CN107034231A - A kind of gene transformation method of Chinese Chestnut - Google Patents
A kind of gene transformation method of Chinese Chestnut Download PDFInfo
- Publication number
- CN107034231A CN107034231A CN201710440002.6A CN201710440002A CN107034231A CN 107034231 A CN107034231 A CN 107034231A CN 201710440002 A CN201710440002 A CN 201710440002A CN 107034231 A CN107034231 A CN 107034231A
- Authority
- CN
- China
- Prior art keywords
- chinese chestnut
- culture
- composition
- screening
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to genetic transformation field, specifically, it is related to a kind of gene transformation method of Chinese Chestnut, acceptor is used as using the somatic embryo of Chinese Chestnut, the transfection bacterium solution of the acceptor and the Agrobacterium tumefaciems AGL1 containing pBI121 plant expression vectors is co-cultured, the Chinese Chestnut tissue for obtaining converting containing target gene through screening and culturing；Wherein, the pBI121 plant expression vectors carry target gene.A kind of gene transformation method for Chinese Chestnut that the present invention is provided, for prior art in Chinese Chestnut, do not determine that a kind of reliable and repeatable method is used for efficient genetic conversion system also, the specific selection Agrobacterium tumefaciems AGL1 bacterial strains of the present invention carry target gene as transfection bacterium, and with pBI121 plant expression vectors, and somatic embryo is used as acceptor, both are co-cultured, screening obtains the Chinese Chestnut tissue of transgenosis, and transfection efficiency is high, and destination gene expression is stable.
Description
Technical field
The present invention relates to genetic transformation field, in particular to a kind of gene transformation method of Chinese Chestnut.
Background technology
Chinese Chestnut (Castanea mollissima) Fagaceae, Castanea is the important Ecological Nonwood Forestry tree of China
Kind, with well developed root system, the advantages of strong adaptability.Castanea distribution is wide, and existing Castanea has kind more than ten, wherein carrying out
The kind of Economical cultivation mainly has Chinese Chestnut Castanea mollissima, European chestnut Castanea sativa, Japanese chestnut
Castanea crenata, American chestnut Castanea dentate.Chinese cultivated Chinese Chestnut is with a long history, and germ plasm resource is rich
Richness, also it is that cross-pollination, the long-term plant Chinese Chestnut inter-species for carrying out Seedling propagation can hybridize mainly due to Chinese Chestnut,
The complicated conditions such as the regional Geographical of growth, form abundant germ plasm resource in long-term systematic growth and evolutionary process.
Chinese Chestnut diseases and insect pests resistance is strong, turns into world's Castanea resistance breeding valuable source at present.The U.S. and
Japan all once introduced a fine variety Chinese Chestnut from China and carries out the breeding researches such as disease and insect resistance.In recent years, the improved seeds of Chinese Chestnut are fast
Speed breeding, increases the active demand of its economic benefit so that the vegetative propagation of Chinese Chestnut obtains numerous studies, particularly plant
Tissue culture technique is continued to develop and perfect.But there is fruit maturation period concentration, conventional hybridization breeding cycle in Chinese Chestnut
Long the problems such as.Genetic transformation overcomes the weight for realizing that the targets such as directive breeding are Chinese Chestnut breed improvement and gene function checking
Want approach.In addition, genetic transformation is also the powerful measure for examining clone gene function, pass through overexpression or gene silencing strategies
To study gene function, the gene of clone can be analyzed and identified exactly in plant organ development, aging and physiological metabolism
Effect and regulatory mechanism, are that further Core Germplasms genetic improvement has established solid foundation from now on.
Somatic embryo (somatic embryo) is called embryoid, is without by fertilization process under isolated culture condition
Embryo's analog of formation, with bipolarity, genetic stability is high, reproduction speed is fast the features such as.Somatic embryo is in gene genetic
It is widely used in the research of transformation system.In the fruit trees such as peach, hickory nut, using somatic embryo occur carry out plant regeneration and
The research of genetic conversion system has been carried out reported success.In the gene genetic Study on Transformation of Castanea, Carraway etc.
The gene genetic conversion of American chestnut is attempted for the first time, and he is tested using the method for particle gun, however, not obtaining transgenosis
Plant, has simply obtained the callus of transgenosis.Then, the method that Seabra and Pais is infected using Agrobacterium is to European chestnut
Hypocotyledonery axis callus carry out the genetic transformation of gene, but also only very low transformation efficiency and the report of chimera formation
Road.The complete Castanea transgenosis of first case is that in European chestnut, the method infected by Agrobacterium carries out conversion and obtained
Transgenic regenerated plant.Subsequent Andrade et al. is reported carries out agrobacterium mediation converted using suspension cultural method, sets up
American chestnut transgenic regenerants system.In Chinese Chestnut, do not determine that a kind of reliable and repeatable method can be used for height also
The genetic conversion system of effect.
In view of this, it is special to propose the present invention.
The content of the invention
It is an object of the invention to provide a kind of gene transformation method of Chinese Chestnut, specific selection Agrobacterium tumefaciems AGL1
Bacterial strain carries target gene as transfection bacterium, and with pBI121 plant expression vectors, and somatic embryo is as acceptor, in specified conditions
Lower to co-culture both, screening obtains the Chinese Chestnut tissue of transgenosis, and transgene efficiency is high.
In order to realize the above-mentioned purpose of the present invention, spy uses following technical scheme：
A kind of gene transformation method of Chinese Chestnut, the somatic embryo using Chinese Chestnut is as acceptor, and the acceptor is with containing
The transfection bacterium solution for having the Agrobacterium tumefaciems AGL1 of pBI121 plant expression vectors is co-cultured, and obtains containing purposeful base through screening and culturing
Because of the Chinese Chestnut tissue of conversion；
Wherein, the pBI121 plant expression vectors carry target gene.
