thr Tyr Leu Lys Leu His Pro Ala Met Lys Gln

165 170 175

tat gaa tat ggt ttt cgg gta ttc ttg ttg aca tat tgt att gtg ctg 576

Tyr Glu Tyr Gly Phe Arg Val Phe Leu Leu Thr Tyr Cys Ile Val Leu

180 185 190

gta tcg gga act tca cat ttt ttt cac gca gct gtt tcg cga ttg ttg 624

Val Ser Gly Thr Ser His Phe Phe His Ala Ala Val Ser Arg Leu Leu

195 200 205

cta att gga gtt ggt gct ggt gtc tgt ttg ctt ata aat gtt ggc ctc 672

Leu Ile Gly Val Gly Ala Gly Val Cys Leu Leu Ile Asn Val Gly Leu

210 215 220

tac cct atc tgg gct ggt gaa gat ttg cac aaa ttg gtg gta aag aat 720

Tyr Pro Ile Trp Ala Gly Glu Asp Leu His Lys Leu Val Val Lys Asn

225 230 235 240

ttt aaa cgt gtt tct act tct ttg gaa ggt tgt gtc aat gga tat ctg 768

Phe Lys Arg Val Ser Thr Ser Leu Glu Gly Cys Val Asn Gly Tyr Leu

245 250 255

cag tgt ctt gaa tat gat cgg ata cca tca aaa atc ctt ctt tac cag 816

Gln Cys Leu Glu Tyr Asp Arg Ile Pro Ser Lys Ile Leu Leu Tyr Gln

260 265 270

gcc tct gat gac cct gtg tat agc gga tac agg gct gct ttg gag tca 864

Ala Ser Asp Asp Pro Val Tyr Ser Gly Tyr Arg Ala Ala Leu Glu Ser

275 280 285

aca agc caa gag gat tct ctg cta gct ttt gct gaa tgg gaa ccc cct 912

Thr Ser Gln Glu Asp Ser Leu Leu Ala Phe Ala Glu Trp Glu Pro Pro

290 295 300

cat ggc cat tac aag atg ttc aat tat ccg tgg gct gat tat gtt aaa 960

His Gly His Tyr Lys Met Phe Asn Tyr Pro Trp Ala Asp Tyr Val Lys

305 310 315 320

gtc agt ggt gcg ttg agg cat tgt gct ttc atg gtc atg gct atg cat 1008

Val Ser Gly Ala Leu Arg His Cys Ala Phe Met Val Met Ala Met His

325 330 335

agc tgt att ctt tca gaa ata cag gca gca tct gat ttg aga caa atc 1056

Ser Cys Ile Leu Ser Glu Ile Gln Ala Ala Ser Asp Leu Arg Gln Ile

340 345 350

ttc tgc aag gag atc cag aga gtt ggg att gaa gga gct aaa gta tta 1104

Phe Cys Lys Glu Ile Gln Arg Val Gly Ile Glu Gly Ala Lys Val Leu

355 360 365

caa cac ctt gga gac aaa gtt gaa aaa atg gag aaa ctt agc cct aga 1152

Gln His Leu Gly Asp Lys Val Glu Lys Met Glu Lys Leu Ser Pro Arg

370 375 380

gac ctt ctc gaa gaa gtt cat ggg gct gcg gag gat cta caa ctg ttg 1200

Asp Leu Leu Glu Glu Val His Gly Ala Ala Glu Asp Leu Gln Leu Leu

385 390 395 400

att gac caa aaa tct tat cta ttg gtt cag gtg gag aac tgg gaa aat 1248

Ile Asp Gln Lys Ser Tyr Leu Leu Val Gln Val Glu Asn Trp Glu Asn

405 410 415

gca aaa caa gct aac cag ctt gga gat cct gaa cat att cag gaa ctg 1296

Ala Lys Gln Ala Asn Gln Leu Gly Asp Pro Glu His Ile Gln Glu Leu

420 425 430

aaa gac aat gaa act aaa gag atg ggg ata cac tcc ttt agt gaa gca 1344

Lys Asp Asn Glu Thr Lys Glu Met Gly Ile His Ser Phe Ser Glu Ala

435 440 445

ggc ttc aat cta agg tct gct cat aca ttg aaa cac atg gat act tat 1392

Gly Phe Asn Leu Arg Ser Ala His Thr Leu Lys His Met Asp Thr Tyr

450 455 460

agt cga aat tca agt atg aat atc tct ggt gca caa atg tgt tcc act 1440

Ser Arg Asn Ser Ser Met Asn Ile Ser Gly Ala Gln Met Cys Ser Thr

465 470 475 480

gga aac gtg ttc aat cag atg gtg tgg cct tca cga ctt tca att ctt 1488

Gly Asn Val Phe Asn Gln Met Val Trp Pro Ser Arg Leu Ser Ile Leu

485 490 495

gga gat gtg att cta aat gaa cgt gaa gta cgt aca ttt gaa agt gca 1536

Gly Asp Val Ile Leu Asn Glu Arg Glu Val Arg Thr Phe Glu Ser Ala

500 505 510

tgt cca ttg tca ttg gcc act ttt act tcc ttg tta att gag ttt gtt 1584

Cys Pro Leu Ser Leu Ala Thr Phe Thr Ser Leu Leu Ile Glu Phe Val

515 520 525

gca aga ctt caa aat ctt gta aat gca ttt caa cag ctt agt gag aag 1632

Ala Arg Leu Gln Asn Leu Val Asn Ala Phe Gln Gln Leu Ser Glu Lys

530 535 540

gca aaa ttt aag gaa ccc gta gat gca gca gag gca gcg aac ttc tag 1680

Ala Lys Phe Lys Glu Pro Val Asp Ala Ala Glu Ala Ala Asn Phe

545 550 555

<210> 2

<211> 559

<212> PRT

<213>tomato (Lycopersicon esculentum)

