CN107043409A - Verticillium dahliae production Microsclerotia related gene VdGAP functional analysis and its application - Google Patents
Verticillium dahliae production Microsclerotia related gene VdGAP functional analysis and its application Download PDFInfo
- Publication number
- CN107043409A CN107043409A CN201611174505.5A CN201611174505A CN107043409A CN 107043409 A CN107043409 A CN 107043409A CN 201611174505 A CN201611174505 A CN 201611174505A CN 107043409 A CN107043409 A CN 107043409A
- Authority
- CN
- China
- Prior art keywords
- vdgap
- microsclerotia
- verticillium dahliae
- gene
- production
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/743—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Agrobacterium; Rhizobium; Bradyrhizobium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to Plant Pathology field, the VdGAP played an important role in germ caryogenesis a gene has been cloned from verticillium dahliae V08DF1 bacterial strains, and there is provided the nucleotide sequence of the gene and its amino acid sequence of encoding proteins matter.Specifically, the invention discloses a kind of verticillium dahliae production Microsclerotia related gene VdGAP.The nucleotide sequence of the gene such as SEQ ID NO：1 or SEQ ID NO：Shown in 2, the protein sequence such as SEQ ID NO of the gene code：Shown in 3.The production Microsclerotia related gene VdGAP of the verticillium dahliae of the present invention can turn into the drug target for the generation for suppressing verticillium dahliae Microsclerotia.
Description
Technical field
The present invention relates to verticillium dahliae (Verticillium dahliae) production Microsclerotia related gene VdGAP function
Analysis and its research of potential application, belong to Plant Pathology research field.
Background technology
Verticillium dahliae (Verticillium dahliae Kleb.) is to cause the important soil-borne disease of plant verticillium wilt former
Fungi, host extensively, can endanger a variety of important industrial crops and garden crop.Traditional Prevention Technique, such as crop rotation, resistance product
Planting the preventing and treating to verticillium wilt such as seed selection, chemical agent has certain effect, but is due to that verticillium dahliae has abundant heredity
Diversity, pathogenicity is easily broken up, and is mainly survived with the germ nuclear structure of strong stress resistance in soil, thus in world's model
The harm for enclosing interior verticillium wilt is still serious.
Verticillium wilt is the monocyclic disease that systematicness infects, and Microsclerotia is main dormancy knot of the verticillium dahliae in soil
Structure, can in the soil long-term survival without host plant for 14 years, as the important primary infection inoculum of plant verticillium wilt,
Played an important role in Disease Cycle, the quantity and survival condition of its formation directly affect the Occurrence degree of verticillium wilt.
Therefore the mechanism of clear and definite Microsclerotia formation and development has weight for furtheing investigate the disease epidemic law and formulating prophylactico-therapeutic measures
Want meaning.Research for verticillium dahliae Microsclerotia often concentrates on the form, size, distribution of Microsclerotia, Microsclerotia in the past
The Soil Factors etc. for being separately cultured technology and influence Microsclerotia survival.The process developed for it is in morphology level
Also clearly, the initial period is expanded by single or several mycelia, and produces substantial amounts of barrier film.Then, the cell of its barrier film after
Continuous increase, as spherical and produce lateral bud.Finally, in cell membrane and iuntercellular depositing black crude granule, melanin is for shape
It is necessary into complete dormancy structure.And for its development molecule mechanism then study it is seldom.
The gene related to the development of verticillium dahliae Microsclerotia reported at present is few, and mostly to it is pathogenic related,
It is gene VDH1 wherein to study most deep.By building the EST libraries of verticillium dahliae Microsclerotia formation development, more than 1000
Find there are 29 to form relevant with verticillium dahliae Microsclerotia in individual EST libraries.Further research finds class therein
The mutant that II hydrophobin genes (VDH1) take part in after the formation of verticillium dahliae Microsclerotia, the gene knockout is formed
The ability of Microsclerotia is substantially reduced, but its is pathogenic almost unchanged.By with GFP amalgamation and expressions, find the assignment of genes gene mapping
There is the position merged in mycelia and conidium cell, that is, it is special in the stage that verticillium dahliae Microsclerotia is initially formed
Property expression, and the gene expression regulated and controled by nutriment carbon source.In addition, by using for reference in other disease funguses such as nuclear disk
The achievement in research of bacterium, the development of Rhizoctonia solani Kuhn sclerotium or pathogenic aspect, thus it is speculated that verticillium dahliae germ caryogenesis may be participated in
Candidate gene, verified by gene knockout, it was found that gene VMK1, VdPKAC1, VdSNF1 and VGB.Wherein VMK1 codings promote
Mutation after mitogen activated protein kinase (mitogen-activated protein kinase, MAPK), the gene knockout
The formation of body Microsclerotia is significantly reduced, and pathogenicity is also remarkably decreased.One of VdPKAC1 coding cAMP deopendent protein kinases A urges
Change the formation of the mutant Microsclerotia after subunit, the gene knockout to dramatically increase, and pathogenicity is then substantially reduced.VdSNF1 is encoded
Mutant code cell wall degrading enzyme after sucrose nonfermenting 1, the gene regulation catabolic repression, knockout
Gene expression decline, pathogenicity is remarkably decreased, and the ability of Microsclerotia formation is also remarkably decreased.With other plant disease fungus
Compare, the molecular mechanism research of verticillium dahliae germ caryogenesis relatively lags behind.These genes having now been found that only are taken off
The tip of the iceberg of verticillium dahliae Microsclerotia developmental mechanism is opened, external environment and internal factor trigger verticillium dahliae Microsclerotia
Approach, target site and the mode of action of development all also need to further announcement.
Other verticillium dahliae belongs to Fungi Imperfecti, and germ form and Variation of Virulence under different ecological condition is very big, and
And influenceed big by conditions such as temperature, nutrition, strain characteristics.On colonial morphology, formed according to when being grown in PDA culture medium
Many major general's verticillium dahliaes of Microsclerotia are divided into the sclerotium type of a large amount of black Microsclerotias that produces, produced in a small amount of black Microsclerotia
Between type and do not produce the mycelia type of Microsclerotia these three Cultural types.Made a variation from our long term monitoring Jiangsu Province verticillium dahliaes
As a result from the point of view of, during investigation in 2002, mycelia type bacterial strain is in field proportion highest, and when reinvestigating within 2008, Growth of Jiangsu Cotton
Verticillium wilt pathogen develops into based on the mycelia type based on sclerotium type.The Population variation that this verticillium dahliae Microsclerotia is produced
Rule also awaits disclosing.
Therefore, it is intended that more participation Microsclerotia hairs are directly excavated from verticillium dahliae by molecular biology method
The gene of correlation is educated, the signal network approach of its regulation and control is explored, verticillium dahliae germ caryogenesis machine is disclosed from molecular level
Reason, new thinking and target are provided for crop disease-resistant breeding, the research and development of new type bactericide.For a part of bacterium and fungi,
During carrier construction, the homologous sequence of target gene both sides certain length on its genome is cloned, and antibiotic is resisted
Property box gene is connected among both.Using such as protoplast transformation or Agrobacterium-medialed transformation method, by this with same
After the plasmid of source sequence is imported in the microbial cell, cell can start nucleic acid repair mechanism on certain proportion, and original target
The nucleotide sequence of gene will by carrier with resistant gene box sequence replace so that produce do not contain target gene knockout dash forward
Variant.And pass through the observation and detection to knocking out mutant and covering mutation type surface, it may be determined that the biology work(of the gene
Can and its in the application prospect of association area.
The content of the invention
VdGAP genes are cloned from verticillium dahliae V08DF1 bacterial strains, the full length gene is 833 bases, nucleotides
Sequence is SEQ ID NO：1, the CDS sequences of the gene have SEQ ID NO：Nucleotide sequence shown in 2.The present invention is carried simultaneously
The protein sequence of VdGAP gene codes is supplied, the protein sequence has SEQ ID NO：Amino acid sequence shown in 3.Root
According to the gene and its nucleotide sequence of flank, construct the knockout for the gene, cover carrier.Turned using agriculture bacillus mediated
Change method, obtains the knockout mutations body and covering mutant of the gene.By the Phenotypic Observation to these transgenic lines and
Analysis, it is found that the albumen influence verticillium dahliae of VdGAP gene expressions produces the ability of Microsclerotia.
Correlation technique route is as follows：
1. using Biological Information Resources shared on the net, designing nucleic acid primer, the knockout carrier of VdGAP genes is built, and
By in vector introduction Escherichia coli and agrobacterium strains.
2. using Biological Information Resources shared on the net, design nucleic acid primer, VdGAP covering carriers are built, and by carrier
Import in Escherichia coli and agrobacterium strains.
3. knockout carrier is imported into verticillium dahliae V08DF1 using the method for Agrobacterium-mediated Transformation, knockout mutations is obtained
Body；Covering carrier is imported into Δ VdGAP knockout mutations bodies using the method for Agrobacterium-mediated Transformation, covering mutant is obtained.
4. observation wild-type strain and knockout and covering mutant produce the difference of Microsclerotia in different culture media.
Brief description of the drawings
(V08DF1 is wild strain to Fig. 1 .VdGAP knockout mutations body fluorescent quantitations figure；1C2 is that T-DNA screens mutant；
Δ VdGAP knockout mutationss body 3, Δ VdGAP knockout mutationss body 4, Δ VdGAP knockout mutationss body 5, Δ VdGAP knockout mutationss body 6,
Δ VdGAP knockout mutationss body 7 is the mutants which had of 5 knockout VdGAP genes)
(V08DF1 is wild strain to Fig. 2 .VdGAP covering mutant fluorescent quantitations figure；1C2 is that T-DNA screens mutant；
VdGAP covering mutant 8, the mutants which had that VdGAP covering mutant 10-2 is 2 covering VdGAP genes)
Fig. 3 wild-type strains V08DF1 and mutant 1C2 produce the analysis knot of Microsclerotia capacity variance on different culture media
Really (V08DF1 is wild strain；1C2 is that T-DNA screens mutant)
Fig. 4 wild-type strains V08DF1 and knockout and covering mutant produce Microsclerotia ability on different culture media
(V08DF1 is wild strain to different analysis result；1C2 is that T-DNA screens mutant；Δ VdGAP knockout mutationss body 7 is knockout
The mutants which had of VdGAP genes；VdGAP covering mutant 8, VdGAP covering mutant 10-2 are 2 covering VdGAP genes
Mutants which had)
Embodiment
The knockout carrier of 1.VdGAP genes and the structure of covering carrier, and the carrier built is led with chemical transformation
Enter in Agrobacterium AGL-1 bacterial strains, the AGL-1 Agrobacteriums with VdGAP gene knockouts function and backfilling function are obtained respectively each
One, idiographic flow is described as follows：
A. using shared on the net Biological Information Resources (referring to：http：//www.broadinstitute.org/
Annotation/genome/verticillium_dahliae/MultiHome.html), two pairs of nucleic acid primers are separately designed,
That is 5 ' flank amplimer upstreams：GGGGACAGCTTTCTTGTACAAAGTGGAAGGTGCAGATACCACCATTC；5 ' flanks expand
Increase primer downstream：GGGGACTGCTTTTTTGTACAAACTTGTGTTCACAAGGCTGTCAAGAG；On 3 ' flank amplimers
Trip：GGGGACAACTTTGTATAGAAAAGTTGTTTCGTAAAGAGCGAGATAGAA；3 ' flank amplimer downstreams：
GGGGACAACTTTGTATAATAAAGTTGTGCACAGGAGTGGGTAAAA.Utilize their bases to verticillium dahliae V08DF1
Because group DNA carries out a PCR (PCR) amplification, each about 1kb in the both sides of VdGAP genes 5 ' and 3 ' sequence is obtained, then
Purpose band is purified.By each 20ng of purified nucleic acid fragment and each 60ng pA-Hyg-OSCAR and pOSCAR plasmids
(being purchased from Fungal Genetics Stock Center) mixes, and adds 1 μ l BPII enzyme mix (are purchased from
Invitrogen), after mixing, 25 DEG C are reacted 16 hours, are obtained and are knocked out plasmid VdGAP-Del.The plasmid is converted into Escherichia coli,
Through nucleic acid sequencing it is correct after, plasmid will be knocked out using heat shock method and imported in Agrobacterium AGL-1, thus obtain carrying VdGAP bases
Because knocking out the AGL-1 agrobacterium strains of function.
B. using shared on the net Biological Information Resources (referring to：http：//www.broadinstitute.org/
Annotation/genome/verticillium_dahliae/MultiHome.html), two nucleic acid primers are separately designed,
That is upstream：GACCTGCAGGCATGCAAGCTTTCATGTACATGTACAGGGACCGA；Downstream：
ACGACGGCCAGTGCCAAGCTTTCTTTATCTTGAATTTGATGACGAACT.Utilize primer pair verticillium dahliae V08DF1
Genomic DNA enters performing PCR amplification, and acquisition includes VdGAP gene promoters, the core of the about 2300bp including ORF and terminator
Acid fragment.The sequence is purified, ClonExpress is utilizedTMII recombining reactions system (being purchased from Vazyme biotech companies) will
The fragment is connected on the 1300-ble carriers (being transformed through this laboratory) linearized with HindIII, obtains VdGAP covering matter
Grain.After sequence verification is correct, the plasmid is imported in Agrobacterium AGL-1, the agrobacterium strains with backfilling function are obtained.
The acquisition of the knockout mutations body and covering mutant of 2.VdGAP genes
Utilize the AGL-1 Agrobacterium bacterium with VdGAP gene knockouts function and backfilling function obtained in previous step
Strain is converted to wild type V08DF1 bacterial strains and the Δ VdGAP knockout mutations bodies obtained respectively, and specific step of converting is as follows：
Verticillium dahliae is forwarded in liquid PDA, 28 DEG C, and 150rpm is cultivated 3 days；Agrobacterium AGL-1 containing T-DNA binary vectors chooses
Monoclonal is taken to be connected among liquid MM culture mediums (now with the current, dissolving in 1 liter of ultra-pure water：2.05g K2HPO4, 1.45g
KH2PO4, 0.15g NaCl, 0.5g MgSO4·7H2O, 0.1g CaCl2·6H2O, 0.0025g FeSO4·7H2O, 0.5g
(NH4)2SO4With 2.0g glucose), 28 DEG C, 150rpm is cultivated 2 days.Agrobacterium (is trained with IM culture mediums in 90ml MM afterwards
Support and 0.5ml glycerine and 0.7808g MES added in base, pH value is adjusted to 5.3-5.5, and is settled to 100ml with MM) it is diluted to OD600
=0.15, then preculture 6 hours is 1.0 × 10 with isometric, concentration5Spore/ml verticillium dahliae spore liquid is mixed
Close.By mixture take it is appropriate be coated on sterilizing, to be placed in CM solid mediums (similar to IM culture mediums, but concentration of glucose is
The half of IM culture mediums, comprises in addition 200 μM of acetosyringones) on nitrocellulose filter (0.45 μm of aperture) on, in 28
DEG C co-culture 48 hours.Afterwards, nitrocellulose filter is transferred on PDA solid mediums【200 μM of cefotaxime and 50 μ
G/ml hygromycin B (screening VdGAP knockout mutationss body) or 25 μ g/ml Bleomycin (screening VdGAP covering mutation
Body)】.After the same terms culture 5-7 days, it is seen that small conversion daughter colony, picking its spore is distinguished with transfer needle and is cultivated, passed through
Cross after single spore separation with the glycerine of final concentration 25%, -70 DEG C of preservations.
3. verticillium dahliae V08DF1 wild strains and VdGAP knockouts and covering mutant produce micro- in different culture media
The difference observation of sclerotium
Obtain after knockout mutations body and covering mutant, by above-mentioned each bacterial strain, picking mycelia is into 1ml sterilized waters, vibration
After uniform, 10 μ l of absorption are added dropwise to solid PDA, Cha Shi, the Cha Shi of broken of cotton of addition and (weigh the coring of 15g cotton seedlings, grind
After mill, 70ml DDW are dissolved in, 25 DEG C of vibration 1h, filter paper is filtered, solid residue packing 2ml Eppendorf pipes (opened by lid
Hole), autoclave sterilization, filter liquor is filtered into 10ml sterile tubes with 0.22 μm of filter, in use, adding per 100ml culture mediums
Enter 2 pipe residues and 1 pipe filter liquor) in three kinds of culture mediums, Microsclerotia production is observed in 25 DEG C of cultures.
Claims (4)
1. the production Microsclerotia GAP-associated protein GAP VdGAP of verticillium dahliae (Verticillium dahliae), it is characterised in that its ammonia
Base acid sequence such as SEQ ID NO：Shown in 3.
2. the production Microsclerotia related gene VdGAP of verticillium dahliae, it is characterised in that the big beautiful wheel described in coding claim 1
The production Microsclerotia GAP-associated protein GAP of branch bacterium.
3. the production Microsclerotia related gene VdGAP of verticillium dahliae according to claim 2, it is characterised in that its nucleosides
Acid sequence such as SEQ ID NO：1 or SEQ ID NO：Shown in 2.
4. the VdGAP covering plasmids that gene nucleotide series according to claim 2 are built.
1) performing PCR amplification is entered using primer pair verticillium dahliae V08DF1 genomic DNA, acquisition includes VdGAP gene promoters
The nucleic acid fragment of about 2300bp including son, extron, introne and terminator.By the fragment purification, and it is connected to linear
On the 1300-ble carriers of change, VdGAP covering plasmids are obtained.
2) through sequence verification it is correct after, the plasmid is imported in Agrobacterium AGL-1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611174505.5A CN107043409A (en) | 2016-12-15 | 2016-12-15 | Verticillium dahliae production Microsclerotia related gene VdGAP functional analysis and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611174505.5A CN107043409A (en) | 2016-12-15 | 2016-12-15 | Verticillium dahliae production Microsclerotia related gene VdGAP functional analysis and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107043409A true CN107043409A (en) | 2017-08-15 |
Family
ID=59543231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611174505.5A Pending CN107043409A (en) | 2016-12-15 | 2016-12-15 | Verticillium dahliae production Microsclerotia related gene VdGAP functional analysis and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107043409A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108130331A (en) * | 2017-12-21 | 2018-06-08 | 江苏省农业科学院 | The structure of verticillium dahliae glycosyl-phosphatidyl inositol gene VdGAP subcellular localization carriers and application |
| CN108588095A (en) * | 2018-05-03 | 2018-09-28 | 江苏省农业科学院 | The structure of verticillium dahliae yeast two-hybrid VdGAP-BD bait carriers and application |
-
2016
- 2016-12-15 CN CN201611174505.5A patent/CN107043409A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108130331A (en) * | 2017-12-21 | 2018-06-08 | 江苏省农业科学院 | The structure of verticillium dahliae glycosyl-phosphatidyl inositol gene VdGAP subcellular localization carriers and application |
| CN108588095A (en) * | 2018-05-03 | 2018-09-28 | 江苏省农业科学院 | The structure of verticillium dahliae yeast two-hybrid VdGAP-BD bait carriers and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Maruthachalam et al. | Identification of pathogenicity-related genes in the vascular wilt fungus Verticillium dahliae by Agrobacterium tumefaciens-mediated T-DNA insertional mutagenesis | |
| Wang et al. | Isolation of Gemmata-like and Isosphaera-like planctomycete bacteria from soil and freshwater | |
| Xu et al. | Isolation, identification, and complete genome assembly of an endophytic Bacillus velezensis YB-130, potential biocontrol agent against Fusarium graminearum | |
| Akamatsu et al. | Identification and function of a polyketide synthase gene responsible for 1, 8-dihydroxynaphthalene-melanin pigment biosynthesis in Ascochyta rabiei | |
| Arcate et al. | Diversity of peronosporomycete (oomycete) communities associated with the rhizosphere of different plant species | |
| Wang et al. | Diversity of microorganisms isolated from the soil sample surround Chroogomphus rutilus in the Beijing region | |
| US20220361506A1 (en) | Endophytic fungus pseudophialophora oryzae p-b313 and its application | |
| Nguyen et al. | Molecular and morphological confirmation of three undescribed species of Mortierella from Korea | |
| CN102304528A (en) | Magnaporthe oryzae avirulence gene AvrPik/kp/km/kh/7 and application thereof | |
| Enya et al. | Biological and phylogenetic characterization of Fusarium oxysporum complex, which causes yellows on Brassica spp., and proposal of F. oxysporum f. sp. rapae, a novel forma specialis pathogenic on B. rapa in Japan | |
| CN105039168B (en) | One plant of tangerine green trichoderma and application thereof | |
| CN105585619A (en) | Protein related to grain length and grain weight of paddy rice grains, encoding gene GL3-3 and application thereof | |
| Satianpakiranakorn et al. | Yeast communities of secondary peat swamp forests in Thailand and their antagonistic activities against fungal pathogens cause of plant and postharvest fruit diseases | |
| Kim et al. | Occurrence of dsRNA mycovirus (LeV-FMRI0339) in the edible mushroom Lentinula edodes and meiotic stability of LeV-FMRI0339 among monokaryotic progeny | |
| CN107043409A (en) | Verticillium dahliae production Microsclerotia related gene VdGAP functional analysis and its application | |
| Özer et al. | Characterization and sensitivity to fungicides of Rhizoctonia spp. recovered from potato plants in Bolu, Turkey | |
| KR20160058942A (en) | Isolated bacterium of the genus streptomyces | |
| Jia et al. | Evaluation of efficacy and mechanism of Bacillus velezensis CB13 for controlling peanut stem rot caused by Sclerotium rolfsii | |
| EP3998854A1 (en) | Novel xanthomonas strains and related methods | |
| Amnuaykanjanasin et al. | Insect-specific polyketide synthases (PKSs), potential PKS-nonribosomal peptide synthetase hybrids, and novel PKS clades in tropical fungi | |
| Zhang et al. | Identification and nitrogen fixation effects of symbiotic Frankia isolated from Casuarina spp. in Zhejiang, China | |
| Sukmawati et al. | Molds isolated from chicken feed as potential amylase resources | |
| WO2012060572A9 (en) | Cloning and base sequence determination of novel iturin biosynthesis gene from antagonistic microorganism bacillus subtilis and characteristics of the gene | |
| CN106497943B (en) | One kind ash arrhizus bacteria gene BcSEP5 relevant to pathogenicity and its application | |
| George et al. | Morphology, molecular identification and phylogenetic analysis based on internal transcribed spacer (ITS) of the ribosomal nuclear DNA (rDNA) sequence of a pathogenic fungal isolate Aspergillus niger LKO1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170815 |