A kind of gene transformation method for Chinese Chestnut that the present invention is provided, for prior art in Chinese Chestnut, does not have also
The method for having determination a kind of reliable and repeatable is used for efficient genetic conversion system, and the present inventor is final to obtain through many experiments
To from Agrobacterium tumefaciems AGL1 bacterial strains target gene, body cell are carried as transfection bacterium, and with pBI121 plant expression vectors
Embryo co-cultures both as acceptor, and screening obtains the Chinese Chestnut tissue of transgenosis, and transfection efficiency is high, and target gene
Expression is stable.
From Chinese Chestnut ovule and the sharp somatic embryos of rataria embryo, it is found that rataria embryo point somatic embryos effect
More preferably.Preferably, the somatic embryo of the Chinese Chestnut uses the rataria embryo point induction of 45~55d after full-bloom stage to form.
Further, the somatic embryo is prepared using following methods：
The rataria embryo point of Chinese Chestnut is taken, after sterilization, induction culture medium is inoculated in, in 23-25 DEG C of light culture, often
Replacing in 18-25 days once induces culture medium, is formed to somatic embryo, continues to cultivate 1~2 week on culture medium is induced, is made
For the somatic embryo of acceptor；
The concentration of each composition for inducing culture medium and each composition is as follows：WPM 2.3 ± 0.1g/L, Vitamin
100±2mg·L-1, 1.0 ± 0.1gL of caseinhydrolysate-1, 2,4-D 0.2mg/L, 6-BA0.2mg/L, sucrose 3wt% ±
0.1wt%, agar 0.7wt% ± 0.1wt%.
Further, during co-cultivation, the Agrobacterium tumefaciems AGL1 in the transfection bacterium solution is in exponential phase.Transfect bacterium
In exponential phase, grow vigorous, it is easy to transfect, improve transfection efficiency.
Further, the transfection bacterium solution is prepared by the following method：
(a) it is 0.6~1.0 that, the Agrobacterium tumefaciems AGL1, which is cultivated to bacterium solution OD values, and centrifugation obtains thalline；
(b) inducing culture, is added in the thalline makes thalline suspend, and the volume of the inducing culture is step (a)
0.2-0.5 times of middle bacterium solution, preferably 0.3-0.4 times；
(c), using rotating speed as 70-80r/min, temperature is 21~23 DEG C, cultivates 2~4 hours, obtains the transfection bacterium solution；
Each composition of the inducing culture and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, MES buffer
9.75 ± 0.1g/L, sucrose 10 ± 0.1g/L, pH 5.5 ± 0.05,80 ± 1mM of acetosyringone.
First by thalline culture to exponential phase, thalline is then collected, is added in the inducing culture of proper volume, bacterium solution
Cell concentration it is suitable, culture a period of time so that thalline adapts to the change of external nourishment composition, provides good for the progress of transfection
Good basis.
Preferably, the rotating speed of the centrifugation in step (a) is 3000-5000r/min, and the time of centrifugation is 5-15min.Pass through
Centrifugation causes thalline enrichment, and the rotating speed damages small to thalline.
Further, Agrobacterium tumefaciems AGL1 culture is carried out using the LB culture mediums containing kanamycins in step (a).
Comprise the following steps that：The Agrobacterium tumefaciems AGL1 single bacterium colonies that picking carries target gene are inoculated in containing kanamycins
In LB fluid nutrient mediums, 28 ± 2 DEG C, 200-250r/min shaken cultivations 2~3 days obtain bacterium solution；100-200 μ L bacterium solutions are taken to connect
Plant into LB liquid mediums of the 50mL containing kanamycins, it is 0.6~1.0 that OD values are arrived in culture under the same terms.
Further, described co-culture is：The transfection bacterium solution soaks the somatic embryo, and temperature is 23~25 DEG C, leaching
The bubble time is 40-80min, preferably 50-60min.As immersion time can for 40min, 45min, 50min, 55min,
60min, 70min, 80min etc..
Pass through the immersion of appropriate time so that the time that thalline has abundance is transferred in somatic embryo, also, prevents miscellaneous bacteria
Pollution.
Preferably, described be immersed on 360 ° of circulators is carried out, and while immersion, circulator is using rotating speed as 35~40r/
Min rotates.
By being rotated during immersion with certain speed, effect is infected in increase.
Further, the screening and culturing is：To co-culture obtained somatic embryo be positioned over added with 500~600 μ l without
On the filter paper of bacterium water, light culture 40-50h；
Tile culture, light culture 6-8d are then transferred on suppression Agrobacterium culture medium；
Add liquid screening medium to cultivate in bioreactor, braked 2 minutes per 3-4 hours, light culture, 10-15d
A subculture is changed, after 6~8 weeks, the callus filtered out is transferred in solid screening and culturing medium；
After 25-30d, it is transferred in the induction culture medium containing resistance screening, light culture, the callus screened；
Wherein, the temperature during screening and culturing is 23~25 DEG C；
The composition of induction culture medium and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, Vitamin100 ±
2mg·L-1, 1.0 ± 0.1gL of caseinhydrolysate-1, 2,4-D 0.2mg/L, 6-BA 0.2mg/L, sucrose 3wt% ±
0.1wt%, agar 0.7wt% ± 0.1wt%；
The composition of suppression Agrobacterium culture medium and the concentration of each composition are as follows：Induce culture medium contain CTX 80 ±
600 ± 5 μM of 1 μ g/ml and Ticarcillin/Clavulanate Acid；
The concentration of the composition of liquid screening medium and each composition is as follows：Induce culture medium and remove agar, contain cephalo
The μ g/ml of thiophene oxime 80 ± 1,300 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml；
The concentration of the composition of solid screening and culturing medium and each composition is as follows：Induce culture medium and contain the μ of CTX 80 ± 1
G/ml, 600 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml.