<400> 2

Met Ala Ala Pro Leu Ser Gln Asn Phe Asn Glu Thr Ser Lys Glu Arg

1 5 10 15

Leu Ile Pro Lys Tyr Ser Glu Tyr Gly Leu Asp Pro Ser Phe Tyr Val

20 25 30

Glu Pro Glu Gly Phe Trp Arg Arg Leu Cys Asn Arg Ile Lys Lys Ser

35 40 45

Gly Ser Asn Val Lys Gln Gly Tyr Ile Lys Ala Ile Asp Met Gly Arg

50 55 60

Lys Asp Pro Arg Lys Val Ile Phe Ala Val Lys Met Gly Leu Thr Leu

65 70 75 80

Ser Leu Val Ser Val Val Ile Phe Phe Lys Glu Pro Leu Ser Tyr Ile

85 90 95

Gly Thr Tyr Ser Ile Trp Ala Ile Leu Thr Val Val Val Val Phe Glu

100 105 110

Phe Ser Ile Gly Ala Thr Leu Asn Lys Gly Phe Asn Arg Ala Leu Gly

115 120 125

Thr Leu Ser Ala Ala Gly Leu Ala Val Gly Ile Ala Glu Leu Ser Val

130 135 140

Met Ala Gly Lys Trp Gln Glu Val Val Ile Val Val Ser Ile Phe Val

145 150 155 160

Ala Gly Phe Leu Ala Thr Tyr Leu Lys Leu His Pro Ala Met Lys Gln

165 170 175

Tyr Glu Tyr Gly Phe Arg Val Phe Leu Leu Thr Tyr Cys Ile Val Leu

180 185 190

Val Ser Gly Thr Ser His Phe Phe His Ala Ala Val Ser Arg Leu Leu

195 200 205

Leu Ile Gly Val Gly Ala Gly Val Cys Leu Leu Ile Asn Val Gly Leu

210 215 220

Tyr Pro Ile Trp Ala Gly Glu Asp Leu His Lys Leu Val Val Lys Asn

225 230 235 240

Phe Lys Arg Val Ser Thr Ser Leu Glu Gly Cys Val Asn Gly Tyr Leu

245 250 255

Gln Cys Leu Glu Tyr Asp Arg Ile Pro Ser Lys Ile Leu Leu Tyr Gln

260 265 270

Ala Ser Asp Asp Pro Val Tyr Ser Gly Tyr Arg Ala Ala Leu Glu Ser

275 280 285

Thr Ser Gln Glu Asp Ser Leu Leu Ala Phe Ala Glu Trp Glu Pro Pro

290 295 300

His Gly His Tyr Lys Met Phe Asn Tyr Pro Trp Ala Asp Tyr Val Lys

305 310 315 320

Val Ser Gly Ala Leu Arg His Cys Ala Phe Met Val Met Ala Met His

325 330 335

Ser Cys Ile Leu Ser Glu Ile Gln Ala Ala Ser Asp Leu Arg Gln Ile

340 345 350

Phe Cys Lys Glu Ile Gln Arg Val Gly Ile Glu Gly Ala Lys Val Leu

355 360 365

Gln His Leu Gly Asp Lys Val Glu Lys Met Glu Lys Leu Ser Pro Arg

370 375 380

Asp Leu Leu Glu Glu Val His Gly Ala Ala Glu Asp Leu Gln Leu Leu

385 390 395 400

Ile Asp Gln Lys Ser Tyr Leu Leu Val Gln Val Glu Asn Trp Glu Asn

405 410 415

Ala Lys Gln Ala Asn Gln Leu Gly Asp Pro Glu His Ile Gln Glu Leu

