CN107056949B - Preparation method of RANKL-TNF sample region fusion protein - Google Patents
Preparation method of RANKL-TNF sample region fusion protein Download PDFInfo
- Publication number
- CN107056949B CN107056949B CN201710073236.1A CN201710073236A CN107056949B CN 107056949 B CN107056949 B CN 107056949B CN 201710073236 A CN201710073236 A CN 201710073236A CN 107056949 B CN107056949 B CN 107056949B
- Authority
- CN
- China
- Prior art keywords
- rankl
- solution
- fusion protein
- sample region
- functional fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a preparation method of RANKL-TNF sample region fusion protein. RANKL is an important cytokine secreted by osteoblasts and endothelial cells, which plays an important role in bone remodeling. The invention comprises five steps: step one, acquiring a RANKL functional fragment. And step two, obtaining a plasmid solution by using the RANKL functional fragment and the vector. And step three, cloning the plasmid vector obtained in the step two, and converting the plasmid vector into BL21 bacterial liquid. And step four, inducing the BL21 thallus obtained in the step three to obtain a RANKL-TNF sample region fusion protein solution. And step five, carrying out protein purification on the RANKL-TNF sample region fusion protein solution obtained in the step four. The invention adopts an induction condition with low temperature and low IPTG concentration to express the soluble target protein with high activity.
Description
Technical Field
The invention belongs to the technical field of bone factor preparation, and particularly relates to a preparation method of RANKL-TNF sample region fusion protein.
Background
Bone tissue is composed of organic and inorganic substances, mainly connective tissue, and is a dynamic organ. In order to maintain structural integrity while maintaining organ mineral balance, bone tissue must be continually structurally remodeled and repaired; this process is the reconstruction of bone. Bone remodeling refers primarily to the metabolic processes of bone that regulate bone structure and function. The metabolic processes of bone mainly involve two types of cells, osteoclasts and osteoblasts. Osteoclasts are primarily involved in the digestion of bone, whereas osteoblasts play a role in bone matrix formation, mineralization of cells, and finally differentiation into osteoblasts and bone lining cells.
Osteoblasts and osteoclasts interact while maintaining bone tissue homeostasis under the regulation of various factors. Disruption of bone remodeling homeostasis leads to a variety of clinical bone diseases including osteoporosis, bone sclerosis, and the like. The process of bone remodeling is accomplished by the coordination of a population of functional cells, called the Basic Multicellular Unit (BMU). The basic multicellular unit is mainly composed of osteoclast, osteoblast, bone lining cell, osteocyte and endothelial cell, which ensure the normal proceeding of bone reconstruction through the interaction of various cytokines. RANKL is an important cytokine secreted by osteoblasts and endothelial cells, which plays an important role in bone remodeling.
Tumor necrosis factor ligand superfamily member 11 is also known as receptor activator of nuclear factor kappa-B ligand, osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a one-way type II membrane protein, and belongs to the tumor necrosis factor family. RANKL and RANK are essential for the development and activation of osteoclasts and for almost all of the triggered bone loss tested. Inhibition of RANKL function by the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastasis. Importantly, RANKL appears to be the cause of arthritic bone and cartilage destruction. RANK-RANKL signaling not only activates a variety of downstream signaling pathways for osteoclast development, but also interacts with other signaling pathways to fine-tune bone homeostasis in normal physiology and disease.
The nuclear factor κ B receptor activator factor ligand (RANKL), its cognate receptor RANK and its natural decoy receptor osteoprotegerin have been identified as the ultimate effector molecule for osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communication and lymph node formation. In addition, RANKL and RANK are expressed in mammary epithelial cells and control the development of the lactating mammary gland during pregnancy. Therefore, it is of great significance to research how to effectively prepare RANKL.
Disclosure of Invention
The invention aims to provide a preparation method of a RANKL-TNF sample region fusion protein aiming at the defects of the prior art.