Culture medium is induced in the present invention, after each composition is configured, in 121 DEG C of autoclave sterilizations 15-30 minutes；Suppress agriculture
Baccilus medium, liquid screening medium, solid screening and culturing medium will be induced after medium sterilization cooling, then add remaining
Composition.In addition, the composition that each culture medium is related in the present invention is commercially available by commercially available, wherein, Vitamin is
Nitsch&Nitsch Vitamin Powder。
Compared with prior art, beneficial effects of the present invention are：
(1) specific selection Agrobacterium tumefaciems AGL1 bacterial strains of the invention are as transfection bacterium, and with pBI121 plant expression vectors
Target gene is carried, somatic embryo co-cultures both as acceptor, screening obtains the Chinese Chestnut tissue of transgenosis, transfection
Efficiency high, and destination gene expression is stable.
(2) present invention also defines the design parameter of each step, transfection is stable.
(3) present invention also defines each step of screening and culturing, obtained seedling can stablize expression target gene.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
There is the accompanying drawing used required in technology description to be briefly described.
Fig. 1 is the electron microscope that the embodiment of the present invention 1 induces obtained somatic embryo；
The pBI121 plant expression vector schematic diagrames that Fig. 2 is carrying target gene MYB1 in the embodiment of the present invention 1；
Fig. 3 is callus PCR detection electrophoretograms in the embodiment of the present invention 1；
Fig. 4 is callus fluorogenic quantitative detection column diagram in the embodiment of the present invention 1.
Embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the present invention.It is unreceipted specific in embodiment
Condition person, the condition advised according to normal condition or manufacturer is carried out.Agents useful for same or the unreceipted production firm person of instrument, be
The conventional products that can be obtained by commercially available purchase.
Embodiment 1
(1) vegetable material
Testing material therefor, ' Yanshan Mountain Hong Li ' (Castanea mollissima cv.Yanshanhongli), picks up from Beijing
City Huairou District Chinese chestnut experiment station, gathers the Chinese Chestnut fruit of different development stage (since after full-bloom stage every three one and a half months
It is adopted once, totally nine times), it is ovule, as time went on, ovule may have grown into rataria when spending latter month.Band is preserved with ice chest
Laboratory is gone back to, 4 DEG C save backup.
Rataria embryo point after sterilization is inoculated in induction culture medium and carries out Fiber differentiation, 23-25 DEG C of light culture.Every 3
Fresh culture of Zhou Genghuan, culture to somatic embryo is formed.
It was found that, it is 45~55 days higher to developing into somatic embryo probability after full-bloom stage.The Chinese Chestnut fruit of period harvesting
In fact through above-mentioned culture, after about three months, there is somatic embryo to be formed.Continue the body after being cultivated 1~2 week on culture medium is induced thin
Blastula (such as Fig. 1), which is used as, infects material.
(2) bacterium solution is transfected
2.1 prepare carrier
Target gene fragment MYB10 can be inserted into by pBI121 plant expression vectors by commercially available purchase, conventional method
On pBI121 plant expression vectors, obtained carrier is as shown in Figure 2.
2.2 prepare thalline
Obtained carrier is transferred in Agrobacterium tumefaciems AGL1 bacterial strains, obtains carrying the Agrobacterium tumefaciems of target gene
AGL1。
2.3 prepare transfection bacterium solution
The Agrobacterium tumefaciems AGL1 single bacterium colonies that picking carries target gene are inoculated in the LB fluid nutrient mediums containing kanamycins
In, 28 ± 2 DEG C, 220r/min shaken cultivations 2~3 days obtain bacterium solution；200 μ L bacterium solutions are taken to be inoculated into 50mL containing kanamycins
It is 0.6~1.0 that OD values are arrived in culture in LB liquid medium, under the same terms.
The bacterium solution of culture is poured into centrifuge tube, 3500r/min centrifugation 15min, is poured out supernatant, is obtained thalline；
20mL inducing cultures are added in thalline makes thalline suspend, and shaken cultivation case is then placed in, using rotating speed as 75r/
Min, temperature is 21~23 DEG C, is cultivated 2~4 hours, obtains transfecting bacterium solution.
(3) infect
With 15ml centrifuge tube, add to induce and obtained somatic embryo (3~4g) is cultivated on culture medium, add appropriate transfection
Bacterium solution (is no more than 4mL), floods somatic embryo.
Lid is tightened, is put on 360 ° of circulators with 40r/min rotating speed, rotates 1 hour.
(4) screening and culturing
Somatic embryo on circulator is transferred in the ware containing aseptic filter paper, pile pea grain size, plus 500 μ L without
Bacterium water, 23~25 DEG C, light culture 2d；
Afterwards callus is transferred to tile on suppression Agrobacterium culture medium and cultivated, 23~25 DEG C, light culture 1 week；
Add 150ml liquid screening mediums in bioreactor (Batch (-type) submerges bioreactor) in,
Above-mentioned callus is put into bioreactor and cultivated, every 4 hours brake 2 minutes, and light culture changes a subculture, 7 weeks for 2 weeks
Afterwards, the callus filtered out is transferred in solid screening and culturing medium；
After 4 weeks, it is transferred in the induction culture medium containing resistance screening, 23~25 DEG C of light cultures.Treat that callus group is sufficiently large
It is small, take 0.5g callus group to extract DNA and do PCR checkings；
Continue to cultivate, until plant seedling occurs, take regrowth tender leaf 0.5g to extract DNA and do PCR checkings.