420 425 430

Lys Asp Asn Glu Thr Lys Glu Met Gly Ile His Ser Phe Ser Glu Ala

435 440 445

Gly Phe Asn Leu Arg Ser Ala His Thr Leu Lys His Met Asp Thr Tyr

450 455 460

Ser Arg Asn Ser Ser Met Asn Ile Ser Gly Ala Gln Met Cys Ser Thr

465 470 475 480

Gly Asn Val Phe Asn Gln Met Val Trp Pro Ser Arg Leu Ser Ile Leu

485 490 495

Gly Asp Val Ile Leu Asn Glu Arg Glu Val Arg Thr Phe Glu Ser Ala

500 505 510

Cys Pro Leu Ser Leu Ala Thr Phe Thr Ser Leu Leu Ile Glu Phe Val

515 520 525

Ala Arg Leu Gln Asn Leu Val Asn Ala Phe Gln Gln Leu Ser Glu Lys

530 535 540

Ala Lys Phe Lys Glu Pro Val Asp Ala Ala Glu Ala Ala Asn Phe

545 550 555

<210> 3

<211> 784

<212> DNA

<213>tomato (Lycopersicon esculentum)

<220>

<221> promoter

<222> (1)..(784)

<223>

<220>

<221> primer_bind

<222> (759)..(784)

<223>

<220>

<221> primer_bind

<222> (1)..(23)

<223>

<400> 3

tggatgtaat aaaaacaagg gaaaatataa aaatatcacc aacctatatt caaaatctta 60

gagaaatatt tatactatat taaaattcta ttacccctga atttattttt taaataattt 120

tttacttctt tacagtttac gtggtgctat cttgtggttc cagcgcgtgt tgatattttt 180

ttaaagctaa gtcacgtagt cgaaaagggg taaaaaatta tttataaaat aagttcagag 240

gtaataggac tttagtatag tcaagtctgt ctctgagatt tcggacataa attaggggct 300

acttatgcat tttttctgat atggactttt gaattattta taaaaaaaaa cacaagaatt 360

atatttcatt aaattgtttt gaatattttt ctaattttaa agaattatta acttatattt 420

gtactcactt cgtttcaaaa ataatgttct aatttgactt ggaaccgtgt aaccttgtga 480

tcgtaaatta aatttatgtc aaatgtatta aaatatcatt taattttgtg accttaaata 540

tgtcatgtaa aaaattaaag ttaaaatttt atcaaaataa agaaaaaaga ttatttttct 600

taaacaaact aaaaaagaga tgagacaact ttttttaaaa tagagggagt atatcttatt 660

atattatcga aatcaacgat cctttcccgt agcacaaatg gaggagagaa aagattatct 720

gagaaagttt actaatttac cgagtattaa gttagaaagt ttctatttcg ctattttatg 780

gata 784

Claims

1. a kind of molecular labeling suitable for tomato assisted Selection, which is characterized in that the nucleotide sequence of the molecular labeling As shown in SEQ ID NO:3.

2. application of the molecule labelled series described in claim 1 in the breeding of Tomato Quality.