CN107058152A

CN107058152A - One plant of fluoranthene degradation bacteria and its application

Info

Publication number: CN107058152A
Application number: CN201611121318.0A
Authority: CN
Inventors: 张朝晖; 夏瑛铭; 王亮; 左宇环; 刘念
Original assignee: Tianjin Polytechnic University
Current assignee: Tianjin Polytechnic University
Priority date: 2016-12-08
Filing date: 2016-12-08
Publication date: 2017-08-18
Anticipated expiration: 2036-12-08
Also published as: CN107058152B

Abstract

The present invention relates to a kind of fluoranthene degradation bacteria and its application, the fungi is Penicillium (Penicillium purpurogenum sp.) DTQ HK1.China General Microbiological culture presevation administrative center is preserved on November 8th, 2016；Deposit number is：CGMCC No.13181.Bacterial strain is on LB solid mediums in incubated first in batting shape bacterium colony of the faint yellow later stage in celadon at 28 DEG C, the back side is in faint yellow, diameter is about under 2 3mm, microscope and surface sweeping Electronic Speculum can be observed bacterial strain and have mycelia, and there is 1 μm or so circular spore structure on head.DTQ HK1 are screened from the river bottom mud polluted by fluoranthene；Separation method is simple, and Penicillium purpurogenum strain DTQ HK1 can effectively degrade fluoranthene, be conducive to repairing the river bottom mud of fluoranthene pollution.

Description

One plant of fluoranthene degradation bacteria and its application

Background technology

Polycyclic aromatic hydrocarbon (Polycyclic aromatic hydrocarbons, PAHs) is to be widely present in river bottom mud to sink A quasi-representative persistence organic pollutant (POPs) in product thing, is countries in the world with carcinogenic, aberration inducing and mutagenesis The a class of pollutant of priority acccess control.Wherein, PAHs more than Fourth Ring is referred to as polycyclic aromatic hydrocarbon with high molecular weight (H-PAHs), H-PAHs It is the emphasis and difficult point for administering PAHs pollutions with stronger toxicity and refractory organicses.Numerous studies show that fluoranthene is river course bottom Most common H-PAHs pollutants in mud, according to there is higher detection frequency and abundance.Therefore, realizing fluoranthene in river bottom mud Effectively remove has important reference for administering H-PAHs pollutions in river bottom mud.

Microorganism remediation technology is under conditions of artificial optimization, using the vital metabolic activity of microorganism, to decompose soil Pollutant in earth or deposit, to repair contaminated environment.In microorganism remediation can for inoculation microorganism from its Source can be divided into indigenous microorganism, external microorganism and genetic engineering bacterium；It can be divided into bacterium and fungi from microbial species Class Type. The microorganism for the PAHs that can degrade being separated to from soil at present has pseudomonas, Flavobacterium, Nocardia, vibrios Belong to, Pseudomonas of unlinking etc., but be directed to the efficient degrading bacteria that PAHs pollutes in river bottom mud.

The content of the invention

It is a kind of high screened from the fluoranthene in river bottom mud present invention aims at providing in order to overcome the deficiencies in the prior art Imitate degradation bacteria and its application.

A kind of fluoranthene degradation bacteria that the present invention is provided, the fungi is Penicillium (Penicillium purpurogenum sp.)DTQ-HK1。

Penicillium purpurogenum Pseudomonas (Penicillium purpurogenum sp.) DTQ-HK1 that the present invention is improved is in 2016 On November 8, in is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center；Address is：Chaoyang District, Beijing City No. 3 Institute of Microorganism, Academia Sinica of institute of North Star West Road 1；Deposit number is：CGMCC No.13181.

The morphological feature for the Penicillium purpurogenum strain DTQ-HK1 that the present invention is provided is as follows：Bacterium Strain on LB solid mediums at 28 DEG C it is incubated be in the faint yellow later stage first celadon batting shape bacterium colony, the back side is in light Yellow, diameter is about under 2-3mm, microscope and surface sweeping Electronic Speculum can be observed bacterial strain and have mycelia, and there is 1 μm or so circular spore on head Structure.

The Penicillium purpurogenum strain DTQ-HK1 that the present invention is provided are from the river course polluted by fluoranthene Separation is screened in bed mud.

The Penicillium purpurogenum strain DTQ-HK1 of the present invention are applied to dirty by fluoranthene as microbial inoculum In the river bottom mud of dye.

The beneficial effects of the present invention are：Penicillium purpurogenum strain DTQ-HK1 screening point Simple from method, the Penicillium purpurogenum strain DTQ-HK1 isolated can effectively degrade fluoranthene, have Beneficial to the river bottom mud for repairing fluoranthene pollution.

Brief description of the drawings

Colonial morphology figure on Fig. 1 (a) Penicillium purpurogenum strain DTQ-HK1 culture mediums；

Strain aspect graph under Fig. 1 (b) Penicillium purpurogenum strain DTQ-HK1 microscopes；

Strain aspect graph under Fig. 1 (c) Penicillium purpurogenum strain DTQ-HK1 ESEMs；

Fig. 2 is Penicillium purpurogenum strain DTQ-HK1 phylogenetic tree；

Fig. 3 is Penicillium purpurogenum strain DTQ-HK1 growth curve；

Fig. 4 is pairs of the Penicillium purpurogenum strain DTQ-HK1 in fluoranthene-inorganic salts nutrient solution The degradation efficiency figure of fluoranthene；

Fig. 5 is that Penicillium purpurogenum strain DTQ-HK1 are added in fluoranthene polluted bed mud in Chang To the degradation effect figure of fluoranthene under Pu and maltose collective effect.

Embodiment

The screening and identification of the fluoranthene efficient degrading bacteria of embodiment 1

Experiment bed mud to be measured is taken to carry out being separately cultured for fluoranthene degradation bacteria.First, 5g bed muds are taken to be inoculated in 50mL containing fluoranthene MSM culture mediums in, the incubated at room temperature two weeks under the conditions of 120rpm shaking table lucifuges pipettes 1mL soil enrichments liquid in new containing glimmering Cultivated in the sterile MSM culture mediums of anthracene and repeat to dilute after one week, carry out the domestication enrichment culture process in continuous four stage.Culture knot Shu Hou, takes bacterium solution to carry out line separation on the LB solid mediums containing fluoranthene, constant temperature and humidity culture at room temperature with oese 3-5d is cultivated in case, the shaping bacterium colony of picking different shape is inoculated on new LB solid mediums respectively to be purified, repeated Line separation, until the colonial morphology formed on solid medium is consistent.The speed of growth is purified to strain faster and is inoculated into and is contained There is Shaking culture in the MSM culture mediums of fluoranthene, and strain form is observed under microscope and ESEM, as a result as schemed Shown in 1 (a) (b) (c).

The compound method of wherein minimal medium (MSM culture mediums) is as follows：Weigh ammonium sulfate 1g, potassium dihydrogen phosphate 0.8g, dipotassium hydrogen phosphate 0.2g, magnesium chloride 0.05g, calcium chloride 0.05g, iron chloride 0.01g, sodium chloride 5g is dissolved in 1L ultra-pure waters, PH to 7.0 ± 0.5 is adjusted with NaOH, in 121 DEG C of wet type autoclaving 20min.

The identification of bacterial strain：

5mL pure strains cultivation liquid is taken first, is centrifuged through 10000rpm, abandoning supernatant, adds 200 μ L buffer solution GA suspension bacterium Fall, add 20 μ L Proteinase K solution and mix, complete bacterial strain DNA extraction process.Then the bacterial strain DNA to extract For template, enter performing PCR amplification and be sequenced.That PCR instrument is selected is ABI272.Using universal primer ITSl (5 '-TCC GTA GGT GAA CCT GCGG-3 ') ITS4 (5 '-TCC TCC GCT TAT TGA TAT GC-3 '), PCR reaction systems are：2x Taq The 111 μ L of μ L, template of μ L, PrimerR (20pm) of μ L, PrimerF (20pm) of mix 10, sterile purified water is settled to 20 μ L. Bacterial strain IcdP1 enters performing PCR amplification 16S rDNA sequences, and PCR reaction conditions are:94 DEG C of pre-degeneration 4min, 94 DEG C are denatured 1min, 55 DEG C Anneal 1min, 72 DEG C of extension 1min, 35 circulations, 72 DEG C of extension 10min, in preservation at 4 DEG C.Bacterial strain DTQ-HK1 enters performing PCR expansion Increase ITS sequences, PCR reaction conditions are：94 DEG C of pre-degenerations 3min, 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 40s, this mistake 35 circulations of Cheng Jinhang.Last 72 DEG C of extensions 10min, is preserved under the conditions of being placed in 4 DEG C.Enter performing PCR amplification using primer pair bacterial strain ITS obtains target DNA fragment, and obtained gene order is as shown in following table SEQ ID.

Obtained gene order is analyzed, sequencing result is analyzed on NCBI websites with Blast programs, with GenBank more control sequences carry out sequence homology comparison.As a result show bacterial strain DTQ-HK1 ITS gene orders with it is a variety of Penicillium sp. (Penicillium) have high homology.Downloaded and bacterial strain DTQ- from GenBank gene databases HK1 sequence similarities are more than 97% and partial mode strain gene order, and clustering is carried out by ClustalX softwares Afterwards, phylogenetic tree such as Fig. 2 is generated with Neighbor-Joining calculations using MEGA5.0 softwares.Can from Fig. 2 Go out, bacterial strain DTQ-HK1 and Penicillium sp. have 99% homology, it may be determined that bacterial strain DTQ-HK1 is Penicillium, And there is with Penicillium purpurogenum strain DTQ-HK1 99% homology in Penicillium.Therefore It can be assumed that the bacterial strain is Penicillium purpurogenum strain DTQ-HK1.

The degradation experiment of the fluoranthene of embodiment 2

After Penicillium purpurogenum strain DTQ-HK1 are obtained, to Penicillium Purpurogenum strain DTQ-HK1 growth curve is measured, aseptically respectively the 1st, 3 of culture, 5,7,14,21,35,42d are measured to the content of fat phosphorus in system, obtain strain Penicillium purpurogenum Strain DTQ-HK1 growth curve such as Fig. 3.It is can be found that by growth curve in Initial stage of culture microorganism growth rate Comparatively fast, and after culture 21d, growth speed is decreased obviously, and strain enters decline phase after culture 35d, under biomass is in Drop trend.

After being measured to strain Penicillium purpurogenum strain DTQ-HK1 growth curve, Further study degradation effects of the strain Penicillium purpurogenum strain DTQ-HK1 to fluoranthene.First, move 2mL is taken to cultivate OD after 7d₆₀₀=1 Penicillium purpurogenum strain DTQ-HK1 bacterial strains are dense to 50mL fluoranthene Spend in the MSM culture mediums for 50mg/L, in lucifuge shaken cultivation 42d under 28 DEG C of constant temperatures, it is once determined every 7d samplings The content of middle fluoranthene, does three groups of parallel tests, and set blank control group.The curve that obtained fluoranthene degradation rate is changed over time is such as Shown in Fig. 4, as can be seen from Figure 4 by 42d culture, fluoranthene concentration is by 50mgL in culture medium^-1It is down to 23.89mgL^-1, Penicillium purpurogenum strain DTQ-HK1 can reach 52.22% to the degradation rate of fluoranthene, meanwhile, It can be seen that 21d strains are improved to fluoranthene degradation rate than comparatively fast, strain tends to be flat to the degradation rate of fluoranthene after 21d before culture Slow, degradation effect change is not obvious.

Wherein fluoranthene extraction and determination method：50mL testing samples are taken in 250mL separatory funnel, are added thereto in three times Enter 50mL ethyl acetate, 3min is shaken every time, collect three extraction extract solutions, cross anhydrous sodium sulfate and go to rotate after moisture removal and steam Hair is concentrated into 2mL or so, and add 20mL methanol (can not will have particular number or write exactly with a certain amount of so uncertain word The requirement of arrival) solvent replacement is carried out after 50mL volumetric flask constant volumes, take 1.5mL solution HPLC in sample bottle to determine.HPLC Condition of work：Chromatographic column is Venusil MP C18 (150mm*4.6mm, 5 μm), UV-detector, Detection wavelength 324nm, post 30 DEG C of temperature, mobile phase is methanol, flow velocity 1mLmin^-1, sample size is 20 μ L.

Reparative experiment of the fluoranthene efficient degrading bacteria of embodiment 3 to polluted bed mud

The acquisition process for testing bed mud is as follows：Take Tianjin University of Technology to dissolve lake surface deposit (0-10cm), reject bed mud The debris such as interior rubble, plant residue, are air-dried in the cool, take ground 10 mesh sieve of air-dried soil sample, and determine wherein fluoranthene Content is 0.97mg/kg (dry ground).Because fluoranthene content is relatively low in mud sample, in order to which experimental observation adds fluoranthene into soil sample, make Fluoranthene concentration is finally 100mg/kg (dry ground) in bed mud.Addition method：First weigh ground 100 mesh sieve of a certain amount of air-dried soil sample After be laid in enamel tray, weigh accurate dosage fluoranthene dissolved with dichloromethane after be transferred in the enamel tray of soil sample, It is stirred continuously in fume hood with glass bar, fluoranthene is evenly distributed in soil sample, it is glimmering contaminating after after dichloromethane completely volatilization The dry soil samples of anthracene is slowly added into wet sample, and wet sample is stirred, dark place cure one week it is standby.

Using the potted plant mode in laboratory, the bed mud dry sample handled well is fitted into 2L plastic measuring glass, adding water makes to possess 3 on mud ~5cm water layers, with simulating riverway bed mud native state.Calamus is planted in bed mud and Penicillium is added Purpurogenum strain DTQ-HK1 and maltose, experiment culture period are 3 months, are sampled per 15d in once measure system The content of fluoranthene.As a result it is as shown in Figure 5, it can be seen that to add 40mLOD in calamus root system₆₀₀=2 Penicillium After after purpurogenum strain DTQ-HK1 and 90mg maltose culture 3 months, calamus-Penicillium Purpurogenum strain DTQ-HK1- maltose collective effect systems can reach 100% to the removal effect of fluoranthene.

Wherein fluoranthene extracting method is as follows：Collection mud sample is ground dry ground with mortar after air-drying in the cool first, crosses 80 Every part weighs the dry mud sample of 5.00g sievings after mesh sieve, takes the above-mentioned dry mud sample handled well in centrifuge tube, 20mL is added thereto Dichloromethane：N-hexane (V:V=1:1) after, ultrasound 30min in Ultrasound Instrument is positioned over, then take centrifuge tube to be placed into centrifuge 2000rpm centrifuges 3min, collects supernatant in boiling flask, said process is in triplicate.The supernatant that three times are collected into Carry out after thickening-purification technology constant volume, HPLC determines the content of wherein fluoranthene.

SEQ ID NO:1

Penicillium purpurogenum strain DTQ-HK1 ITS gene orders：

TCTCGCGGCCACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGG TCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGCGAACCCTGATGAAGATGGGCTGTCTGAG TACGATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGAT AAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGC ATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAA AGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGCATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGG TCACCACCACA

SEQ ID NO: 1

Penicillium purpurogenum strain DTQ-HK1 ITS gene orders：

TCTCGCGGCCACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGC CGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGCGAACCCTGATGAAGATGGGCTGTCTGAGTACG ATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT AATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGC CTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGC AGCGGCGACGTCCGTCTGGTCCTCGAGCGCATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCAC CACCACA

Primer

ITSl(5’-TCC GTA GGT GAA CCT GCGG-3’)

ITS4(5’-TCC TCC GCT TAT TGA TAT GC-3’)

Claims

1. a kind of fluoranthene degradation bacteria；For Penicillium (Penicillium purpurogenum sp.) DTQ-HK1.

2. the fluoranthene degradation bacteria of claim 1；Penicillium (Penicillium purpurogenum sp.) DTQ-HK1 in On November 8th, 2016 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, and deposit number is： CGMCC No.13181。

3. the fluoranthene degradation bacteria of claim 1 is applied to the efficient degradation of the fluoranthene in river bottom mud.

4. the fluoranthene degradation bacteria of claim 1 can realize the complete removal of fluoranthene under calamus, the collective effect of maltose, have The reparation polluted beneficial to fluoranthene in bed mud.