The invention comprises five steps:
step one, acquiring a RANKL functional fragment SEQ NO.1, wherein the RANKL functional fragment SEQ NO.1 contains arginine at a position 160 to tryptophan at a position 318.
And step two, obtaining a plasmid solution by utilizing the RANKL functional fragment SEQ NO.1 and a vector, wherein the vector is a pGST-4T series vector.
And step three, cloning the plasmid solution obtained in the step two, and converting the plasmid solution into BL21 bacterial liquid.
And step four, inducing the BL21 bacteria obtained in the step three under the conditions that the IPTG final concentration is 0.1-0.5 mM and the temperature is 16-25 ℃ to obtain the RANKL-TNF sample region fusion protein solution.
And step five, carrying out protein purification on the RANKL-TNF sample region fusion protein solution obtained in the step four. Obtain the RANKL-TNF sample region fusion protein.
The first step is as follows:
SD rats were ovariectomized and two weeks later total RNA of their tibia was extracted. Designing degenerate primers SEQ No.2 and reverse primer SEQ No.3 according to YFRAZM and AFKVR/QDID sequences, wherein the sequence of the degenerate primer SEQ No.2 is 5'TAYTTYMGNGCNCARATG 3'; the sequence of the reverse primer SEQ No.3 is 5'RTCDATRTCNYGNACYTTRAANGC 3'. And obtaining the RANKL cDNA through reverse transcription PCR.
The resulting RANKL cDNA was purified. Taking the purified cDNA as a template, designing an initial primer, wherein the sequence of a forward primer SEQ No.4 of the initial primer is 5'CCCGGGCAAGCCTGAGGCTCAGC 3'; the reverse primer of the primary primer SEQ No.5 sequence is 5'CCCGGGTCAGTCTATGTCTTGAACTTT 3'. The RANKL functional fragment SEQ NO.1 is cloned by using an initial primer. The RANKL functional fragment SEQ NO.1 contains arginine at position 160 to tryptophan at position 318.
The second step is as follows:
the functional fragments of RANKL were purified. mu.L of 10xbuffer, 0.3. mu.L of 100xBSA, 1. mu.L of SmaI and 4.7. mu.L of MilliQ H2O were added to 20. mu.L of the purified RANKL functional fragment of SEQ NO.1 and subjected to enzymatic single cleavage. Taking 10 mu L of carrier; the vector adopts pGST-4T series vectors; mu.L of 10xbuffer, 0.3. mu.L of 100xBSA, 1. mu.L of SmaI and 14.7. mu.L of MilliQ H2O were added to the vector to perform enzyme singulation. The operation temperature of enzyme single cutting of the carrier and the RANKL functional fragment is 37 ℃, and the enzyme single cutting time is 3 hours.
And respectively carrying out electrophoresis and gel tapping dissolution on the carrier subjected to enzyme single cutting and the RANKL functional fragment SEQ NO. 1. Obtaining carrier fluid and RANKL functional fragment fluid.
Respectively purifying 2 mu L of carrier fluid and 6 mu L of RANKL functional fragment fluid, mixing, and adding 1 mu L of 10xT4buffer and 1 mu L of T4DNA ligase; a connection initiation system is obtained. The initial ligation system was incubated overnight at 16 ℃ to obtain a ligation solution.
Mu.l of the ligation solution was added to a petri dish containing chemically competent cells of DH 5. alpha. and ice-cooled for 30 min. The mixture is placed in a 42 ℃ environment for heat shock 90 s. Placing on ice for 2-3 min. The mixture was placed at 37 ℃ and 1ml of LB medium was added. Shaking table at 120r/min for 45 min. Centrifuging at 5000r/min for 3 min. Evenly spread on LB plates containing 100ng/ml ampicillin. The plate was inverted and incubated at 37 ℃ overnight. Obtaining plasmid extraction bacteria liquid.
Inoculating the plasmid-extracted bacterial liquid to 4mL LB culture medium containing ampicillin for culture; the culture environment is 200r/min shaker 12-16h at 37 deg.C. And carrying out plasmid extraction on the cultured plasmid extraction bacterial liquid to obtain a plasmid solution.