In the present embodiment, the composition of each culture medium is as follows：
The composition of induction culture medium and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, Nitsch＆Nitsch
Vitamin Powder 100±2mg·L-1, 1.0 ± 0.1gL of caseinhydrolysate-1, 2,4-D 0.2mg/L, 6-BA
0.2mg/L, sucrose 3wt% ± 0.1wt%, agar 0.7wt% ± 0.1wt%；
Each composition of inducing culture and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, MES buffer
9.75 ± 0.1g/L, sucrose 10 ± 0.1g/L, pH 5.5 ± 0.05,80 ± 1mM of acetosyringone；
The composition of suppression Agrobacterium culture medium and the concentration of each composition are as follows：Induce culture medium contain CTX 80 ±
600 ± 5 μM of 1 μ g/ml and Ticarcillin/Clavulanate Acid；
The concentration of the composition of liquid screening medium and each composition is as follows：Induce culture medium and remove agar, contain cephalo
The μ g/ml of thiophene oxime 80 ± 1,300 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml；
The concentration of the composition of solid screening and culturing medium and each composition is as follows：Induce culture medium and contain the μ of CTX 80 ± 1
G/ml, 600 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml.
After each composition of induction culture medium and inducing culture is configured in the present invention, in 121 DEG C of autoclave sterilizations 20
Minute；It is that will induce medium sterilization cooling to suppress Agrobacterium culture medium, liquid screening medium, solid screening and culturing medium
Afterwards, then remaining composition is added.In addition, the composition that each culture medium is related in the present invention is commercially available by commercially available.
(5) detecting step and result
The detection of 5.1 callus group and result
It is 86 to screen obtained callus group, therefrom randomly selects 16 and extracts genomic DNA using kit；
According to the target gene MYB10 sequences on carrier, the primer and synthetic primer across carrier are designed, primer is：F:
CTGTCGCTACTGATTACGGTGC；
R:CACCTTCTAACAAGGTCTCCCA；
Using genomic DNA as template, enter performing PCR detection：
PCR reaction systems are 20 μ L, and response procedures are:95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 35s, 60 DEG C of annealing 35s,
72 DEG C of extension 1min, 36 circulations；72 DEG C of extensions 10min, 4 DEG C of 30s.Agarose gel electrophoresis analyzes PCR primer.
Testing result is as shown in figure 3, in Fig. 3,1 is D2000marker；2 and 3 be respectively water and no template control；4 be matter
Grain positive control；5~20 transgenosis callus groups to be detected, target fragment size 1900bp.Amplification shows 5,6,7,10,
11st, 15,17,18 have 8 swimming lanes successfully to obtain and positive control identical purpose band (1900bp), and negative control (nothing
Template Controls and water) without purpose band, so Preliminary Identification this 8 is positive cell group.
4 are chosen from this 8 positive cell groups, fluorescent quantitation is done, fluorescent quantitation result is as shown in Figure 4.In Fig. 4,
MYB10-1-1, MYB10-1-3, MYB10-1-13, MYB10-1-14 are corresponding in turn in Fig. 3 marked as 5,7,17,18.Can in Fig. 4
To find out, with compareing (non-transgenic callus) contrast, transgenic sample all has stronger expression quantity, shows foreign gene MYB10
Rotate into plant callus.
5.2 regrowth tender leafs are detected and result
The regrowth tender leaf for the positive that the callus of identification is rolled into a ball correspondingly enters performing PCR detection, and PCR testing results are with more
Wound group is consistent.
Further, the callus of fluorescent quantitation is rolled into a ball into corresponding regrowth tender leaf and carries out fluorogenic quantitative detection, testing result
With callus, group is consistent.
Repeat the experiment, the positive rate of transfection is more than 50%, also, the stable expression purpose base of regrowth tender leaf
Cause.
It can be seen that, the gene transformation method for the Chinese Chestnut that the present invention is provided, transformation efficiency is high, and the expression that can stablize,
Good basis is provided for the research of Chinese Chestnut character.
Embodiment 2
(1) vegetable material
Testing material therefor, ' Yanshan Mountain Hong Li ' (Castanea mollissima cv.Yanshanhongli), picks up from Beijing
45d rataria embryo point, is preserved with ice chest and takes back laboratory, 4 DEG C of preservations are standby after city Huairou District Chinese chestnut experiment station, collection full-bloom stage
With.
Rataria embryo point after sterilization is inoculated in induction culture medium and carries out Fiber differentiation, 23-25 DEG C of light culture.Often
18d changes a fresh culture, after about three months, has somatic embryo to be formed.Continue after cultivating 1 week on culture medium is induced
Somatic embryo as infecting material.
(2) bacterium solution is transfected
2.1 prepare carrier
Target gene fragment MYB10 can be inserted into by pBI121 plant expression vectors by commercially available purchase, conventional method
On pBI121 plant expression vectors.
2.2 prepare thalline
Obtained carrier is transferred in Agrobacterium tumefaciems AGL1 bacterial strains, obtains carrying the Agrobacterium tumefaciems of target gene
AGL1。
2.3 prepare transfection bacterium solution
The Agrobacterium tumefaciems AGL1 single bacterium colonies that picking carries target gene are inoculated in the LB fluid nutrient mediums containing kanamycins
In, 28 ± 2 DEG C, 200r/min shaken cultivations 3 days obtain bacterium solution；100 μ L bacterium solutions are taken to be inoculated into liquid of the 50mL containing kanamycins
It is 0.8 that OD values are arrived in culture in LB culture mediums, under the same terms.
The bacterium solution of culture is poured into centrifuge tube, 3000r/min centrifugation 10min, is poured out supernatant, is obtained thalline；
10mL inducing cultures are added in thalline makes thalline suspend, and shaken cultivation case is then placed in, using rotating speed as 70r/
Min, temperature is 21~23 DEG C, is cultivated 4 hours, obtains transfecting bacterium solution.
(3) infect
With 15ml centrifuge tube, add to induce and obtained somatic embryo (3~4g) is cultivated on culture medium, add 3.5mL and turn
Microbiological contamination liquid, floods somatic embryo.
Lid is tightened, is put on 360 ° of circulators with 35r/min rotating speed, rotates 40min.
(4) screening and culturing
Somatic embryo on circulator is transferred in the ware containing aseptic filter paper, pile pea grain size, plus 600 μ L without
Bacterium water, 23~25 DEG C, light culture 40h；
Afterwards callus is transferred to tile on suppression Agrobacterium culture medium and cultivated, 23~25 DEG C, light culture 6d；
Add 150ml liquid screening mediums in bioreactor (Batch (-type) submerges bioreactor) in,
Above-mentioned callus is put into bioreactor and cultivated, every 3 hours brake 2 minutes, and light culture, 10d changes a subculture, 6 weeks
Afterwards, the callus filtered out is transferred in solid screening and culturing medium；
After 25d, it is transferred in the induction culture medium containing resistance screening, 23~25 DEG C of light cultures.Treat that callus group is sufficiently large
It is small, take 0.2g callus group to extract DNA and do PCR checkings.10 are randomly choosed altogether, and it is the positive there are 7, and positive rate is 70%；To sun
Property sample carry out fluorogenic quantitative detection, express higher, basic be the same as Example 1.
The callus group of the positive is continued to cultivate, until plant seedling occurs, takes regrowth tender leaf 0.2g extractions DNA to be PCR and tests
Card, is the positive, fluorogenic quantitative detection result is with callus unity fruit.
In the present embodiment, the composition of each culture medium is as follows：
The composition of induction culture medium and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, Nitsch＆Nitsch
Vitamin Powder 100±2mg·L-1, 1.0 ± 0.1gL of caseinhydrolysate-1, 2,4-D 0.2mg/L, 6-BA
0.2mg/L, sucrose 3wt% ± 0.1wt%, agar 0.7wt% ± 0.1wt%；
Each composition of inducing culture and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, MES buffer
9.75 ± 0.1g/L, sucrose 10 ± 0.1g/L, pH 5.5 ± 0.05,80 ± 1mM of acetosyringone；
The composition of suppression Agrobacterium culture medium and the concentration of each composition are as follows：Induce culture medium contain CTX 80 ±
600 ± 5 μM of 1 μ g/ml and Ticarcillin/Clavulanate Acid；
The concentration of the composition of liquid screening medium and each composition is as follows：Induce culture medium and remove agar, contain cephalo
The μ g/ml of thiophene oxime 80 ± 1,300 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml；
The concentration of the composition of solid screening and culturing medium and each composition is as follows：Induce culture medium and contain the μ of CTX 80 ± 1
G/ml, 600 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml.
Culture medium and inducing culture are induced in the present invention, after each composition is configured, in 121 DEG C of 30 points of autoclave sterilizations
Clock；Suppressing Agrobacterium culture medium, liquid screening medium, solid screening and culturing medium will be induced after medium sterilization cooling,
Remaining composition is added again.In addition, the composition that each culture medium is related in the present invention is commercially available by commercially available.
Repeat the experiment, the positive rate of transfection is more than 50%, also, the stable expression purpose base of regrowth tender leaf
Cause.
Embodiment 3
(1) vegetable material
Testing material therefor, ' Yanshan Mountain Hong Li ' (Castanea mollissima cv.Yanshanhongli), picks up from Beijing
55d rataria embryo point, is preserved with ice chest and takes back laboratory after city Huairou District Chinese Chestnut experiment station, collection full-bloom stage, 4 DEG C of preservations
It is standby.
Rataria embryo point after sterilization is inoculated in induction culture medium and carries out Fiber differentiation, 23-25 DEG C of light culture.Often
25d changes a fresh culture, after about three months, has somatic embryo to be formed.
Continue the somatic embryo after being cultivated 2 weeks on culture medium is induced as infecting material.
(2) bacterium solution is transfected
2.1 prepare carrier
Target gene fragment MYB10 can be inserted into by pBI121 plant expression vectors by commercially available purchase, conventional method
On pBI121 plant expression vectors.
2.2 prepare thalline
Obtained carrier is transferred in Agrobacterium tumefaciems AGL1 bacterial strains, obtains carrying the Agrobacterium tumefaciems of target gene
AGL1。
2.3 prepare transfection bacterium solution
The Agrobacterium tumefaciems AGL1 single bacterium colonies that picking carries target gene are inoculated in the LB fluid nutrient mediums containing kanamycins
In, 28 ± 2 DEG C, 250r/min shaken cultivations 2 days obtain bacterium solution；200 μ L bacterium solutions are taken to be inoculated into liquid of the 50mL containing kanamycins
It is 1.2 that OD values are arrived in culture in LB culture mediums, under the same terms.
The bacterium solution of culture is poured into centrifuge tube, 5000r/min centrifugation 5min, is poured out supernatant, is obtained thalline；
25mL inducing cultures are added in thalline makes thalline suspend, and shaken cultivation case is then placed in, using rotating speed as 80r/
Min, temperature is 21~23 DEG C, is cultivated 2 hours, obtains transfecting bacterium solution.
(3) infect
With 15ml centrifuge tube, add to induce and obtained somatic embryo (3~4g) is cultivated on culture medium, add 3.8mL and turn
Microbiological contamination liquid, floods somatic embryo.
Lid is tightened, is put on 360 ° of circulators with 40r/min rotating speed, rotates 80min.
(4) screening and culturing
Somatic embryo on circulator is transferred in the ware containing aseptic filter paper, pile pea grain size, plus 500 μ L without
Bacterium water, 23~25 DEG C, light culture 50h；
Afterwards callus is transferred to tile on suppression Agrobacterium culture medium and cultivated, 23~25 DEG C, light culture 8d；
Add 150ml liquid screening mediums in bioreactor (Batch (-type) submerges bioreactor) in,
Above-mentioned callus is put into bioreactor and cultivated, every 4 hours brake 2 minutes, and light culture, 15d changes a subculture, 8 weeks
Afterwards, the callus filtered out is transferred in solid screening and culturing medium；
After 30d, it is transferred in the induction culture medium containing resistance screening, 23~25 DEG C of light cultures.Treat that callus group is sufficiently large
It is small, take 1.0g callus group to extract DNA and do PCR checkings.10 are randomly choosed altogether, and it is the positive there are 6, and positive rate is 60%；To sun
Property sample carry out fluorogenic quantitative detection, express higher, basic be the same as Example 1.
The callus group of the positive is continued to cultivate, until plant seedling occurs, takes regrowth tender leaf 1.0g extractions DNA to be PCR and tests
Card, is the positive, fluorogenic quantitative detection result is with callus unity fruit.
In the present embodiment, the composition of each culture medium is as follows：
The composition of induction culture medium and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, Nitsch＆Nitsch
Vitamin Powder 100±2mg·L-1, 1.0 ± 0.1gL of caseinhydrolysate-1, 2,4-D 0.2mg/L, 6-BA
0.2mg/L, sucrose 3wt% ± 0.1wt%, agar 0.7wt% ± 0.1wt%；
Each composition of inducing culture and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, MES buffer
9.75 ± 0.1g/L, sucrose 10 ± 0.1g/L, pH 5.5 ± 0.05,80 ± 1mM of acetosyringone；
The composition of suppression Agrobacterium culture medium and the concentration of each composition are as follows：Induce culture medium contain CTX 80 ±
600 ± 5 μM of 1 μ g/ml and Ticarcillin/Clavulanate Acid；
The concentration of the composition of liquid screening medium and each composition is as follows：Induce culture medium and remove agar, contain cephalo
The μ g/ml of thiophene oxime 80 ± 1,300 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml；
The concentration of the composition of solid screening and culturing medium and each composition is as follows：Induce culture medium and contain the μ of CTX 80 ± 1
G/ml, 600 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml.
Culture medium and inducing culture are induced in the present invention, after each composition is configured, in 121 DEG C of 15 points of autoclave sterilizations
Clock；Suppressing Agrobacterium culture medium, liquid screening medium, solid screening and culturing medium will be induced after medium sterilization cooling,
Remaining composition is added again.In addition, the composition that each culture medium is related in the present invention is commercially available by commercially available.
Repeat the experiment, the positive rate of transfection is more than 50%, also, the stable expression purpose base of regrowth tender leaf
Cause.
The present inventor has also done many control groups, specific as follows：
Control group 1：PBI121 plant expression vectors in embodiment 1 are changed to pCAMBIA1300 plant expression vectors, root
Cancer Agrobacterium AGL1 is changed to Agrobacterium GV3101, other be the same as Examples 1.
Control group 2：PBI121 plant expression vectors in embodiment 1 are changed to pCAMBIA1304 plant expression vectors, root
Cancer Agrobacterium AGL1 is changed to Agrobacterium GV3101, other be the same as Examples 1.
Control group 3：PBI121 plant expression vectors in embodiment 1 are changed to pCAMBIA1300 plant expression vectors, root
Cancer Agrobacterium AGL1 is changed to Agrobacterium EHA105, other be the same as Examples 1.
Control group 4：PBI121 plant expression vectors in embodiment 1 are changed to pCAMBIA1304 plant expression vectors, root
Cancer Agrobacterium AGL1 is changed to Agrobacterium EHA105, other be the same as Examples 1.
Control group 5：Agrobacterium tumefaciems AGL1 in embodiment 1 is changed to Agrobacterium EHA105, other be the same as Examples 1.
Control group 6：Agrobacterium tumefaciems AGL1 in embodiment 1 is changed to Agrobacterium GV3101, other be the same as Examples 1.
Control group 7：PBI121 plant expression vectors in embodiment 1 are changed to pCAMBIA1300 plant expression vectors, its
His be the same as Example 1.
Control group 8：PBI121 plant expression vectors in embodiment 1 are changed to pCAMBIA1304 plant expression vectors, its
His be the same as Example 1.
The callus group random selection 10 that screening is obtained extracts DNA and does PCR checkings, if there is the positive in callus group, cultivates
To plant seedling, take tender leaf to extract DNA and do PCR checkings；Obtained result is as follows：
Control group 1：Callus group 1 is the positive, and destination gene expression is general, and the plant seedling that the culture of positive callus group is obtained is not
Detect destination gene expression.
Control group 2：Callus group 1 is the positive, and destination gene expression is general, and the plant seedling that the culture of positive callus group is obtained is not
Detect destination gene expression.
Control group 3：Callus group 1 is the positive, but destination gene expression is very weak in callus group, the culture of positive callus group
Obtained plant seedling is not detected by destination gene expression.
Control group 4：Callus group 2 is the positive, but destination gene expression is all very weak in callus group, the training of positive callus group
Support obtained plant seedling and be not detected by destination gene expression.
Control group 5：Callus group 3 is positive, has 2 callus group destination gene expressions substantially, and 1 is unobvious, the positive
It is obvious that the plant seedling that the culture of callus group is obtained detects 1 destination gene expression.
Control group 6：Callus group 3 is positive, has 2 callus group destination gene expressions substantially, and 1 is unobvious, the positive
It is obvious that the plant seedling that the culture of callus group is obtained detects 1 destination gene expression.
Control group 7：Callus group 3 is the positive, has expression obvious by 2 callus groups, and 1 is unobvious, positive callus group
Cultivate obtained plant seedling and be not detected by destination gene expression.
Control group 8：Callus group 4 is the positive, has expression obvious by 2 callus groups, and 1 is unobvious, positive callus group
Cultivate obtained plant seedling and be not detected by destination gene expression.
It can be seen that, the gene transformation method for the Chinese Chestnut that the present invention is provided, transformation efficiency is high, and the expression that can stablize,
Good basis is provided for the research of Chinese Chestnut character.
Although illustrate and describing the present invention with specific embodiment, but it will be appreciated that without departing substantially from the present invention's
Many other changes and modification can be made in the case of spirit and scope.It is, therefore, intended that in the following claims
Including belonging to all such changes and modifications in the scope of the invention.
Claims (10)
1. a kind of gene transformation method of Chinese Chestnut, it is characterised in that the somatic embryo using Chinese Chestnut is described as acceptor
The transfection bacterium solution of acceptor and the Agrobacterium tumefaciems AGL1 containing pBI121 plant expression vectors is co-cultured, and is contained through screening and culturing
The Chinese Chestnut tissue of purposeful genetic transformation；
Wherein, the pBI121 plant expression vectors carry target gene.
2. the gene transformation method of Chinese Chestnut according to claim 1, it is characterised in that the body of the Chinese Chestnut is thin
Blastula uses the rataria embryo point induction of 45~55d after full-bloom stage to form.
3. the gene transformation method of Chinese Chestnut according to claim 2, it is characterised in that the somatic embryo use with
It is prepared by lower section method：
Take after the rataria embryo point of Chinese Chestnut, sterilization, be inoculated in induction culture medium, in 23-25 DEG C of light culture, per 18-25
Its replacing once induces culture medium, is formed to somatic embryo, continues to cultivate 1~2 week on culture medium is induced, obtains as acceptor
Somatic embryo；
The concentration of each composition for inducing culture medium and each composition is as follows：WPM 2.3 ± 0.1g/L, Vitamin 100 ±
2mg·L-1, 1.0 ± 0.1gL of caseinhydrolysate-1, 2,4-D 0.2mg/L, 6-BA 0.2mg/L, sucrose 3wt% ±
0.1wt%, agar 0.7wt% ± 0.1wt%.
4. the gene transformation method of Chinese Chestnut according to claim 1, it is characterised in that during co-cultivation, the transfection
Agrobacterium tumefaciems AGL1 in bacterium solution is in exponential phase.
5. the gene transformation method of Chinese Chestnut according to claim 1, it is characterised in that the transfection bacterium solution by with
It is prepared by lower section method：
(a) it is 0.6~1.0 that, the Agrobacterium tumefaciems AGL1, which is cultivated to bacterium solution OD values, and centrifugation obtains thalline；
(b) inducing culture, is added in the thalline makes thalline suspend, and the volume of the inducing culture is bacterium in step (a)
0.2-0.5 times of liquid, preferably 0.3-0.4 times；
(c), using rotating speed as 70-80r/min, temperature is 21~23 DEG C, cultivates 2~4 hours, obtains the transfection bacterium solution；
Each composition of the inducing culture and the concentration of each composition are as follows：WPM 2.3 ± 0.1g/L, MES buffer
9.75 ± 0.1g/L, sucrose 10 ± 0.1g/L, pH 5.5 ± 0.05,80 ± 1mM of acetosyringone.
6. the gene transformation method of Chinese Chestnut according to claim 5, it is characterised in that centrifugation in step (a)
Rotating speed is 3000-5000r/min, and the time of centrifugation is 5-15min.
7. the gene transformation method of Chinese Chestnut according to claim 5, it is characterised in that crown gall agriculture bar in step (a)
Bacterium AGL1 culture is carried out using the LB culture mediums containing kanamycins.
8. the gene transformation method of Chinese Chestnut according to claim 1, it is characterised in that the co-cultivation is：It is described
Transfect bacterium solution and soak the somatic embryo, temperature is 23~25 DEG C, and soak time is 40-80min, preferably 50-60min.
9. the gene transformation method of Chinese Chestnut according to claim 8, it is characterised in that described to be immersed in 360 ° of rotations
Carried out on device, while immersion, circulator rotates by 35~40r/min of rotating speed.
10. the gene transformation method of the Chinese Chestnut according to claim any one of 1-9, it is characterised in that the screening
Cultivate and be：The somatic embryo that co-cultivation is obtained is positioned on the filter paper added with 500~600 μ l sterilized waters, light culture 40-50h；
Tile culture, light culture 6-8d are then transferred on suppression Agrobacterium culture medium；
Add liquid screening medium to cultivate in bioreactor, braked 2 minutes per 3-4 hours, light culture, 10-15d changes one
Subculture, after 6~8 weeks, the callus filtered out is transferred in solid screening and culturing medium；
After 25-30d, it is transferred in the induction culture medium containing resistance screening, light culture, the callus screened；
Wherein, the temperature during screening and culturing is 23~25 DEG C；
The composition of induction culture medium and the concentration of each composition are as follows：100 ± 2mgL of WPM 2.3 ± 0.1g/L, Vitamin-1, 1.0 ± 0.1gL of caseinhydrolysate-1, 2,4-D 0.2mg/L, 6-BA 0.2mg/L, sucrose 3wt% ± 0.1wt%, agar
0.7wt% ± 0.1wt%；
The composition of suppression Agrobacterium culture medium and the concentration of each composition are as follows：Induce culture medium and contain the μ g/ of CTX 80 ± 1
600 ± 5 μM of ml and Ticarcillin/Clavulanate Acid；
The concentration of the composition of liquid screening medium and each composition is as follows：Induce culture medium and remove agar, contain CTX
80 ± 1 μ g/ml, 300 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml；
The concentration of the composition of solid screening and culturing medium and each composition is as follows：Induce culture medium and contain the μ g/ of CTX 80 ± 1
Ml, 600 ± 2 μM of Ticarcillin/Clavulanate Acid and screening antibiotic 60 ± 1 μ g/ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710440002.6A CN107034231B (en) | 2017-06-12 | 2017-06-12 | Gene transformation method of Chinese chestnut |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710440002.6A CN107034231B (en) | 2017-06-12 | 2017-06-12 | Gene transformation method of Chinese chestnut |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107034231A true CN107034231A (en) | 2017-08-11 |
| CN107034231B CN107034231B (en) | 2021-01-19 |
Family
ID=59541260
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710440002.6A Active CN107034231B (en) | 2017-06-12 | 2017-06-12 | Gene transformation method of Chinese chestnut |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107034231B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115812603A (en) * | 2022-12-28 | 2023-03-21 | 北京农学院 | Method for establishing castanea mollissima somatic embryo regeneration system |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104593409A (en) * | 2015-01-05 | 2015-05-06 | 北京农学院 | Chinese chestnut transgenic method based on agrobacterium rhizogenes mediation |
-
2017
- 2017-06-12 CN CN201710440002.6A patent/CN107034231B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104593409A (en) * | 2015-01-05 | 2015-05-06 | 北京农学院 | Chinese chestnut transgenic method based on agrobacterium rhizogenes mediation |
Non-Patent Citations (3)
| Title |
|---|
| E. CORREDOIRA ET AL.: "Agrobacterium-mediated transformation of European chestnut somatic embryos with a Castanea sativa (Mill.) endochitinase gene", 《NEW FORESTS》 * |
| 方小平等: "花生小叶外植体植株再生及农杆菌介导的基因遗传转化", 《中国油料》 * |
| 李子东等: "农杆菌介导的DREB1A 基因转化多花黑麦草及其转化体系的优化", 《山东大学学报(理学版)》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115812603A (en) * | 2022-12-28 | 2023-03-21 | 北京农学院 | Method for establishing castanea mollissima somatic embryo regeneration system |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107034231B (en) | 2021-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109735562B (en) | Construction method of economic plant effective root system transgenic system | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN104561089B (en) | A kind of breeding method of Transgenic melon tissue-cultured seedling and application | |
| CN107557385A (en) | Acceptor class kinase gene AcSERK1 genetic transforming method and its application occurs for a kind of pineapple somatic embryo | |
| CN106119281A (en) | A kind of agriculture bacillus mediated Semen Tritici aestivi stem apex genetic transforming method rapidly and efficiently | |
| CN103444524B (en) | Method for quickly building genetic transformation regeneration system of grapes | |
| CN102229950B (en) | Rapid and high-efficiency transgenic method for indica rice | |
| CN113234751A (en) | Agrobacterium tumefaciens transformation vector based on rhizobium III type effector NopP and application thereof | |
| CN102492721A (en) | Sesame genetic transformation method mediated by agrobacterium | |
| CN104561090A (en) | Method for improving agrobacterium tumefacien-mediated genetic transformation efficiency of poplar | |
| CN104087605B (en) | Cultivate method and the relevant biological material thereof of the transgenic graminaceous plant that tiller number increases | |
| CN107034231A (en) | A kind of gene transformation method of Chinese Chestnut | |
| CN108588002B (en) | Method for obtaining embryogenic callus of millet for genetic transformation and genetic transformation | |
| CN105524933A (en) | OsJMJ714 functions of influence on rice grain size and tolerance to salt stress and application of OsJMJ714 | |
| CN105255938A (en) | Agrobacterium rhizogenes mediated genetically modified Erigeron breviscapus hairy root transformation method | |
| Martínez et al. | Rhizobium rhizogenes-mediated transformation of Rhodiola rosea leaf explants | |
| CN104726489A (en) | Method for obtaining transgenic cotton through agrobacterium-mediated living immature embryo transformation | |
| CN105039391A (en) | Method of establishing genetic transformation of mature embryos of agrobacterium tumefaciens mediated Dongnong winter wheat No.1 | |
| CN110106171A (en) | Long-chain non-coding RNA and its application in regulation plant frigostabile | |
| CN104542295A (en) | Transgenic breeding method of sweet wormwood | |
| CN103255141B (en) | Paddy rice nitrogen deficiency specific induced expression promoter Y5 and application thereof | |
| CN105886527A (en) | Agrobacterium tumefaciens mediated transformation system for efficiently obtaining transgenic plants of paspalum vaginatum and application thereof | |
| CN108753816A (en) | The transgenic arabidopsis strain and its construction method of SYTA gene overexpressions | |
| CN105132430B (en) | Corn nutritive organ-specific promoter and its application | |
| CN109371060A (en) | A kind of quick transgene method of spindle tree |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |