CN107043420B - A kind of anti-PD-1 antibody and its application - Google Patents

Abstract

The present invention provides a kind of 1 antibody of anti-PD or its antibody fragment, can specifically bind 1 molecules of PD, in conjunction with can block the combination of PD 1 and PD L1 and/or PD L2 later, and can generate a series of biological effects.

Description

A kind of anti-PD-1 antibody and its application

Technical field

The invention belongs to medical domains, and in particular to a kind of antibody or its antibody fragment, the antibody or its antibody fragment are special Anisotropic recognizer death molecule (programmed cell death 1, PD-1) can be used as immune activation object to stimulate machine The immune response of body, to generate the function and effect of the diseases such as antitumor.

Background technology

2011, cancer was more than heart disease, became the global first big cause of death.WHO is announced in December, 2013, the whole world Newly-increased cancer patient's number alreadys exceed 14,000,000 every year, this is compared with 12,700,000 people of statistical result in 2008, and number is substantially Increase.The death toll of the same period, cancer patient also increased, and increase to 8,200,000 people from past 7,600,000 people.Exempt within 2013 Epidemic disease anti-cancer therapies are chosen as by Science magazines first of annual 10 big technological breakthroughs, and since then, tumour immunotherapy research is continuous Breakthrough is obtained, clinical application also achieves immense success, is controlling for current cancer therapies research field most foreground Treatment means are expected to become the new conventional treatments after operation, chemicotherapy method.

In early stage the 1980s, Allison and other researchers determine and are responsible for identifying antigen on T cell surface The gene structure of α β T cell receptors (TCR).The later stage eighties, Boone, Rosenberg, Old et al. are studied and are found respectively, no With there are some tumour specific antigens in tumour patient body, simultaneously specific killing tumour cell can be identified by T cell, So that the hope of immunotherapy of tumors rekindles, numerous studies are dedicated to the research and development of tumor therapeutic vaccine.However, The study found that only TCR signals are not sufficient to activation antigen specific T-cells, the activation of T cell also needs to Schwartz et al. The participation of other molecules, that is, so-called second signal " costimulatory molecules " synergistic effect.Simultaneously the study found that only specific Antigen presenting cell (APCs) can express costimulatory molecules, and most cells, including tumour cell can not carry For costimulatory molecules signal.In early stage the 1990s, Allison etc. is found that CD28 molecules, is capable of providing t cell activation Required second signal.It is CD28 molecules that Linsley et al. researchs later, which find to express in the B7 molecules of APCs cell surfaces, Ligand, and Allison etc. is studied by mouse model, and the tumour cell that B7 molecules can be expressed after transformation can be small Mouse immune system is removed rapidly.Therefore, the missing of tumour cell B7 developed by molecule may be that body can not effective activated t cell Immune key factor.

Show Cytotoxic T lymphocyte associated antigen-4 (cytotoxic T in the research of the 1990s Lymphocyte-associated antigen-4, CTLA-4) play in vivo with the antipodal functions of CD28, if CD28, this kind of molecular proportion work is an automobile " throttle ", then this molecule of CTLA-4 play be " brake " work( Energy.After body T cell activation, this kind of molecule meeting " inspection " immune cell activation degree, in the cell of activation in expression Immune suppression function is adjusted and plays, so that the T cell of body is unlikely to hyper-proliferative and activates and injuring normal cell, because This this kind of molecule is otherwise known as " immunologic test point " molecule.Cancer cell utilizes the immunosuppression mechanism of this kind of molecule, escapes body Immune system killing.Studies have shown that the signal of CTLA-4 is blocked using CTLA-4 monoclonal antibody specifics, it can be notable T cell activity is improved, and is found in the research of the mouse model of kinds of tumors, it can be big after monoclonal antibodies block CTLA-4 It is big to improve rejection ability of the mouse to tumour.Other than CTLA-4, immunologic test point molecule further includes PD-1, PD-L1, TIM- 3, the B7 such as LAG-3, TIGIT superfamilies and CD28 superfamily molecules.These " inhibition " are blocked to believe by monoclonal antibody specific Number, the activity of T cell can be discharged again, so that these T cells can play antitumor action.Tumour immunity checkpoint Therapy is the contribution of antitumor strategy：On the one hand, immunologic test point therapy is not directly targeted tumour cell, but acts on The immune system of patient Yu, the signal functioned by the T cell that lifts restrictions is to discharge T cell activity；On the other hand, this It plants the activation to T cell and does not have antigentic specificity, but entire immune system is reactivated, therefore can be suitable for The treatment of a variety of difference tumours, can be as the conventional therapies of tumour.Moreover, the success of CTLA-4 antibody blockings therapy, It has started immunosupress relevant molecule and has blocked the development and application in oncotherapy, be representative based on PD-1 and PD-L1 etc. The blocking antibody of immunosuppression molecule exploitation equally achieves important breakthrough, and U.S. FDA in 2014 has approved two PD-1 resistances Disconnected property antibody, nivolumab and pembrolizumab, are used for the clinical treatment of melanoma.

Currently, there are still the demands for developing other anti-PD-1 antibody.

Invention content

One aspect of the present invention is to provide a kind of anti-PD-1 antibody that can be combined with PD-1 molecular specifics or it is anti- Body segment, the anti-PD-1 antibody or its antibody fragment include such as SEQID NO.:3、SEQ ID NO.:4 and SEQ ID NO.:5 Shown in heavy chain CDRs；And such as SEQ ID NO.:6、SEQ ID NO.:7 and SEQ ID NO.:Light chain CDRs shown in 8, Described in anti-PD-1 antibody or its antibody fragment include SEQ ID NO.:Heavy chain CDR and/or SEQ ID NO. shown in 5:8 Shown in light chain CDR.The wherein described antibody fragment is selected from Fab, Fab ', Fab '-SH, Fv, scFv, F (ab ')₂, double antibody and packet Peptide containing CDR, the combination of the anti-PD-1 antibody or its antibody fragment blocks PD-1 and PD-L1 and/or PD-L2.

In some embodiments, the anti-PD-1 antibody or its antibody fragment include SEQ IDNO.:Heavy chain shown in 9 Sequence and/or SEQ ID NO.:Sequence of light chain shown in 10.

In some embodiments, the anti-PD-1 antibody or its antibody fragment are mouse source or the anti-PD-1 monoclonals of humanization Antibody.

The second aspect of the present invention is to provide the multinuclear glycosides for the separation for encoding the anti-PD-1 antibody or its antibody fragment Acid.

The third aspect of the present invention is to provide the expression vector for including the polynucleotides.

The fourth aspect of the present invention is to provide the host cell for including above-mentioned expression vector.

The fifth aspect of the present invention is to provide the method for preparing the anti-PD-1 antibody or its antibody fragment, the method Including：1) host cell is cultivated；2) polypeptide is recycled from the host cell or culture medium.

The sixth aspect of the present invention is to provide a kind of composition containing the anti-PD-1 antibody or its antibody fragment.

The seventh aspect of the present invention is that providing the anti-PD-1 antibody or its antibody fragment is preparing for improving T cell Purposes in the drug of secretion of gamma-IFN level.

The eighth aspect of the present invention is that providing the anti-PD-1 antibody or its antibody fragment is preparing treatment influenza or controlling Treat the purposes in the antitumor drug for being preferably non-small cell lung cancer or colorectal cancer.

Anti- PD-1 antibody provided by the invention or its antibody fragment can specifically bind PD-1 molecules, in conjunction with later capable of The combination of PD-1 and PD-L1 and/or PD-L2 is blocked, and a series of biological effects can be generated.These biological effect packets It includes：It is special can to improve tumor cases tumour for the level that healthy individuals influenza virus specific T-cells secretion of gamma-IFN can be improved The level of specific T cell secretion of gamma-IFN can especially inhibit mouse interior tumor to grow.

Description of the drawings

Fig. 1 is to indicate that 6# antibody can block the figure of the combination of PD-1 and PD-L1.

Fig. 2 is to indicate that 6# antibody can activate the figure that influenza virus specific T-cells react in healthy individuals.

Fig. 3 be indicate 6# antibody can in activated tumor case specific for tumour antigen t cell responses figure.

Fig. 4 is the expression and purification for indicating humanization 6# antibody proteins and the figure of SDS-PAGE purity detecting results.

Fig. 5 is the figure for the gradient ELISA experimental results for indicating humanization 6# antibody combinations PD-1.

Fig. 6 is to indicate that humanization 6# antibody in vitro blocks the figure of the combination of PD-1/PD-L1.

Fig. 7 is the figure for indicating SPR detection 6# antibody and the affinity of humanization 6# antibody combinations PD-1.

Fig. 8 is the figure for indicating SPR detection 6# antibody and the affinity of humanization 6# antibody combinations PD-1.

Fig. 9 is the figure for indicating 6# antibody NCG mouse HCC-827 tumor model inhibition assay results.

Figure 10 is the figure for indicating humanization 6# antibody in NCG mouse difference tumor models inhibition assay results.

Specific implementation mode

Important member of the PD-1 molecules as CD28 families, other further include CD28, CTLA-4, ICOS etc..PD-1 molecules The B cell in activation, T cell and bone marrow cell etc. are expressed, the I type memebrane proteins that molecular weight is about 55kDa have now been found that PD-1 has Two ligands, are PD-L1 and PD-L2 respectively, and PD-1 inhibits T cell activity by the interaction with PD-L1 and/or PD-L2. PD-L1 can be expressed in kinds of tumor cells surface height, by the interaction of PD-1 and PD-L1, can be inhibited tumor-infiltrated The functional activity of lymphocyte includes the secretion level etc. of the T cell proliferative capacity of TCR mediations and cell factor, therefore quilt The important mechanisms that kinds of tumors is monitored using and as tumour cell escape immune system.And antibody specificity is utilized to block PD-1 With the interaction of PD-L1 and/or PD-L2, the T cell in holddown can be activated so that the function of T cell is released It puts, restores the function of T cell, to reach using body immune system killing tumor cell and then carry out the work of oncotherapy With.

The present invention is made based on above-mentioned principle, the present invention in anti-PD-1 antibody or its antibody fragment by with PD-1 molecular specifics combine, and block the combination of PD-1 and PD-L1 and/or PD-L2, to make T cell activation, improve T cell point Secrete the level of IFN-γ.

In the application, anti-PD-1 antibody include with the PD-1 antibody specifically bound or derivative, also include with it is original Antibody shows the antibody fragment of substantially the same antigentic specificity." antibody fragment " or " antibody binding fragment " refers to antibody Antigen-binding fragment and antibody analog generally include the antigen binding domain or variable region of at least partly maternal antibody, such as One or more CDR.Antibody fragment retains at least some of binding specificity of maternal antibody.Antibody fragment include selected from Fab, Fab′、Fab′-SH、Fv、scFv、F(ab′)₂, double antibody, the peptide etc. comprising CDR.

" Fab segments " is made of the CH1 and variable region of a light chain and heavy chain.

Contain two heavy chain fragments of the CH1 and CH2 structural domains comprising antibody in the area " Fc ".Two heavy chain fragments by two or Multiple disulfide bond are simultaneously kept together by the hydrophobic effect of CH3 structural domains.

" Fab ' segments " is containing a light chain and comprising between VH structural domains and CH1 structural domains and CH1 and CH2 structural domains The part of one heavy chain in region forms interchain disulfide bond between two heavy chains of two Fab ' segments to form F (ab ')₂Point Son.

“F(ab′)₂Segment " contains the part that two light chains and two include the constant region between CH1 and CH2 structural domains Thus heavy chain forms interchain disulfide bond between two heavy chains.Therefore, F (ab ')₂Segment is by passing through the disulfide bond between two heavy chains The two Fab ' segments composition to keep together.

" areas Fv " includes but to lack constant region from the variable region of both heavy chain and light chain.

" single-chain Fv antibody (scFv antibody) " refers to the antibody fragment of the VH and VL structural domains comprising antibody, these structural domains It is present in single polypeptide chain.In general, in addition Fv polypeptides include peptide linker between VH and VL structural domains, which makes The required structure for antigen binding can be formed by obtaining scFv.

" double antibody " is that there are two the small antibody fragments of antigen binding site for tool.The segment is included in identical polypeptide chain In the heavy-chain variable domains (VH) (VH-VL or VL-VH) that are connect with light variable domains (VL).By using be as short as cannot The connector matched between two structural domains of same chain so that the complementary domain of the structural domain and another chain matches simultaneously Form two antigen binding sites.

" humanization " form of non-human (such as mouse) antibody is to derive from non-human immune globulin containing minimal The chimeric antibody of Bai Xulie.The major part of humanized antibody is human immunoglobulin(HIg), wherein some hypervariable region residues quilt of receptor antibody With it is required specificity, affinity and ability non-human species hypervariable region residue displacement, non-human species for example have mouse, Rat, rabbit or non-human primates.In some cases, the Fv framework regions residue of human immunoglobulin(HIg) is residual by corresponding non-human Base replaces.In addition, humanized antibody may include the not residue present in receptor antibody or donor antibody.Carry out these modification with It is further improved antibody performance.

When referring to ligand/receptor, antibody/antigen or other combination clock synchronizations, " specificity " combine refer to albumen and/or its The association reaction of the albumen such as PD-1 is determined whether there is in the heterogeneous population of its biological reagent.Therefore, specified Under the conditions of, specific ligand/antigen is combined with specific receptor/antibody, and not with present in significant quantity and sample its Its protein binding.

The present invention also provides the pharmaceutical compositions containing PD-1 antibody of the present invention or its antibody fragment.In order to prepare medicine group Object is closed, various required dosage forms can be prepared by making antibody or its antibody fragment be mixed with pharmaceutical acceptable carrier or excipient. As the present invention medical composition dosage form type, such as can enumerate the tablet as oral agents, powder agent, pill, Powder, granule, granula subtilis, soft/hard capsule, film coating agent, pilule, sublingual tablet, paste etc., as non-oral dose, Injection, suppository, percutaneous agent, ointment, emplastrum, liquid for external use etc. can be enumerated, those skilled in the art being capable of basis Administration route and administration object etc. select dosage form appropriate.

The dosage of the active ingredient of the pharmaceutical composition of the present invention, according to administration object, object internal organs, symptom, administration Method etc. is different and has differences, it may be considered that type, medication, the age of patient and weight, the symptom of patient of dosage form Deng being determined according to the judgement of doctor.

Pharmaceutical composition of the present invention can also contain other medicaments, including but not limited to cytotoxic agent, cell growth inhibition Agent, anti-angiogenetic therapy drug or antimetabolite, target tumor drug, immunostimulant or immunomodulator or and cell toxicant The antibody that agent, cytostatic agent or other drug toxicities combine.

Hereinafter, carrying out more specific description to the present invention by embodiment.But it will be appreciated by those skilled in the art that It is the purpose that embodiment below is intended to be merely illustrative of the present, and is not intended to limit the present invention.

The preparation of embodiment 1.6# antibody

The structure of 1.PD-1 recombinant expression plasmids

Using the cDNA clone plasmid SC117011 of Origene companies PD-1 as template, designs two primers and introduce respectively Restriction enzyme site SgfI and MluI, are cloned into expression vector pCMV6-Entry, establish the recombinant eukaryon expression matter of PD-1 full-length proteins Grain.

The primer sequence of clone is as follows：

Upstream amplification primer sequence：CACGCGATCGCATGCAGATCCCACAGGCGC

Downstream amplification primer sequence：ACCGACGCGTGAGGGGCCAAGAGCAGT

The expression and purification of 2.PD-1 recombinant proteins

1) HEK293T cells are transfected：HEK293T cells are with 1:3 reach and continue to cultivate in culture dish；Take 7.5mL DMEM In (serum-free and antibiotic) to 50mL pipes, 300 μ L polyetherimide (PEI) MegaTran, 1.0 mixings are added；75 μ g are added In PD-1 recombinant plasmid dnas to mixing liquid, mixing simultaneously stands 30 minutes；It takes respectively in 515 μ L to each culture dish in 37 DEG C 5% CO₂It is cultivated in incubator.After transfection 24 hours, 25 μ L 2M sodium butyrates are added per ware cell to final concentration 5mM.

2) lytic cell：After transfection 48 hours, cell cracking is carried out.Culture medium is sucked, 1mL PBS are added and are rinsed, Suck PBS.1mL lysis buffers are added, use preceding addition protease inhibitors PI and PMSF.It is placed in ice chest and shakes on shaking table It swings, collects the lysate in all culture dishes, supernatant is collected in 4 DEG C of centrifugations.

3) DDK affinity chromatographys column purification：With 0.45 μM, the lysate supernatant after 33mm pvdf membrane filter filter centrifugations is simultaneously 15mL pipes are transferred to, the Beads 1mL mixed are added, are put into after sealing in 360 degree of vortex mixers, in 4 DEG C of combinations 2 hours；It takes out 15mL is managed, and lysate is poured into BIO-RAD chromatographic columns, and catch and penetrate liquid, and liquid sampling WB detections are penetrated after drop is most；With cracking Wash buffer column material 1-2 times rinses Beads 3 times with TBST again after drop is most, is washed with 0.1M Glycine pH3.5 after drop is most De-, 200 μ L, drop are not collected to the greatest extent for the first time, second and third each 500 μ L, and 250 μ L of third time are collected into a 1.5mL pipe, and It is rapidly added NaH₂PO₄(pH=11.0) be neutralized to pH7.0 or so, often pipe be added glycerine to final concentration of 10%, Tween-80 extremely Final concentration of 0.1%.PD-1 albumen after purification is identified with SDS-PAGE.

The preparation and screening of 3.PD-1 monoclonal antibodies

The overall length PD-1 recombinant proteins (hereinafter referred to as PD-1 antigens) of the purifying generated according to standard method recombination are used It is immunized in B6/C57 mouse (Beijing Vital River Experimental Animals Technology Co., Ltd.).The specific method is as follows：

1) animal immune：Purified PD-1 antigens are emulsified with complete Freund's adjuvant, using subcutaneous or intraperitoneal injection side 6-8 week old BALB/c mouses are immunized in method, and only for 50 μ g/, interval carries out being immunized for second after two weeks immunizing dose, with not exclusively not Family name's adjuvant emulsion, immunizing dose are 50 μ g/.It is immune that tail blood is taken to measure serum titer with ELISA method gradient dilution afterwards twice；Root Determine whether booster immunization according to result, chooses the highest mouse of antibody titer and carry out cell fusion.

2) cell fusion：Myeloma cell uses the sp2/0 in the sources BALB/c, and exponential phase is in when fusion；It takes Immune mouse spleen, is made lymphocyte single cell suspension；Mouse spleen lymphocyte is with myeloma cell with 1:5-1:10 mixing, 37 DEG C 50%PEG (PH 8.0) 1mL is added dropwise, incomplete culture medium and remaining terminate liquid is added, HAT is added after abandoning supernatant in centrifugation Culture medium suspension mixing, MC constant volumes to 50mL are dispensed into 3.5cm culture dishes, are put in wet box, are placed in 37 DEG C, 5%CO₂It is permanent It is cultivated in warm incubator.

3) it screens and clones：Fusion selects cell clone in 7-10 days, and ELISA is carried out using the PD-1 recombinant proteins of purifying Test.Mark cell strain number.Limiting dilution is carried out to positive hole cell, ELISA values is measured within 5-6 days after each limiting dilution, chooses The higher monoclonal hole of OD280 positive values is taken to carry out limiting dilution, hardened fruit is the positive entirely until ELISA measures 96 orifice plates.It chooses The monoclonal singling for taking positive value high.It is 6# that it, which corresponds to fusion plate cell strain,.

4) preparation and purification of cell conditioned medium monoclonal antibody：By cell strain 6# use containing 15% serum DMEM medium cultures in It cultivates, is spread cultivation to about 4 × 10 in 10cm culture dishes⁷When a, 800rpm centrifuges 5min, abandons supernatant and cell is transferred to 2L rolling bottles In, serum free medium is added, it is about 3 × 10 to make cell density⁵A/ml.After continuing culture 1~2 week, when cell mortality reaches (cell density is about 1-2 × 10 at this time when to 60%-70%⁶A/ml), collect cell suspension 6000rpm high speed centrifugations 20min, takes supernatant, affinity chromatography to carry out supernatant purifying, and corresponding column material, monoclonal antibody 6# hypotypes are selected according to antibody die mould For IgG1, purified using proteinG.Monoclonal antibody concentration mensuration after purification, packing (100uL/ is managed, a concentration of 1mg/ml), It is stored in 4-8 DEG C.

The neutralization activity of 4.PD-1 monoclonal antibodies 6# detects

Experiment material：PD-L1 surely turns cell line, PD1-FC albumen (or PD1-DDK albumen)；Goat-Anti-FC- FITC IgG (or Goat-Anti-mouse-FITC IgG)

1) PD-1 albumen working concentrations are determined

Material	It is required that	Addition	Addition sequence
				PD-L1 cell lines	5~10 × 104/ hole	40uL	Step1
Blank supernatant/M-IgG	/	80uL	Step2
				Albumen PD1-Fc/DDK	Tape label	30uL	Step3

By PD1-Fc/DDK albumen since 4~5ug/mL concentration gradient doubling dilution at least five concentration, be separately added into thin Born of the same parents are in the mixed liquor with supernatant.4 DEG C of reaction 60min after mixing, are added corresponding secondary antibody after washing, 4 DEG C of reaction 45min make It is read with quantitative fluorescence analysis instrument (Glomax, Promega company).

Using minimum protein concentration values of Positive fluorescence intensity when most strong as albumen working concentration.

Not add PD1-FC or add PDL1-FC as negative control hole.

2) antibody screening

According to above-mentioned reaction system, antibody screening, secondary antibody concentration 1 are carried out:200~1:500.

Not add PD1-FC or add PDL1-FC as negative control hole.

Using blank supernatant or M-IgG as Positive control wells.

5. the expression and purification of mouse source antibody

By 2 × 10⁶Cell strain 6# cells by the way that the BALB/C mice of 6-8 week old is injected intraperitoneally, (purchased from dimension tonneau, China is public Department), mouse ascites are collected after 2-3 weeks, the ascites of acquisition is first passed through after precipitation is gone in centrifugation, isometric 20mM is added thereto Na₃PO₄(pH 7.0) is uniformly mixed, then with 0.22 μm of membrane filtration ascites, mainly prevents other impurity in ascites to column Son causes to damage；Prepare loading purifying after the completion of filtering.

Protein G (5mL) HP affinity columns (GE companies) are connected to AKTAPurifier/Explorer/FPLC/ On START (GE companies), following process is operated on machine：First 20% ethyl alcohol in column is gone out with water, then uses 20mM Na₃PO₄, the buffer solution of pH 7.0 balances pillar, after show that above-mentioned ascites passes through 5mLloop rings by conductance after being 4.5% on instrument The mode of loading is injected to be combined with Protein G, flow velocity 1mL/min；After UV is steady, it is added 1M's in subsequent collecting pipe The about 0.8mL of Tris pH 9.0 (collected volume 3.2mL) then make 100% 0.1M Gly pH 3.0 into program and wash The de- antibody hung on pillar, collects the sample of elution, sample preparation, and gel electrophoresis identification judges that glue figure stripe size is correct；On if The method that identification is errorless, and liquid is changed using concentration is stated, the antibody of concentration is constantly diluted with PBS, repeatedly 100 times of concentration and dilution or more Sample is dispensed afterwards, directly uses or be stored in -80 DEG C of refrigerators.

6. humanization 6# antibody expressions purify

Humanization 6# antibody by building the NO. of ID containing SEQ respectively:9 and SEQ ID NO.:The pCAGGS of 10 polynucleotides Transfection 293T cells, the antibody of expression purify expression vector (Addgene companies) through Protein G affinity column chromatographies jointly.Tool Body includes：

1) 14-16h before transfection divides the larger cell of cell density to disk (a such as disk 100% is paved with the 10cm of cell Culture dish is with 1:3 are passed on), after 14-16h, cell density reaches can be transfected on 70%.

2) by taking 10cm culture dishes transfect adherent 293T cells as an example：The amount of plasmid needed for transfection is 20 μ g/ disk (light chains: Heavy chain=1:1, mass ratio), it is diluted in the HBS liquid of 100 μ L/ disks, is stood after mixing；With PEI (μ L):Plasmid quality (μ g)= 1:The dosage of 4 ratio-dependent PEI (1mg/mL) is diluted in the HBS liquid of 100 μ L/ disks, is stood after mixing.Above-mentioned two solution Mixing 5min is individually stood, the two is mixed continue to stand 20min later, be finally added to the cell culture fluid to be transfected In.

3) after transfecting 4-6h, liquid is changed to the cell of transfection, first with changing fresh nothing into again after twice of the PBS rinses of 2-3mL The DMEM culture mediums of serum (press 1:1000 add mycillin), in 37 DEG C of constant temperature, 5%CO₂Incubator in cultivate expression.

By the cell culture fluid after above-mentioned transfection, supernatant is collected after 3 days in culture, liquid is changed with DMEM culture mediums, then to the Seven days again by a supernatant.The supernatant that 2 times are collected mixes, and purifies destination protein, and purification process uses the above-mentioned step of the present embodiment Protein G mouse source antibody purification process in rapid 5.

7.PD-1-mFc protein expression and purifications

By PD-1 genes and mouse source antibody Fc district CH2 and CH3 Gene Fusion, the pCAGGS expression of structure PD-1-mFc albumen carries Body (Addgene companies), common to transfect 293T cells, the antibody of expression is purified through Protein G affinity column chromatographies.It expresses and pure Change method uses expression and purification process in above-mentioned 5.

Embodiment 2.PD-1 blocking antibodies screen and affinity analysis

The PD-1 albumen expressed by 293T cells in vitro carries out mouse immune, the monoclonal antibody of acquisition carry out PD-1 with The antibody of specific inhibition PD-1 and PD-L1 interactions is capable of in the blocking experiment screening of PD-L1.

It is prepared by the total length expressed 293T cells of 1.PD-L1

In the present embodiment, by by PD-L1 overall lengths (pEGFP-N1 carrier-GFP tagged-plasmids, PD-L1-GFP-p (Clontech companies) transfects 293T cells (ATCC), obtains the 293T cells of expression PD-L1 overall lengths.First 1 day is transfected according to 0.5 ~2 × 10⁵Cell per well is inoculated in 24 well culture plates, and the not antibiotic DMEM complete mediums (GIBCO of 500 μ l are added Company), cell confluency is up to 70~80% when ensureing to transfect.1 μ g PD-L1-GFP-p plasmids be diluted in 50 μ l without serum and In the culture medium of antibiotic, gently mixing.2 μ l PEI (4mg/ml) are diluted in the culture medium that 50 μ l are free of serum and antibiotic In, gently mixing.After five minutes, 50 μ l PEI dilutions are added drop-wise in 50 μ l DNA dilutions, gently mixing, are incubated at room temperature 20 minutes.100 μ l PEI/DNA compounds, which are added drop-wise in every hole and are gently shaken, makes it uniformly be mixed with fresh culture medium. After cell is put into 4~6h of incubator incubation, replaces serum-containing medium and remove compound.Cell is placed on 37 DEG C, CO₂It incubates Case continues after being incubated 24 hours, detects GFP expressions by stream type cell analyzer (BD ARIA II), evaluation PD-L1 is complete The expression of long expression 293T cells.

2. antibody blocking experiments

By 6# antibody and PD-1-mFc albumen (acquisition of embodiment 1) according to molar ratio 2:1 ratio mixing postposition is incubated on ice It educates 1 hour, is added to later containing 2 × 10⁵The total length expressed 293T cells of PD-L1 in, set on ice be incubated 30 minutes.Setting Ebola virus GP protein specific antibodies 4G7 (Mapp Biopharmaceutical) is negative control；PBS cleanings later two It is secondary, the anti-mouse IgG secondary antibodies of APC labels are added, are cleaned twice with PBS buffer solution after being incubated 30 minutes, it is finally molten with 300mL PBS Liquid carries out flow cytometry after being resuspended.The results are shown in Figure 1, the results showed that, it is complete that PD-1-mFc can significantly be attached to PD-L1 On the 293T cells of long expression, and the combination of PD-1 and PD-L1 can be completely inhibited by being added after 6# antibody, so that PD-1- MFc not can be incorporated on the PD-L1 albumen of 293T cell surfaces.Therefore, 6# antibody can significantly inhibit PD-1 in cellular level With the combination of PD-L1.

Activation capacity of the embodiment 3.PD-1 blocking antibodies to influenza-specific T cells

It blocks the combination of PD-1 and PD-L1 that can discharge T cell activity, improves specific T-cells cell Proliferation and cell Cytokine secretion is horizontal.Therefore, in the present embodiment, by acquiring the peripheral blood of healthy individuals, and influenza-specific T cells are carried out Amplification in vitro culture, later by elisa experiment (ELISPOT) to be added PD-1 blocking antibodies after influenza it is special The influence of property T cell and non-specific T-cell reaction level is evaluated.

1. healthy volunteer's peripheral blood lymphocytes (PBMCs) detaches：

Vein peripheral blood of the lymphocyte from healthy individuals used in the present invention.Individual by screening is through clinician After medical fitness, detailed programs flow and the quantity of required blood are informed by experimenter, agree to and sign know together through volunteer Meaning book, by clinical worker, to volunteer, blood was collected.2 healthy volunteers of final this project screening, when blood sampling, use Contain EDTA-K₂The 9ml disposal vacuums heparin tube (VACUETTE, Austrian Gray receive company) of anti-freezing, every volunteer adopts Blood about 20-25ml overturns anti-hemostasis-coagulation immediately after blood sampling.

1) first by the peripheral blood of fresh acquisition with 121 DEG C of high pressure sterilization phosphate buffers after cooling (PBS, pH7.4) Diluted blood sample is carefully added into preprepared 15ml lymphocyte separation mediums and (is given birth to purchased from the Tianjin oceans Hao by one times of dilution Object Technology Co., Ltd.) in, when addition, is careful, is slowly added to, and avoids interface chaotic；

2) 20 points are centrifuged with horizontal centrifuge (SORVALL Stratos, Thermo companies of the U.S.) 700g under the conditions of 25 DEG C Clock, reduction of speed is adjusted to most slow when stopping；

Four layers of sample point after centrifugation, top layer's blood plasma is sucked out with Pasteur pipette, and the second layer is carefully sucked out later In buffy coat to new sterile centrifugation tube, as thick pure PBMCs cells；

3) thick pure PBMCs cells are diluted in equal volume with isometric phosphate buffer (PBS, pH7.4), later at 25 DEG C Under the conditions of with the centrifugal force 10 minutes of 800g；

Supernatant is discarded, is resuspended with 7ml serum-frees RPMI1640 (GE companies of U.S. Hyclone brands), the 500g at 25 DEG C Centrifugation 5 minutes；

Supernatant is discarded, is resuspended, adding 7ml, (FBS, U.S. Thermo Fisher company brands Australia are come containing 10% fetal calf serum Source) RPMI-1640 culture mediums cleaning, at 25 DEG C 500g centrifuge 5 minutes；

4) it is resuspended with RPMI-1640 culture mediums of the 3ml containing 10%FBS after discarding supernatant, takes appropriate gravity treatment liquid in hemocytometer Cell count is carried out on number plate, is used in combination the RPMI-1640 culture mediums final adjustment containing 10% serum to 2.5 × 10⁶Cell/ml is close It is spare to obtain PBMCs cells for degree；

5) the influenza M1 antigen polypeptides library that every peptide final concentration 5ug/mL is added in cell suspension is stimulated, in culture Third day is added the recombination leukocyte mesonium-2 (rIL-2) of final concentration of 20U/mL and continues to cultivate afterwards, third day in incubation It was measured according to culture medium state half with the 7th day and changes liquid, and supplement 20U/mL rIL-2, the tenth day harvest cell carries out related inspection It surveys.

The T cell activation that 2.ELISPOT detects antibody is horizontal

1) ELISPOT detects cytositimulation culture

ELISPOT plates (Merck Millipore Corp.) shift to an earlier date 12 hours or more to be resisted with phosphate buffer (pH7.4) is diluted Human gamma-interferon monoclonal antibody is coated with, and 4 DEG C horizontal positioned.It is used containing 10% serum (HyClone) before stimulator antigen and cell is added RPIM-1640 culture mediums are closed 1 hour under room temperature.

2009H1N1 influenza viruses M1 overlapping polypeptides library is dilute with the RPMI-1640 culture mediums of 10% serum (HyClone) It releases to every 5 μ g/ml of polypeptide, 100 μ l is added per hole into ELISPOT plate holes, each peptide library sets two repeating holes, separately sets without more Peptide stimulates blank control wells and phytolectin (PHA) to stimulate Positive control wells.The control of this experimental setup includes：

No polypeptide stimulation, no antibody are negative control；

No polypeptide stimulation, adds antibody；

Polypeptide stimulates, no antibody；

Polypeptide stimulates, and adds antibody；

The antibody being wherein added includes：6# antibody, positive control antibodies Nivolumab (United States Merck company) and unrelated Antibody EBOLA virus GP protein antibody 4G7 (GP- α).Antibody is added in 96 holes according to 10 μ g/ml final concentrations and carries out stimulation culture.

100 μ l are added in PBMCs cell per wells after dilution, 100 μ l polypeptides dilutions and 100 μ l will be contained after adding The ELISPOT plates of PBMCs dilutions set 37 DEG C, 5%CO₂It is incubated 18 hours under the conditions of (carbon dioxide).

2) ELISPOT board-washings and result obtain

A) after being incubated, hole inner cell liquid is discarded, the deionized water that 200 μ l room temperature are added in every hole rapidly is cleaned 2 times, The PBS (PBST) for containing 5 ‰ Tween-20 later is cleaned 3 times.

B) washing lotion is removed, firmly buckles and does on blotting paper, the diluted detection antibody of 100 μ l is added per hole, be incubated at room temperature 2h.

C) removal detection antibody-solutions, PBST are cleaned 3 times, and the Streptavidin-HRP diluted is added per hole later and combines 100 μ l of object are incubated at room temperature 1h.

D) it develops the color：Streptavidin-HRP conjugate solution is removed, PBST is cleaned 3 times, PBS cleanings later 2 times.It is absorbing water Firmly buckle dry on paper, 100 μ l AEC substrate solutions are added per hole later, after being incubated at room temperature 15~30 minutes, when seeing clearly When spot, with distilled water flushing with stopped reaction.

E) 37 DEG C or dry at room temperature, later by ELISPOT plates with automatic plate reader (C.T.L) to anti-in the holes ELISPOT The spot answered is counted, and adjusting parameter and is carried out quality control later, is provided end reaction result.

3. interpretation of result

By counting 10⁵The specific spots number that is generated after stimulation in cell is simultaneously analyzed, and evaluation PD-1 is blocked Influence of the antibody to T cell activation.

As a result it shows (Fig. 2), under no polypeptide incentive condition, the stimulation hole phase of Nivolumab positive control antibodies is added Stronger t cell immune response can be generated for negative control hole, while 6# antibody can generate comparable levels of T cell and exempt from Epidemic disease is reacted, and GP- α negative control antibodies are then compared with negative control hole without significant difference.

The comparison of T cell activation level after each antibody is added under to influenza polypeptide incentive condition finds to be added The stimulation hole of Nivolumab positive control antibodies can generate stronger t cell immune response relative to negative control hole, simultaneously 6# antibody can generate comparable levels of t cell immune response, and GP- α negative control antibodies are then compared with negative control hole without notable Difference.

Therefore, 6# antibody can in vitro under condition of culture effective activation healthy individuals T cell, promote it to generate IFN- γ, to enhance its T cell immune function.

Activated in Vitro ability of the embodiment 4.PD-1 blocking antibodies to non-small cell lung cancer case tumor specific T cells

One of the important application of PD-1 blocking antibodies is its antitumor action, and the present embodiment acquires 15 non-small cell lungs Carninomatosis Patients with Peripheral blood carries out in vitro culture using tumour-specific polypeptides, evaluates 6# antibodies on tumor peptide library specificity Ts later The activation capacity of cell is detected, the antitumor potential for the PD-1 blocking antibodies cell in vitro level that the evaluation present invention screens.

1. case enters a group screening

The case being included in the present embodiment is the non-small cell lung cancer case of aspiration biopsy positive tumor cell.

2.PBMCs sorts (in step 1 in embodiment 2 1) -4)).

3. oncopeptide the library external stimulus expands

The tumor-antigen peptide library that every peptide final concentration 5ug/mL is added in cell suspension is stimulated, after culture The recombination leukocyte mesonium-2 (rIL-2) for final concentration of 20U/mL being added in three days continues to cultivate, third day and in incubation It is measured according to culture medium state half within seven days and changes liquid, and supplement 20U/mL rIL-2, the tenth day harvest cell carries out coherent detection.

4.ELISPOT detects the T cell activation level of antibody (with step 3) in embodiment 2

5. interpretation of result

By counting 10⁵The specific spots number that is generated after stimulation in cell is simultaneously analyzed, and evaluation PD-1 is blocked Influence of the antibody to T cell activation.

In 15 non-small cell lung cancer cases, there are 4 process oncopeptide cultured and amplified in vitro to go out tumour-specific T thin Born of the same parents, by the response situation to this 4 tumor cases PBMCs to PD-1 antibody, evaluation tumor specific T cells are to PD-1 antibody Reaction effect.As a result it shows (Fig. 3), under no polypeptide incentive condition, the stimulation hole of Nivolumab positive control antibodies is added Stronger t cell immune response can be generated relative to negative control hole, while 6# antibody can generate comparable levels of T cell Immune response, and GP- α negative control antibodies are then compared with negative control hole without significant difference.By under oncopeptide incentive condition The comparison of T cell activation level after each antibody is added, finds the stimulation hole that Nivolumab positive control antibodies are added relative to the moon Property control wells can generate stronger t cell immune response, while can to generate comparable levels of T cell immune anti-for 6# antibody It answers, and GP- α negative control antibodies are then compared with negative control hole without significant difference.

Therefore, the T cell that 6# antibody can in vitro under condition of culture in effective activation tumor cases body, especially tumour The activity of specific T-cells promotes it to generate IFN-γ, to enhance its T cell immune function.

The humanization and in-vitro recombination expression and affinity preliminary identification of embodiment 5.PD-1 antibody

According to the sequence homology of 6# antibody, the present invention is on the CDR region basis for retaining two antibody, by replacing people Source antibody backbone obtains humanization 6# antibody (h-6#).

SEQ ID NO.:1：6# mouse source antibody H chain

SEQ ID NO.:2：6# mouse source antibody L chain

SEQ ID NO.:3：6#H chain CDR1

SEQ ID NO.:4：6#H chain CDR2

SEQ ID NO.:5：6#H chain CDR3

SEQ ID NO.:6：6#L chain CDR1

SEQ ID NO.:7：6#L chain CDR2

SEQ ID NO.:8：6#L chain CDR3

SEQ ID NO.:9：Humanization 6#H chain

SEQ ID NO.:10：Humanization 6#L chain

The present embodiment constructs pCAGGS carrier antibody expression clonings, by transiently transfecting 293T cell express humans source 6# Antibody carries out affinity chromatography by protein G gel columns to the antibody of expression.After Protein G pillar affinity chromatographys Antibody purity reaches 95% or more (such as Fig. 4).ELISA detections are carried out by the humanization 6# antibody to expression and purification, it is tied It closes the horizontal of PD-1 and carries out preliminary assessment, using 6# mouse source antibody as positive control, with Ebola virus specific antibody 13C6 (Mapp Biopharmaceutical) is used as negative control.The result shows that the 6# antibody and humanization 6# by gradient dilution are anti- The OD450 absorption values of body combination PD-1 albumen prompt the affinity of humanization 6# antibody and PD-1 close to 6# mouse in peer-level Source antibody (such as Fig. 5).

Pass through the detection of the 293T cell combination fluidic cell blocking experiments to PD-1-mFc albumen and overall length PD-L1 expression (such as Fig. 6) evaluates humanization 6# antibody.The present embodiment uses 6# mouse source antibody and nivolumab right as the positive According to, the results showed that, humanization 6# antibody can block the combination of PD-1 and PD-L1 completely.

The affinity of embodiment 6.6# antibody and humanization 6# antibody is verified

In the present embodiment, parent is carried out to 6# antibody and humanization 6# antibody by surface plasma resonance technology (SPR) It is identified with power.

PD-1 albumen, 6# antibody and humanization 6# antibody are changed in liquid to SPR buffer solutions (10mM HEPES-HCl, 150mM Na-Cl, 0.005%Tween-20, pH 7.4).PD-1 albumen is diluted to 20 μ g/ml to be fixed on CM5 chips, it The antibody of gradient dilution is respectively flowed through into each channel of CM5 chips afterwards, binding kinetics are analyzed using BIA evaluation softwares Parameter, and calculate affinity constant.

The present embodiment identifies the PD-1 albumen that 6# antibody is produced from different expression systems, to evaluate the combination of the two antibody The characteristic (Fig. 7) of PD-1 albumen.PD-1 albumen tool there are four N-link glycosylation site, respectively 49,58,74 and 116 Aspartic acid (Asn, N), its glycosylation modified difference of the albumen of different expression systems production, and the difference of level of glycosylation The different combination that may influence antibody and PD-1 albumen.What is more important, bodily fuctions' property albumen it is glycosylation modified not Therefore difference detects antibody to different tables under the states such as same cell type, different tissues, Different Organs and age, disease Up to system production PD-1 protein affinities for instruct PD-1 antibody medications have certain guidance meaning.

The result shows that the PD-1 albumen that 6# antibody can be obtained with renaturation after insect cell production and Bacillus coli expression It can combine, affinity is respectively 2.17 × 10^-10M and 2.7 × 10^-10M, the PD-1 affinity with the expression of eukaryon 293T cells It is 6.74 × 10^-10M, mutual no significant difference.The present embodiment the result shows that, 6# antibody is combined with PD-1 is not by expression The influence of system prompts it that may have more extensive crowd and morbid state to be applicable in spectrum (such as Fig. 5).

Pass through the detection to 6# antibody and PD-1 affinity after humanization, the results showed that, 6# antibody and PD-1's is affine Power is 6.74 × 10^-10M, commercialized PD-1 antibody nivolumab are 1.53 × 10^-9M, and humanization 6# antibody and PD-1 Affinity is 8.07 × 10^-10M.Therefore, it can be seen that from SPR results and 6# affinity of antibodies are suitable with nivolumab, and people Source 6# antibody still keeps 10^-10The affinity (such as Fig. 8) of M number grade.

The NCG Immune deficient mice HCC827 tumor suppressions of embodiment 7.6# antibody are tested

Since 6# antibody cannot combine mouse PD-1 molecules, it originally practices NCG immunodeficient mouses and is commented Valence.

The NCG mouse tumor Inhibition test steps of 6# antibody include：

1.NCG mouse people source immune system is rebuild

Human PBMC's s cells are inoculated with first into every NCG mouse, being established in NCG Mice Bodies has people source immune system Mouse：

I. human PBMC's s cell quantities are inoculated with：1×10⁷Cell/200 μ l/ are only；

Ii. inoculation position：Tail vein；

2.HCC-827 cell line tumor formations

It is inoculated with PBMCs cells and is inoculated with HCC-827 Lines after 3 days in every NCG mouse：

A) HCC-827 cell quantities are inoculated with：5×10⁷Cell/200 μ l/ are only；

B) inoculation position：Tail vein；

3. grouping and processing：

The mouse for selecting tumor formation more uniform after about 1 week after tumor cell injection is grouped, and carries out antibody abdominal cavity later Injection.The present embodiment is negative right with Ebola virus specific antibody 13C6 (MappBiopharmaceutical) injection group According to for nivolumab antibody as positive control, 6# antibody is that processing group carries out parallel laboratory test, every group of 5 mouse.

Antibody is injected：After mouse tumor formation is apparent (7 days), point 4 injection of antibodies, 200 μ g/, is spaced two later for the first time It, i.e., 200 μ g/ are injected only in third day second, later every three days or four days injection third times and (be 200 μ g/ the 4th time Only).

The tumor size of detection in every three to four days, last time continue observation one week after tumor formation after injecting.

4. therapeutic effect is observed：

1) tumor size detects：

A) diameter measurement, unit mm are carried out with slide calliper rule after antibody injection, calculation formula is：V=1/2 × a × b × b (a is major diameter, and b is minor axis)；

B) it tests and terminates after last time is observed, separation tumor tissues are directly taken pictures observation；

The result shows that the control group mice of injection 13C6 antibody equal fast-growth after the injection of 13C6 antibody.Nivolumab Tumour growth control is good after antibody injection, no bulky tumors growth, No. 5 antibody injection groups tumour growth after antibody injection Plateau is quickly entered, there is the tachyauxesis after antibody is injected 10 days and 14 days respectively of two mouse, but still significantly less than 13C6 Antibody control group.The present embodiment the result shows that, 6# antibody can effectively inhibit tumour growth, have potential oncotherapy value (such as Fig. 9).

8. humanization 6# antibody of embodiment is evaluated in NCG mouse difference tumor models inhibitions

For study humanization 6# antibody NCG mouse tumor Inhibition test steps include：

1.NCG mouse people source immune system is rebuild

It is rebuild with embodiment 7NCG mouse people source immune system.

2. different tumor cell line tumor formations

Inoculation PBMCs cells be inoculated with respectively in every NCG mouse after 3 days Lines H157, H1299 with And colorectal cancer cell system HCT116 and HT29：

Inoculating cell quantity：5×10⁷Cell/200 μ l/ are only；

Inoculation position：Tail vein；

3. grouping and processing：

The mouse for selecting tumor formation more uniform after about 1 week after tumor cell injection is grouped, and carries out antibody abdominal cavity later Injection.The present embodiment is using 13C6 antibody injection groups as negative control, and nivolumab antibody is as non-small cell lung cancer tumor model Positive control, humanization 6# antibody are that processing group carries out parallel laboratory test, every group of 3 mouse.

Mice group	Antibody is injected and dosage	Mouse quantity
			Negative control group	100μl	3
H-6# antibody groups	10mg/kg, 100 μ l	3
			Nivolumab	10mg/kg, 100 μ l	3

Antibody is injected：After mouse tumor formation is apparent (7 days), divide 3-4 injection of antibodies, 200 μ g/ only, are spaced later for the first time Two days, i.e. 200 μ g/ are injected only in third day second, later every three days or injection in four days is primary (be 200 μ g/ only).

The tumor size of detection in every three to four days, last time continue observation one week after tumor formation after injecting.

4. therapeutic effect is observed：

1) tumor size detects：

A) diameter measurement, unit mm are carried out with slide calliper rule after antibody injection, calculation formula is：V=1/2 × a × b × b (a is major diameter, and b is minor axis)；

The result shows that the control group mice of injection 13C6 antibody equal fast-growth after the injection of 13C6 antibody.Nivolumab Good in tumour growth control after antibody injection, no bulky tumors growth, humanization 6# antibody injection groups are after antibody injection Tumour growth quickly enters plateau, there is the tachyauxesis after antibody is injected 10 days and 14 days respectively of two mouse, but still significantly Less than 13C6 antibody control groups.The present embodiment the result shows that, humanization 6# antibody can effectively inhibit non-small cell lung cancer and knot Tumour growth in rectum tumor NCG mouse models, the oncotherapy effect (such as Figure 10) with wide spectrum.

Sequence table

<110>Institute of Microorganism, Academia Sinica, bio tech ltd of Aureal Dongyuan County

<120>A kind of anti-PD-1 antibody and its application

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 119

<212> PRT

<213>Artificial sequence

<220>

<223>The areas 6# heavy chain of antibody V

<400> 1

Val Lys Leu Gln Glu Ser Gly Ala Glu Leu Val Lys Pro Gly Ala Ser

1 5 10 15

Val Lys Leu Pro Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Tyr

20 25 30

Met Tyr Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly

35 40 45

Gly Ile Asn Pro Ser Asn Gly Gly Thr Asn Phe Asn Glu Lys Phe Lys

50 55 60

Asn Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn Thr Ala Tyr Met

65 70 75 80

Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr

85 90 95

Arg Arg Asp Tyr Arg Tyr Asp Gly Gly Phe Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser

115

<210> 2

<211> 111

<212> PRT

<213>Artificial sequence

<220>

<223>The areas 6# antibody light chain V

<400> 2

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Thr Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Ser Ile Ser Cys Arg Ala Ser Lys Ser Val Ser Thr Ser

20 25 30

Gly Phe Asn Tyr Met His Trp Tyr Gln Gln Lys Ser Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Phe Leu Ala Ser Asn Leu Ala Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His

65 70 75 80

Pro Val Glu Glu Gly Asp Ala Ala Thr Tyr Tyr Cys Gln His Ser Trp

85 90 95

Glu Leu Pro Leu Thr Phe Gly Gln Gly Thr Lys Leu Glu Leu Thr

100 105 110

<210> 3

<211> 8

<212> PRT

<213>Artificial sequence

<220>

<223>6# heavy chains CDR1

<400> 3

Gly Tyr Thr Phe Thr Ser Tyr Tyr

1 5

<210> 4

<211> 8

<212> PRT

<213>Artificial sequence

<220>

<223>6# heavy chains CDR2

<400> 4

Ile Asn Pro Ser Asn Gly Gly Thr

1 5

<210> 5

<211> 13

<212> PRT

<213>Artificial sequence

<220>

<223>6# heavy chains CDR3

<400> 5

Thr Arg Arg Asp Tyr Arg Tyr Asp Gly Gly Phe Asp Tyr

1 5 10

<210> 6

<211> 10

<212> PRT

<213>Artificial sequence

<220>

<223>6# light chains CDR1

<400> 6

Lys Ser Val Ser Thr Ser Gly Phe Asn Tyr

1 5 10

<210> 7

<211> 3

<212> PRT

<213>Artificial sequence

<220>

<223>6# light chains CDR2

<400> 7

Leu Ala Ser

1

<210> 8

<211> 9

<212> PRT

<213>Artificial sequence

<220>

<223>6# light chains CDR3

<400> 8

Gln His Ser Trp Glu Leu Pro Leu Thr

1 5

<210> 9

<211> 120

<212> PRT

<213>Artificial sequence

<220>

<223>Humanization 6# heavy chains

<400> 9

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Tyr Met Tyr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Gly Ile Asn Pro Ser Asn Gly Gly Thr Asn Phe Asn Glu Lys Phe

50 55 60

Lys Asn Lys Ala Thr Met Thr Val Asp Lys Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Arg Asp Tyr Arg Tyr Asp Gly Gly Phe Asp Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 10

<211> 110

<212> PRT

<213>Artificial sequence

<220>

<223>Humanization 6# light chains

<400> 10

Asp Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Lys Ser Val Ser Thr Ser

20 25 30

Gly Phe Asn Tyr Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro

35 40 45

Arg Leu Leu Ile Phe Leu Ala Ser Asn Leu Ala Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

65 70 75 80

Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Ser Trp

85 90 95

Glu Leu Pro Leu Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile

100 105 110

Claims (11)

1. a kind of anti-PD-1 antibody that can be combined with PD-1 molecular specifics, it includes such as SEQ ID NO.: 3、SEQ ID NO.:4 and SEQ ID NO.:Heavy chain CDRs shown in 5；And such as SEQ ID NO.:6、SEQ ID NO.:7 and SEQ ID NO.:Light chain CDRs shown in 8.

2. anti-PD-1 antibody as described in claim 1, it includes SEQ ID NO.:Heavy chain shown in 9 and SEQ ID NO.:10 Shown in light chain.

3. anti-PD-1 antibody as claimed in claim 1 or 2 is mouse source or the anti-PD-1 monoclonal antibodies of humanization.

4. encoding the polynucleotides of the separation of the anti-PD-1 antibody of any one of claim 1-2.

5. the expression vector of the polynucleotides comprising claim 4.

6. the host cell of the expression vector comprising claim 5.

7. the method for preparing the anti-PD-1 antibody of any one of claim 1-3, the method includes：

1) host cell as described in claim 6 is cultivated；

2) polypeptide is recycled from the host cell or culture medium.

8. a kind of composition contains anti-PD-1 antibody according to any one of claims 1 to 3.

9. the anti-PD-1 antibody of any one of claims 1 to 3 is preparing the medicine for improving T cell secretion of gamma-IFN level Purposes in object.

10. purposes of the anti-PD-1 antibody of any one of claims 1 to 3 in preparing treatment influenza or antitumor drug.

11. purposes as described in claim 10, wherein the tumour is non-small cell lung cancer or colorectal cancer.