The third step is as follows:
mu.l of plasmid solution was added to a petri dish containing BL21 chemically competent cells and ice-cooled for 30 min. The mixture is placed in a 42 ℃ environment for heat shock 90 s. Placing on ice for 2-3 min. The mixture was placed at 37 ℃ and 1ml of LB medium was added. Shaking table at 120r/min for 45 min. Centrifuging at 5000r/min for 3 min. Evenly spread on LB plates containing 100ng/ml ampicillin. The plate was inverted and incubated at 37 ℃ overnight. Obtaining the transitional bacterial liquid.
1mL of the transitional bacterium solution was transferred to 100mL of LB medium containing ampicillin. Shaking overnight at 200r/min at 37 deg.C; BL21 bacterial liquid was obtained.
The fourth step is as follows:
30mL of BL21 bacterial solution was transferred to 1000mL of a new LB medium containing ampicillin. Shaking at 37 deg.C for 200r/min until OD reaches 0.8. Adjusting the temperature to 16-25 ℃, adding IPTG with the final concentration of 0.1-0.5 mM, and standing for 30-60 min. Shaking for 16-20h at 200r/min to complete the induction. Centrifuging at 9000r/min for 15min to obtain bacterial mass. After weighing, the mass was frozen at-80 ℃. The pellet was thawed and filled into a beaker. 20ml of lysis buffer was placed in a beaker and spun well to ensure that the pellet was well resuspended in lysis buffer. The mixed pellet and lysis buffer were loaded into a 50ml centrifuge tube. 250 mul of lysozyme with a concentration of 60mg/ml was added to the centrifuge tube and mixed well. 250 μ l of 17.6mg/ml PMSF was added to the tube and mixed well. The centrifuge tube with the cap closed is placed across to an ice bin. The ice box was shaken at 50r/min into a centrifuge tube and became viscous. If the tube did not become viscous after 30min in the shaker, 250. mu.l lysozyme with a concentration of 60mg/ml and 250. mu.l PMSF with a concentration of 17.6mg/ml were added to the tube, mixed well and shaken at 50r/min until the tube became viscous.
250 μ l of DNAseI at a concentration of 100ng/ml was added to the centrifuge tube and shaken on ice for 30min, the viscosity in the centrifuge tube decreased. The centrifuge tube was placed in a flask with ice inside, and the flask was placed in an ultrasonic cell disruptor. Starting an ultrasonic cell crusher, carrying out ultrasonic treatment for ten times, wherein the ultrasonic treatment time is 30s each time, and standing for 30s between two ultrasonic treatments. Vibrating the centrifuge tube up and down. Centrifuging the tube at 4 deg.C for 30min at 20000 r/min. The precipitate in the centrifuge tube was discarded to obtain a supernatant. The supernatant is RANKL-TNF sample region fusion protein solution.
The fifth step is as follows:
and diluting the RANKL-TNF sample region fusion protein solution by four times by using a phosphate buffer solution to obtain a diluent. And filtering the diluent by a filter membrane of 0.22 mu m, and then purifying the protein to obtain the required RANKL-TNF sample region fusion protein.
The invention has the beneficial effects that:
1. the RANKL functional fragment of the invention comprises arginine at position 160 to tryptophan at position 318. Has complete functions, shorter sequence and higher expression amount than the traditional sequence.
2. The invention obtains a high-expression plasmid vector through pGST-4T series vectors.
3. The invention adopts an induction condition with low temperature and low IPTG concentration, and effectively expresses the soluble target protein with high activity.
Drawings
FIG. 1 is an SDS-PAGE electrophoresis of RANKL-TNF-like fusion proteins prepared according to the invention;
FIG. 2 is a graph showing the results of a trap staining experiment performed on the RANKL-TNF-like domain fusion protein prepared in the present invention.
Detailed Description
The invention is further described below with reference to the accompanying drawings.
SD rats were ovariectomized and two weeks later total RNA of their tibia was extracted. Designing degenerate primers SEQ No.2 and reverse primer SEQ No.3 according to YFRAZM and AFKVR/QDID sequences, wherein the sequence of the degenerate primer SEQ No.2 is 5'TAYTTYMGNGCNCARATG 3'; the sequence of the reverse primer SEQ No.3 is 5'RTCDATRTCNYGNACYTTRAANGC 3'. And obtaining the RANKL cDNA through reverse transcription PCR.
The resulting RANKL cDNA was purified. Taking the purified cDNA as a template, designing an initial primer, wherein the sequence of a forward primer SEQ No.4 of the initial primer is 5'CCCGGGCAAGCCTGAGGCTCAGC 3'; the reverse primer of the primary primer SEQ No.5 sequence is 5'CCCGGGTCAGTCTATGTCTTGAACTTT 3'. The RANKL functional fragment SEQ NO.1 is cloned by using an initial primer. The RANKL functional fragment SEQ NO.1 contains arginine at position 160 to tryptophan at position 318.
The functional fragments of RANKL were purified. mu.L of 10xbuffer (10-fold digestion buffer), 0.3. mu.L of 100xBSA (100-fold bovine serum albumin), 1. mu.L of SmaI (restriction enzyme) and 4.7. mu.L of MilliQ H2O (ultrapure water) were added to 20. mu.L of the purified RANKL functional fragment SEQ NO.1 to perform enzyme single cleavage. Taking 10 mu L of carrier; the vector adopts pGST-4T series vectors; mu.L of 10xbuffer, 0.3. mu.L of 100xBSA, 1. mu.L of SmaI and 14.7. mu.L of MilliQ H2O were added to the vector to perform enzyme singulation. The operation temperature of enzyme single cutting of the carrier and the RANKL functional fragment is 37 ℃, and the enzyme single cutting time is 3 hours.
And respectively carrying out electrophoresis and gel tapping dissolution on the carrier subjected to enzyme single cutting and the RANKL functional fragment SEQ NO. 1. Obtaining carrier fluid and RANKL functional fragment fluid.
Respectively purifying 2 mu L of carrier fluid and 6 mu L of RANKL functional fragment fluid, mixing, and adding 1 mu L of 10XT4buffer and 1 mu L of T4DNA ligase; a connection initiation system is obtained. The initial ligation system was incubated overnight at 16 ℃ to obtain a ligation solution.
Mu.l of the ligation solution was added to a petri dish containing chemically competent cells of DH 5. alpha. and ice-cooled for 30 min. The mixture is placed in a 42 ℃ environment for heat shock 90 s. Place on ice for 2.5 min. The mixture was placed at 37 ℃ and 1ml of LB medium was added. Shaking table at 120r/min for 45 min. Centrifuging at 5000r/min for 3 min. Evenly spread on LB plates containing 100ng/ml ampicillin. The plate was inverted and incubated at 37 ℃ overnight. Obtaining plasmid extraction bacteria liquid.
Inoculating the plasmid-extracted bacterial liquid to 4mL LB culture medium containing ampicillin for culture; the culture environment is 200r/min shaking table at 37 ℃ for 14 h. And carrying out plasmid extraction on the cultured plasmid extraction bacterial liquid to obtain a plasmid solution.
Mu.l of plasmid solution was added to a petri dish containing BL21 chemically competent cells and ice-cooled for 30 min. The mixture is placed in a 42 ℃ environment for heat shock 90 s. Place on ice for 2.5 min. The mixture was placed at 37 ℃ and 1ml of LB medium was added. Shaking table at 120r/min for 45 min. Centrifuging at 5000r/min for 3 min. Evenly spread on LB plates containing 100ng/ml ampicillin. The plate was inverted and incubated at 37 ℃ overnight. Obtaining the transitional bacterial liquid.
1mL of the transitional bacterium solution was transferred to 100mL of LB medium containing ampicillin. Shaking overnight at 200r/min at 37 deg.C; BL21 bacterial liquid was obtained.
30mL of BL21 bacterial solution was transferred to 1000mL of a new LB medium containing ampicillin. Shaking at 200r/min at 37 deg.C until OD (optical density) reaches 0.8. The temperature was adjusted to 22 ℃ and IPTG was added to a final concentration of 0.1mM and left for 50 min. Shaking for 18h at 200r/min to complete the induction. Centrifuging at 9000r/min for 15min to obtain bacterial mass. After weighing, the mass was frozen at-80 ℃. The pellet was thawed and filled into a beaker. 20ml of lysis buffer was placed in a beaker and spun well to ensure that the pellet was well resuspended in lysis buffer. The mixed pellet and lysis buffer were loaded into a 50ml centrifuge tube. 250 mul of lysozyme with a concentration of 60mg/ml was added to the centrifuge tube and mixed well. 250 μ l of 17.6mg/ml PMSF was added to the tube and mixed well. The centrifuge tube with the cap closed is placed across to an ice bin. The ice box was shaken at 50r/min into a centrifuge tube and became viscous. If the tube did not become viscous after 30min in the shaker, 250. mu.l lysozyme with a concentration of 60mg/ml and 250. mu.l PMSF with a concentration of 17.6mg/ml were added to the tube, mixed well and shaken at 50r/min until the tube became viscous.
250 μ l of DNAse I at a concentration of 100ng/ml was added to the centrifuge tube and shaken on ice for 30min, the viscosity in the centrifuge tube decreased. The centrifuge tube was placed in a flask with ice inside, and the flask was placed in an ultrasonic cell disruptor. Starting an ultrasonic cell crusher, carrying out ultrasonic treatment for ten times, wherein the ultrasonic treatment time is 30s each time, and standing for 30s between two ultrasonic treatments. Vibrating the centrifugal tube from top to bottom until the centrifugal tube is clear and not sticky. Centrifuging the tube at 4 deg.C for 30min at 20000 r/min. The precipitate in the centrifuge tube was discarded to obtain a supernatant. The supernatant is RANKL-TNF sample region fusion protein solution.
And diluting the RANKL-TNF sample region fusion protein solution by four times by using a phosphate buffer solution to obtain a diluent. And filtering the diluent by a filter membrane of 0.22 mu m, and then purifying the protein to obtain the required RANKL-TNF sample region fusion protein.
As shown in FIG. 1, electrophoresis demonstrated successful protein purification of the RANKL-TNF-like domain fusion protein.
As shown in FIG. 2, P-1, P-2 and P-3 were defined as a group to which RANKL was administered at a concentration of 100ng/mL, and N-1, N-2 and N-3 were defined as a negative control group. Through trap staining experiments, the prepared RANKL-TNF sample region fusion protein has activity.
SEQUENCE LISTING
<110> family, Xu
<120> preparation method of RANKL-TNF sample region fusion protein
<130> 1
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 486
<212> DNA
<213> Artificial Synthesis
<400> 1
cggggcaagc ctgaggctca gccgtttgct cacctcacca tcaatgctgc cgacatccca 60
tcgggttccc ataaagtcag tctgtcctct tggtaccatg atcgaggctg ggccaagatc 120
tctaacatga cgttaagcaa cggaaaacta agggttaacc aagatggctt ctattacctg 180
tacgccaaca tttgcttcag gcatcatgaa acctcaggga gcgtacctgc ggactatctt 240
cagctgatgg tatatgtcgt taaaaccagc atcaaaatcc caagttcgca taacctgatg 300
aaagggggga gcactaagaa ctggtcaggg aattctgaat tccactttta ttccataaac 360
gttggaggat ttttcaagct ccgggctggt gaggaaatta gcgtccaggt gtccaaccct 420
tccctgttgg atccggatca agatgcgacg tactttgggg ctttcaaagt tcaagacata 480
gactga 486
<210> 2
<211> 18
<212> PRT
<213> Artificial Synthesis
<400> 2
Thr Ala Tyr Thr Thr Tyr Met Gly Asn Gly Cys Asn Cys Ala Arg Ala
1 5 10 15
Thr Gly
<210> 3
<211> 24
<212> PRT
<213> Artificial Synthesis
<400> 3
Arg Thr Cys Asp Ala Thr Arg Thr Cys Asn Tyr Gly Asn Ala Cys Tyr
1 5 10 15
Thr Thr Arg Ala Ala Asn Gly Cys
20
<210> 4
<211> 23
<212> DNA
<213> Artificial Synthesis
<400> 4
cccgggcaag cctgaggctc agc 23
<210> 5
<211> 27
<212> DNA
<213> Artificial Synthesis
<400> 5
cccgggtcag tctatgtctt gaacttt 27
Claims (1)
1. A preparation method of RANKL-TNF sample region fusion protein comprises five steps; the method is characterized in that:
step one, acquiring a RANKL functional fragment SEQ NO. 1;
step two, obtaining a plasmid solution by using the RANKL functional fragment SEQ NO.1 and a vector, wherein the vector is a pGST-4T series vector;
step three, cloning the plasmid solution obtained in the step two, and converting the plasmid solution into BL21 bacterial liquid;
step four, inducing the BL21 bacteria obtained in the step three under the conditions that the IPTG final concentration is 0.1-0.5 mM and the temperature is 16-25 ℃; obtaining a RANKL-TNF sample region fusion protein solution;
fifthly, carrying out protein purification on the RANKL-TNF sample region fusion protein solution obtained in the fourth step; obtaining RANKL-TNF sample region fusion protein;
wherein, the second step is as follows: purifying the functional fragment of RANKL; mu.L of 10xbuffer, 0.3. mu.L of 100xBSA, 1. mu.L of SmaI and 4.7. mu.L of MilliQ H were added to 20. mu.L of the purified RANKL functional fragment SEQ NO.12O, performing enzyme single cutting; taking 10 mu L of carrier; the vector adopts pGST-4T series vectors; mu.L of 10xbuffer, 0.3. mu.L of 100xBSA, 1. mu.L of SmaI and 14.7. mu.L of MilliQ H were added to the carrier2O, performing enzyme single cutting; the operation temperature of enzyme single cutting of the carrier and the RANKL functional fragment is 37 ℃, and the enzyme single cutting time is 3 hours; respectively carrying out electrophoresis and cutting on the carrier and the RANKL functional fragment SEQ NO.1 after completing enzyme single cuttingDissolving the glue; obtaining carrier fluid and RANKL functional fragment fluid;
respectively purifying 2 mu L of carrier fluid and 6 mu L of RANKL functional fragment fluid, mixing, and adding 1 mu L of 10xT4buffer and 1 mu L of T4DNA ligase; obtaining a connection initial system; connecting the initial system overnight in an environment at 16 ℃ to obtain a connecting liquid;
adding 5 mu L of connecting solution into a culture dish containing DH5 alpha chemical competent cells, and carrying out ice bath for 30 min; placing the mixture in an environment with the temperature of 42 ℃ for heat shock for 90 s; placing on ice for 2.5 min; placing the mixture in an environment with the temperature of 37 ℃, and adding 1mL of LB culture solution; shaking table at 120r/min for 45 min; centrifuging at 5000r/min for 3 min; evenly coating on an LB plate containing 100ng/mL ampicillin; the plate was inverted and incubated overnight at 37 ℃; obtaining plasmid extraction bacterial liquid;
inoculating the plasmid-extracted bacterial liquid to 4mL LB culture medium containing ampicillin for culture; the culture environment is 200r/min shaking table at 37 ℃ for 14 h; carrying out plasmid extraction on the cultured plasmid extraction bacterial liquid to obtain a plasmid solution;
the third step is as follows: adding 2 μ L plasmid solution into a culture dish containing BL21 chemically competent cells, and ice-cooling for 30 min; placing the mixture in an environment with the temperature of 42 ℃ for heat shock for 90 s; placing on ice for 2-3 min; placing the mixture in an environment at 37 ℃, and adding 1mL of LB culture solution; shaking table at 120r/min for 45 min; centrifuging at 5000r/min for 3 min; evenly coating on an LB plate containing 100ng/mL ampicillin; the plate was inverted and incubated overnight at 37 ℃; obtaining transitional bacterial liquid;
taking 1mL of transition bacterium liquid, and transferring the transition bacterium liquid to 100mL of LB culture medium containing ampicillin; shaking overnight at 200r/min at 37 deg.C; obtaining BL21 bacterial liquid;
the fourth step is as follows: taking 30mL of BL21 bacterial liquid, and transferring the liquid to 1000mL of new LB culture medium containing ampicillin; shaking at 37 deg.C for 200r/min until OD reaches 0.8; adjusting the temperature to 22 ℃, adding IPTG with the final concentration of 0.1mM, and standing for 50 min; shaking for 18h at 200r/min to complete induction; centrifuging at 9000r/min for 15min to obtain bacterial mass; after weighing, transferring the fungus blocks to-80 ℃ for freezing; thawing the mushroom blocks and filling the mushroom blocks into a beaker; filling 20mL of lysis buffer solution into a beaker, and uniformly mixing the lysis buffer solution in a rotating manner to ensure that the bacterium blocks are fully resuspended in the lysis buffer solution; filling the uniformly mixed bacterium blocks and lysis buffer solution into a 50ml centrifuge tube;
adding 250 mu L of lysozyme with the concentration of 60mg/mL into the centrifuge tube, and fully and uniformly mixing; adding 250 mu L of PMSF with the concentration of 17.6mg/mL into a centrifuge tube, and fully and uniformly mixing; putting the centrifuge tube covered with the cover to the ice box; shaking the ice box 50r/min to the centrifugal tube to become viscous; if the centrifugal tube is not thickened after 30min by a shaking table, adding 250 microliter of lysozyme with the concentration of 60mg/mL and 250 microliter of PMSF with the concentration of 17.6mg/mL into the centrifugal tube, fully and uniformly mixing, and shaking the shaking table at 50r/min until the centrifugal tube is thickened;
adding 250 mu L of DNAseI with the concentration of 100ng/mL into a centrifugal tube, and oscillating on ice for 30min to reduce the viscosity in the centrifugal tube; putting the centrifuge tube into a flask with ice, and putting the flask into an ultrasonic cell crusher; starting an ultrasonic cell crusher, carrying out ultrasonic treatment for ten times, wherein the ultrasonic treatment time is 30s each time, and standing for 30s between two ultrasonic treatments; vibrating the centrifugal tube up and down; centrifuging the centrifugal tube at the temperature of 4 ℃ for 30min at 20000 r/min; discarding the precipitate in the centrifugal tube to obtain a supernatant; the supernatant fluid is RANKL-TNF sample region fusion protein solution;
the fifth step is as follows: diluting the RANKL-TNF sample region fusion protein solution by four times by using a phosphate buffer solution to obtain a diluent; and filtering the diluent by a filter membrane of 0.22 mu m, and then purifying the protein to obtain the required RANKL-TNF sample region fusion protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710073236.1A CN107056949B (en) | 2017-02-10 | 2017-02-10 | Preparation method of RANKL-TNF sample region fusion protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710073236.1A CN107056949B (en) | 2017-02-10 | 2017-02-10 | Preparation method of RANKL-TNF sample region fusion protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107056949A CN107056949A (en) | 2017-08-18 |
| CN107056949B true CN107056949B (en) | 2021-03-12 |
Family
ID=59598196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710073236.1A Active CN107056949B (en) | 2017-02-10 | 2017-02-10 | Preparation method of RANKL-TNF sample region fusion protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107056949B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102241776B (en) * | 2010-05-25 | 2013-05-08 | 首都医科大学 | RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof |
| CN103060274B (en) * | 2012-12-28 | 2013-12-11 | 首都医科大学 | RANKL-TNF sample region mouse monoclonal antibody and its preparation method and use |
| CN104004080A (en) * | 2014-06-06 | 2014-08-27 | 首都医科大学 | Humanized antibody targeted to RANKL (Receptor Activator Of Nuclear Factor Kappa B Ligand) and TNF-alpha (Tumor Necrosis Factor) and application of humanized antibody |
| US11111284B2 (en) * | 2014-08-21 | 2021-09-07 | The General Hospital Corporation | Tumor necrosis factor superfamily and TNF-like ligand muteins and methods of preparing |
-
2017
- 2017-02-10 CN CN201710073236.1A patent/CN107056949B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107056949A (en) | 2017-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dudakovic et al. | High‐resolution molecular validation of self‐renewal and spontaneous differentiation in clinical‐grade adipose‐tissue derived human mesenchymal stem cells | |
| Yuan et al. | PPARγ and Wnt signaling in adipogenic and osteogenic differentiation of mesenchymal stem cells | |
| JP5031165B2 (en) | Recombinant fusion protein dimer, trimer, quatromer or pentamer bimer or oligomer | |
| JP2015508077A5 (en) | ||
| EP2976097B1 (en) | Compositions comprising collagen and prp for tissue regeneration and their production method | |
| ES2539186T3 (en) | Stromal stem cells | |
| Lopez-Cazaux et al. | Culture medium modulates the behaviour of human dental pulp-derived cells | |
| AU779461C (en) | Osteoprotegerin binding proteins and receptors | |
| JP2018507177A (en) | Factors and cells that provide bone, bone marrow, and cartilage induction | |
| CN117241818A (en) | Combination therapy of amuc_1100 and immune checkpoint modulator for the treatment of cancer | |
| CN107974433B (en) | Enhanced anti-tumor NK cell and preparation method and application thereof | |
| CN107056949B (en) | Preparation method of RANKL-TNF sample region fusion protein | |
| CN104195105B (en) | A kind of culture system in vitro kit and its application method for improving human spermatogoa vigor | |
| JP4610194B2 (en) | Novel chimeric TNF ligand | |
| CN104311668B (en) | Anti-paralichthys olivaceus immunoglobulin D monoclonal antibody as well as application and preparation method thereof | |
| JP2012509942A5 (en) | ||
| Paul et al. | Lessons on skeletal cell plasticity from studying jawbone regeneration in zebrafish | |
| Li et al. | Purification and characterization of recombinant human interleukin-29 expressed in Escherichia coli | |
| WO2003033663A2 (en) | Rankl mimics and uses thereof | |
| US20220411472A1 (en) | Self-assembling circular tandem repeat proteins with increased stability | |
| CN103214561B (en) | Human hepatitis c virus core antigen and preparation method and application thereof | |
| RU2408730C1 (en) | RECOMBINANT PROTEIN Collbd-BMP-7, RECOMBINANT PLASMID pCollbd-BMP-7, STRAIN Escherichia coli-PRODUCER OF RECOMBINANT PROTEIN Collbd-BMP-7, METHOD TO PRODUCE RECOMBINANT PROTEIN Collbd-BMP-7 | |
| KR101785502B1 (en) | A fusion protein of fibronectin protein and Bone morphogenetic protein-2 | |
| CN103937828A (en) | Preparation method of fusion protein of porcine interferon-alpha 1 and thymosin-alpha 1 | |
| Tang et al. | A living eukaryotic autocementation kit from surface display of silica binding peptides on Yarrowia lipolytica |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhu Sipin Inventor after: Xu Jiake Inventor after: Zhou Jie Inventor after: Xiao Jian Inventor after: Zhang Hongyu Inventor after: Li Xiaokun Inventor before: Xu Jiake Inventor before: Zhou Jie Inventor before: Zhu Sipin Inventor before: Xiao Jian Inventor before: Zhang Hongyu Inventor before: Li Xiaokun |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |