CN107012215A - The specific primer and multiple PCR detection kit of the corrupt pathogen of detection - Google Patents
The specific primer and multiple PCR detection kit of the corrupt pathogen of detection Download PDFInfo
- Publication number
- CN107012215A CN107012215A CN201710217225.6A CN201710217225A CN107012215A CN 107012215 A CN107012215 A CN 107012215A CN 201710217225 A CN201710217225 A CN 201710217225A CN 107012215 A CN107012215 A CN 107012215A
- Authority
- CN
- China
- Prior art keywords
- primer
- junket
- molten
- coccus
- staphylococcus saprophyticus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a kind of multiple PCR detection kit of main corrupt pathogen (staphylococcus saprophyticus and the big coccus of molten junket) in detection low-temperature meat product.The invention provides the primer sets of detection staphylococcus saprophyticus and the big coccus of molten junket, it is made up of primer pair 1 and primer pair 2.Specific fragment of the present invention for staphylococcus saprophyticus and the big coccus of molten junket, two pairs of primers designed for specific amplified, amplified fragments size is respectively staphylococcus saprophyticus 201bp and the big coccus 392bp of molten junket, and sample gene group passes through multiplex PCR, electrophoresis detection, you can make corresponding judgement.The present invention, using a step multiplex PCR, can identify the staphylococcus saprophyticus and the big coccus of molten junket in low-temperature meat product by providing two pairs of specific primers, the characteristics of being easy to judge with quick, inexpensive, simple to operate and result.
Description
Technical field
The invention belongs to field of biological detection, and in particular to the specific primer of the corrupt pathogen of a kind of detection and multiple
PCR detection kit.
Background technology
Low-temperature meat product refers to the class meat products by the processing shortening such as steaming, boiling, smoke, bake, under processing technology is normal pressure
Carry out, often temperature only has 72-85 DEG C less than 100 DEG C, meat products central temperature, therefore low-temperature meat product is during processing
Protein denaturation appropriateness, close with Meat, elasticity is big, and chewiness is good, the features such as fresh and tender, succulence, while overcome again
Poor taste, weak flavor, a variety of shortcomings of nutrient component damages of high temperature meat product presence, maintain the original of meat products to greatest extent
Nutritious and local flavor, it is very popular with consumers, it is the direction of following meat products development.But, due to its special processing technology,
So as to cause meat products sterilizing not thorough, in subsequent storage and sales process, once condition is suitable or is contaminated, in product
The bacterium of residual will mushroom out breeding, cause corruption, deteriorate meat products nutrition, have a strong impact on Product Safety, threaten
Consumer health.Research shows that the dominant microflora in low-temperature meat product is often to cause the flora of food apoilage.It is rotten
Raw staphylococcus and the big coccus of molten junket are most common two kinds corrupt pathogens in low-temperature meat product, seriously threaten food security.
Staphylococcus saprophyticus belongs to staphylococcus, is gram-positive cocci, is conditioned pathogen, is to cause young woman's urinary tract sense
One of more typical pathogen of dye.The molten big coccus of junket is gram-positive cocci, is generally separated from animal skin and animal production
Product, its diameter is staphylococcic 2-4 times.The evolution of the molten big coccus of junket and human pathogen bacterium staphylococcus aureus and anthrax bud
Born of the same parents bacillus is closely related, under appropriate conditions, can also cause organism disease.
Staphylococcus saprophyticus is the dominant bacteria in Greece's sausage, is also common strain in Chinese the Dong nationality's Variety of Traditional Fermented Meat.
Meanwhile, staphylococcus saprophyticus and the big coccus of molten junket are the predominant bacterias in boiled salted duck, and quality is sent out in storage with boiled salted duck
Raw deterioration, shelf life are short closely related, largely have impact on sale, the circulation of product, huge economy is caused to enterprise
Loss.Therefore, this kind of spoilage organisms in product is monitored and controlled extremely crucial to enterprise development.
At present, for the detection and identification of spoilage organisms in meat products, the main or traditional bacteria distribution culture of application with
The method that Bacterial Physiological biochemical reaction is combined.In traditional isolation and identification method, flat board culture, picking are carried out to sample first
Different bacterium colony purifying, colonial morphology is carried out to each single bacterium colony and thalli morphology is observed, and carries out the identification bacterium such as biochemical reactions
Strain.In practical operation, it has been found that conventional method has many problems such as waste time and energy.Therefore, it is simpler, accurate, fast
The authentication method of speed is significant in practice.Staphylococcus saprophyticus and the big coccus of molten junket are as common in low-temperature meat product
Corrupt pathogen, set up and the method for Rapid identification carried out to it for ensuring food safety and human health is most important.
PCR method is easy, quick, specificity and sensitiveness are good, and extensive popularization and application are obtained in practice.Multiplex PCR
Technology is improved on the basis of Standard PCR, i.e., in a PCR reaction system, by adding multipair primer, to multiple
Target sequence expanded, detected, its reaction principle, reagent composition and operating process are consistent with Standard PCR, with more increasing
Effect, it is economical the characteristics of.
The content of the invention
In view of the shortcomings of the prior art, staphylococcus saprophyticus is detected from low-temperature meat product and molten the invention provides two pairs
The specific primer and corresponding PCR detection kit of the big coccus of junket.The kit of the present invention being capable of the clinical sample of mass detection
This, and it is time-consuming short, and cost is low, simple to operate.
The present invention provides two pairs of specific primers that staphylococcus saprophyticus and the big coccus of molten junket are detected from low-temperature meat product,
The nucleotides sequence of the specific primer is classified as：
Primer pair 1：Staphylococcus saprophyticus
Sense primer Mid-F：5’-TTACGCTATATAAACAAATAAT-3’
Anti-sense primer Mid-R：5’-ATGACTAGTGTATGGATTGTT-3’.
Primer pair 2：The molten big coccus of junket
Sense primer Duf-F：5’-ACGAGTGCGAAATTTGCGAG-3’
Anti-sense primer Duf-R：5’-TCCACATCGACCTCACATCG-3’.
Wherein the sense primer Mid-F of primer pair 1 and anti-sense primer Mid-R are respectively positioned on staphylococcus saprophyticus Mid genes；Draw
Thing is respectively positioned on to 2 sense primer Duf-F and anti-sense primer Duf-R on the big coccus Duf genes of molten junket.
Second object of the present invention is to provide one kind and staphylococcus saprophyticus and the big ball of molten junket is detected from low-temperature meat product
The multiple PCR reagent kit of bacterium, the kit includes specific primer, and the nucleotides sequence of the specific primer is classified as：
Primer pair 1：Staphylococcus saprophyticus
Sense primer Mid-F：5’-TTACGCTATATAAACAAATAAT-3’
Anti-sense primer Mid-R：5’-ATGACTAGTGTATGGATTGTT-3’.
Primer pair 2：The molten big coccus of junket
Sense primer Duf-F：5’-ACGAGTGCGAAATTTGCGAG-3’
Anti-sense primer Duf-R：5’-TCCACATCGACCTCACATCG-3’.
Preferably, the kit also includes positive control and negative control.
Further, the positive control is the restructuring of the partial nucleotide sequence containing staphylococcus saprophyticus Mid genes
Plasmid, the length of the partial nucleotide sequence is 201bp, and particular sequence is referring to SEQ ID No.1 in sequence table；And the sun
Property control for the partial nucleotide sequence containing the big coccus Duf genes of molten junket recombinant plasmid, the length of the partial nucleotide sequence
Spend for 390bp, particular sequence is referring to SEQ ID No.2 in sequence table.
Third object of the present invention is to provide the application method of mentioned reagent box, is using DNA to be measured as template, using upper
State the specific primer described in kit and enter performing PCR amplification, by amplified production electrophoresis, if amplification is to about 201bp DNA fragmentation,
The staphylococcus saprophyticus positive is judged to, if DNA fragmentation of the amplification to about 390bp, the big coccus positive of molten junket is judged to, if amplification is arrived about
201bp and 390bp DNA fragmentation, is judged to staphylococcus saprophyticus and the big coccus of molten junket is positive；Conversely, being judged to feminine gender.
Preferably, the PCR reaction conditions are：95 DEG C of 5min, 35 circulations (95 DEG C of 30s, 53 DEG C of 30s, 72 DEG C
30s), last 72 DEG C of 10min.
Fourth object of the present invention is to provide the multiplex PCR detection side of a kind of staphylococcus saprophyticus and the big coccus of molten junket
Method, is, using DNA to be measured as template, performing PCR amplification to be entered using the specific primer described in mentioned reagent box, by amplified production electricity
Swimming, if amplification detects staphylococcus saprophyticus to about 201bp DNA fragmentation, if amplification is to about 390bp DNA fragmentation,
The big coccus of molten junket is detected, if amplification detects staphylococcus saprophyticus and molten junket to 201bp and 390bp DNA fragmentation simultaneously
Big coccus.
Preferably, the PCR reaction conditions are：95 DEG C of 5min, 35 circulations (95 DEG C of 30s, 53 DEG C of 30s, 72 DEG C
30s), last 72 DEG C of 10min.
The 5th purpose of the present invention be to provide in above-mentioned specific primer, kit, sequence table SEQ ID No.1 and
Nucleotides sequence described in SEQ ID No.2 is listed in the application in the reagent for preparing detection staphylococcus saprophyticus and the big coccus of molten junket.
The superiority of the kit of the present invention includes following aspect：
A. kit is simple to operate, is adapted in each basic unit's food inspection units concerned, low-temperature meat product manufacturer
And slaughterhouse is widely popularized and used, the present invention in kit detect sample when only need to pipettor, pipettor gun head,
This kit can be used to detect sample for PCR instrument and desk centrifuge, common lab.
B. result judgement is directly perceived, is observed after electrophoresis.
C. operating personnel need not receive professional training, can be detected only referring to specification.
D. with low cost, economical and practical, big multi-user is subjected to.
Brief description of the drawings
Fig. 1 is the specific detection experimental result of kit of the present invention；Wherein, swimming lane M is DL2000 molecular weight standards；Swimming
Road 1 is staphylococcus saprophyticus and the big coccus of molten junket；Swimming lane 2 is staphylococcus saprophyticus；Swimming lane 3 is the big coccus of molten junket；Swimming lane 4-5 is
Escherichia coli, swimming lane 6-7 are that salmonella, swimming lane 8-9 are that Pasteurella, swimming lane 10-11 are riemerella anatipestifer, swimming lane
12-13 is that Staphylococcus sciuri, swimming lane 14-15 are that staphylococcus aureus, swimming lane 16-17 are that enterococcus faecalis, swimming lane 18-19 are
VREF, swimming lane 20 are Negative control Sterile water.
Fig. 2 is the sensitivity Detection experimental result of kit of the present invention；Wherein, swimming lane M is DL2000 molecular weight standards；Swimming
Road 1-7 DNA profiling amount is respectively 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, is conventional method unless otherwise specified.Test material used, is normal unless otherwise specified in following embodiments
Advise biochemical reagents.
Embodiment 1
The multiple PCR detection kit bag of staphylococcus saprophyticus and the big coccus of molten junket in the detection low-temperature meat product of the present invention
Include：
1.2 × PCR TaqMix 5 (250 μ l/ branch)；
2. primer pair 1：Sense primer Mid-F 1 (50 μ l/ branch)；Anti-sense primer Mid-R 1 (50 μ l/ branch)
3. primer pair 2：Anti-sense primer Duf-F 1 (50 μ l/ branch)；Anti-sense primer Duf-R 1 (50 μ l/ branch)
4. positive control staphylococcus saprophyticus DNA 1 (250 μ l/ branch)；The big coccus DNA of the molten junket of positive control 1 (250
μ l/ branch)
5. negative control DNA 1 (250 μ l/ branch)；
6. sterile deionized water 1 (1000 μ l/ branch).
Mentioned reagent box can detect 50 parts of samples, and -20 DEG C freeze, and storage life is 1 year.
Wherein, 2 × PCR TaqMix are commercial reagents；
Primer pair 1：Staphylococcus saprophyticus
Sense primer Mid-F：5’-TTACGCTATATAAACAAATAAT-3’
Anti-sense primer Mid-R：5’-ATGACTAGTGTATGGATTGTT-3’.
Primer pair 2：The molten big coccus of junket
Sense primer Duf-F：5’-ACGAGTGCGAAATTTGCGAG-3’
Anti-sense primer Duf-R：5’-TCCACATCGACCTCACATCG-3’.
The primer pair sequence can be by artificial synthesized.
Positive control dna：Using the genomic DNA of staphylococcus saprophyticus as template, with the Mid-F that is related in the present invention and
Mid-R is primer, expands purpose fragment.Amplification program is：95 DEG C of 5min, 35 circulations (95 DEG C of 30s, 53 DEG C of 30s, 72 DEG C
30s), last 72 DEG C of 10min.Amplified production is entered into row agarose gel electrophoresis, reclaimed with commercial kit, purify purpose
DNA fragmentation, is connected, transformed competence colibacillus bacillus coli DH 5 alpha with pMD 19-T carriers, battalion of the coating containing 80 μ g/ml ampicillins
Picking monoclonal bacterial strain after broth agar plates, incubated overnight is supported, the 5ml nutrient meats containing 80 μ g/ml ampicillins are inoculated into
In soup, 37 DEG C, 200rpm, culture to exponential phase is positive strain through the correct bacterial strain of sequencing identification.Carried with DNA of bacteria
Take kit to extract the recombinant plasmid pMD-Mid in positive strain, be used as positive control；The positive recombinant plasmid of the molten big coccus of junket
Structure of the pMD-Duf preparation process with reference to pMD-Mid recombinant plasmids.
Negative control DNA：Staphylococcus aureus CVCC1882 is bought in China Veterinery Drug Inspection Office.Glycerine is taken to freeze
The μ l of CVCC1882 bacterial strains 5, be inoculated into 5ml nutrient broths, 37 DEG C, 200rpm, cultivate to exponential phase, use DNA of bacteria
Extracts kit extracts its genomic DNA, is used as negative control；
Sterile deionized water：121 DEG C of autoclaving 30min of deionized water.
Embodiment 2
The multiple PCR reagent kit user of staphylococcus saprophyticus and the big coccus of molten junket in the detection low-temperature meat product of the present invention
Method is：
1. from the pathological material of diseases such as pure bacterial cultures, low-temperature meat product (such as sausage, bacon, salt water duck etc.), putrid food
Extract STb gene.Commercial kit can be used in DNA extraction.
2. by 2 × PCR TaqMix in kit, primer pair 1 (sense primer Mid-F, anti-sense primer Mid-R), primer
PCR reaction solutions are configured to 2 (anti-sense primer Duf-F, anti-sense primer Duf-R), sterile deionized water and the DNA profiling of extraction,
The μ l of total system 50.Simultaneously positive control is expanded with the positive control dna in kit as template；With the feminine gender in kit
Comparison DNA expands negative control as template.The specific compound method of PCR reaction solutions such as table 1：
The compound method of the PCR reaction solutions of table 1
3. the above-mentioned PCR reaction solutions prepared are placed in PCR instrument, purpose fragment is expanded, amplification program is as follows：95℃
5min, 35 circulations (95 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 30s), last 72 DEG C of 10min.
4. electrophoresis observation：Each μ l of 10 μ l, DL2000 molecular masses standard 6 of amplified production are taken, with 1% Ago-Gel,
Electrophoresis 30min under 120V voltages.Observed with gel uv analyzer, photograph is preserved.Expand purpose fragment size be 201bp and
390bp。
5. result judgement：Purpose fragment is arrived in positive control amplification, is tested and is set up when negative control is without purpose fragment.If sample
The DNA fragmentation to about 201bp is expanded, the staphylococcus saprophyticus positive is judged to, if sample amplification is judged to about 390bp DNA fragmentation
The molten big coccus of junket is positive, if sample amplification is to about 201bp and 390bp DNA fragmentation, is judged to staphylococcus saprophyticus and the big ball of molten junket
Bacterium is positive；If conversely, without band, being judged to feminine gender.
6. amplified production is sequenced, its nucleotides sequence is classified as the partial nucleotide sequence of staphylococcus saprophyticus Mid genes
Row, length is 201bp.Obtained nucleotide sequence is sequenced as follows：
SEQ ID No.1
TTACGCTATATAAACAAATAATTCTATAATGGCAATAATTAAAAAGATCAAGAATACTATGCCATATAT
ATTATTCTTCTTAACACTTTTAGCATTGGCATTTTTTTGTTTCGCTTTACTATTTAAATTAGAAAAGAAAGTGATGC
CAGAATAAACAGCAATAAGTACCGTTATTGCAAAAACAATCCATACACTAGTCAT
Amplified production is sequenced, its nucleotides sequence is classified as the partial nucleotide sequence of the big coccus Duf genes of molten junket,
Length is 390bp.Obtained nucleotide sequence is sequenced as follows：
SEQ ID No.2
TACGAGTGCGGAATTTGCGAGTTGAAACGGGTAGTTGAACTTTGCGCTATTTTCCAGGAACATATCGTT
ATTTCTAAGGACCCATTCGTCATTATCTGTCTTCACATAGTCCAGATCTAAGTCCAGATACGTGATATTACCATCTC
TATCGCGTTCACATGGAGAAGAGATATTACAGAATATCTTAATGGGTTGATAAGCCTTATCTAGAGCGATAGAAACA
GTATAACCATGATACTTTGGAAGAAAATGAAGTGTTTTATACTGTAATGGGATATCAATATTTTTGATAAAGTGTCG
GAGTATTGTCGTTTCATCACAGATGACAAGAAAGTATTCTTCTGTTTCTTTTAACAGCATACCTTCTACCTCGATGT
GAGGCCGATGTGGAA
Embodiment 3
The specific detection of kit of the present invention
10 plants of Staphylococcus sciuris, 5 plants of staphylococcus aureuses, 5 plants of excrement intestines balls are extracted with DNA of bacteria extracts kit
Bacterium, 5 Enterococcus faecalis, 10 plants of Escherichia coli, 10 plants of salmonellas, 10 plants of Pasteurellas, the gene of 5 plants of riemerella anatipestifers
Group DNA, using these DNA samples as template, enters performing PCR with the kit in the present invention and detects.As a result show, squirrel grape ball
Bacterium, staphylococcus aureus, enterococcus faecalis, VREF, Escherichia coli, salmonella, Pasteurella, riemerella anatipestifer
It is feminine gender, shows that kit specificity is good.
Embodiment 4
The sensitivity Detection of kit of the present invention
The genomic DNA of staphylococcus saprophyticus and the big coccus of molten junket is extracted, spectrophotometer method determines its DNA initial concentration
For 280ng/ μ l, its concentration is adjusted to 10ng/ μ l, 10 times are then diluted successively, the DNA profiling of 7 concentration is obtained, its concentration
Gradient is respectively 10ng/ μ l, 1ng/ μ l, 100pg/ μ l, 10pg/ μ l, 1pg/ μ l, 100fg/ μ l, 10fg/ μ l.Each concentration
DNA respectively takes 1 μ l to make template, and entering performing PCR with kit of the present invention respectively expands.Testing result shows, in the present invention
Kit detection limitation is staphylococcus saprophyticus genomic DNA 100pg；The genomic DNA 10pg of the molten big coccus of junket, illustrates examination
Agent box sensitiveness is good.
Embodiment 5
87, sample for being suspected to be spoilage organisms pollution is collected from low-temperature meat product (sausage, bacon, salt water duck), it is sterile to take
Appropriate tissue, STb gene is extracted with general-purpose genetic group DNA extraction kit, every part of DNA sample takes 5 μ l as mould from tissue
Plate, is detected respectively with kit of the present invention.Meanwhile, tissue is coated on the chocolate flat board containing 8% Sheep Blood
On, 37 DEG C are placed in, 24h is cultivated in the incubator containing 5% carbon dioxide, bacteria distribution identification is carried out.The detection knot of two methods
It is really：The positives sample of bacterial isolation method has 71 parts, and negative has 16 parts.Detected with the kit of the present invention, on
State 71 parts of all positives of positive sample；It is the positive to have 12 parts in 16 negative samples, and 4 parts are feminine gender.The symbol of two methods
Conjunction rate is 71+4/87=86.2%, illustrates that kit of the present invention is more sensitive than conventional bacteria isolation and identification method.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention,
Although the present invention is described in detail with reference to the foregoing embodiments, for those skilled in the art, it still may be used
To be modified to the technical scheme described in foregoing embodiments, or equivalent substitution is carried out to which part technical characteristic.
Within the spirit and principles of the invention, any modification, equivalent substitution and improvements made etc., should be included in the present invention's
Within protection domain.
Sequence table
SEQUENCE LISTING
<110>Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
<120>The specific primer and multiple PCR detection kit of the corrupt pathogen of detection
<160> 2
<170> PatentIn Version 3.5
<210> 1
<211> 199
<212> DNA
<213>Artificial sequence
<400> 1
TTACGCTATATAAACAAATAATTCTATAATGGCAATAATTAAAAAGATCAAGAATACTATGCCATATATA
TTATTCTTCTTAACACTTTTAGCATTGGCATTTTTTTGTTTCGCTTTACTATTTAAATTAGAAAAGAAAG
TGATGCCAGAATAAACAGCAATAAGTACCGTTATTGCAAAAACAATCCATACACTAGTCAT 201
<210> 2
<211> 392
<212> DNA
<213>Artificial sequence
<400> 2
TACGAGTGCGGAATTTGCGAGTTGAAACGGGTAGTTGAACTTTGCGCTATTTTCCAGGAACATATCGTTATTT
CTAAGGACCCATTCGTCATTATCTGTCTTCACATAGTCCAGATCTAAGTCCAGATACGTGATATTACCATCTCTATC
GCGTTCACATGGAGAAGAGATATTACAGAATATCTTAATGGGTTGATAAGCCTTATCTAGAGCGATAGAAACAGTAT
AACCATGATACTTTGGAAGAAAATGAAGTGTTTTATACTGTAATGGGATATCAATATTTTTGATAAAGTGTCGGAGT
ATTGTCGTTTCATCACAGATGACAAGAAAGTATTCTTCTGTTTCTTTTAACAGCATACCTTCTACCTCGATGTGAGG
CCGATGTGGAA 392
Claims (8)
1. a kind of specific primer for detecting corrupt pathogen, it is characterised in that big mainly for staphylococcus saprophyticus and molten junket
Coccus；The nucleotides sequence of the specific primer is classified as：
Primer pair 1：Staphylococcus saprophyticus
Sense primer Mid-F：5’-TTACGCTATATAAACAAATAAT-3’
Anti-sense primer Mid-R：5’-ATGACTAGTGTATGGATTGTT-3’.
Primer pair 2：The molten big coccus of junket
Sense primer Duf-F：5’-ACGAGTGCGAAATTTGCGAG-3’
Anti-sense primer Duf-R：5’-TCCACATCGACCTCACATCG-3’.
2. a kind of multiple PCR reagent kit for the specific primer for detecting corrupt pathogen, it is characterised in that mainly for saprophytic Portugal
Grape coccus and the big coccus of molten junket；The kit includes specific primer, and the nucleotides sequence of the specific primer is classified as：
Primer pair 1：Staphylococcus saprophyticus
Sense primer Mid-F：5’-TTACGCTATATAAACAAATAAT-3’
Anti-sense primer Mid-R：5’-ATGACTAGTGTATGGATTGTT-3’.
Primer pair 2：The molten big coccus of junket
Sense primer Duf-F：5’-ACGAGTGCGAAATTTGCGAG-3’
Anti-sense primer Duf-R：5’-TCCACATCGACCTCACATCG-3’.
3. a kind of multiple PCR reagent kit of specific primer for detecting corrupt pathogen according to claim 2, its feature
It is, the kit also includes positive control and negative control.
4. a kind of multiple PCR reagent kit of specific primer for detecting corrupt pathogen according to claim 3, its feature
It is, the positive control is the recombinant plasmid of the partial nucleotide sequence containing staphylococcus saprophyticus Mid genes, the part core
The length of nucleotide sequence is 201bp, and sequence is：
TTACGCTATATAAACAAATAATTCTATAATGGCAATAATTAAAAAGATCAAGAATACTATGCCATATATATTA
TTCTTCTTAACACTTTTAGCATTGGCATTTTTTTGTTTCGCTTTACTATTTAAATTAGAAAAGAAAGTGATGCCAGA
ATAAACAGCAATAAGTACCGTTATTGCAAAAACAATCCATACACTAGTCAT
And the recombinant plasmid that the positive control is the partial nucleotide sequence containing the big coccus Duf genes of molten junket, the part
The length of nucleotide sequence is 392bp, and sequence is：
TACGAGTGCGGAATTTGCGAGTTGAAACGGGTAGTTGAACTTTGCGCTATTTTCCAGGAACATATCGTTATTT
CTAAGGACCCATTCGTCATTATCTGTCTTCACATAGTCCAGATCTAAGTCCAGATACGTGATATTACCATCTCTATC
GCGTTCACATGGAGAAGAGATATTACAGAATATCTTAATGGGTTGATAAGCCTTATCTAGAGCGATAGAAACAGTAT
AACCATGATACTTTGGAAGAAAATGAAGTGTTTTATACTGTAATGGGATATCAATATTTTTGATAAAGTGTCGGAGT
ATTGTCGTTTCATCACAGATGACAAGAAAGTATTCTTCTGTTTCTTTTAACAGCATACCTTCTACCTCGATGTGAGG
CCGATGTGGAA。
5. the multiple PCR reagent kit of the specific primer of the corrupt pathogen of detection according to claim 2-4 a kind of makes
With method, it is characterised in that be, using DNA to be measured as template, to enter performing PCR amplification using described specific primer, amplification is produced
Thing electrophoresis, if DNA fragmentation of the amplification to about 201bp, is judged to the staphylococcus saprophyticus positive, if DNA piece of the amplification to about 390bp
Section, is judged to that the big coccus of molten junket is positive, if amplification is to about 201bp and 390bp DNA fragmentation simultaneously, be judged to staphylococcus saprophyticus and
The molten big coccus of junket is positive；Conversely, being judged to feminine gender.
6. the multiple PCR reagent kit of the specific primer of the corrupt pathogen of detection according to claim 2-4 a kind of makes
With method, it is characterised in that the PCR reaction conditions are：95 DEG C of 5min, 35 circulations are 95 DEG C of 30s, 53 DEG C of 30s, 72 DEG C
30s, last 72 DEG C of 10min.
7. the multiple PCR reagent kit of the specific primer of the corrupt pathogen of detection according to claim 2-4 a kind of makes
With method, it is characterised in that be, using DNA to be measured as template, to enter performing PCR amplification using described specific primer, amplification is produced
Thing electrophoresis, if amplification detects staphylococcus saprophyticus to about 201bp DNA fragmentation, if about 392bp DNA pieces are arrived in amplification
Section, then detect the big coccus of molten junket, if amplification is detected simultaneously by staphylococcus saprophyticus to 201bp and 392bp DNA fragmentation
With the big coccus of molten junket.
8. nucleotide sequence according to claim 4, it is characterised in that the saprophytic grape in detection low-temperature meat product is prepared
Application in coccus and the big coccus reagent of molten junket.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710217225.6A CN107012215B (en) | 2017-04-05 | 2017-04-05 | Specific primer for detecting putrefactive pathogenic bacteria and multiple PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710217225.6A CN107012215B (en) | 2017-04-05 | 2017-04-05 | Specific primer for detecting putrefactive pathogenic bacteria and multiple PCR detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012215A true CN107012215A (en) | 2017-08-04 |
| CN107012215B CN107012215B (en) | 2021-08-24 |
Family
ID=59445893
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710217225.6A Active CN107012215B (en) | 2017-04-05 | 2017-04-05 | Specific primer for detecting putrefactive pathogenic bacteria and multiple PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012215B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108896758A (en) * | 2018-05-09 | 2018-11-27 | 中国农业科学院兰州兽医研究所 | A kind of kit based on molten junket big coccus plate agglutination test antigen composition, preparation method and applications |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814797A (en) * | 2005-12-02 | 2006-08-09 | 浙江大学 | Method for identifying 28 frequent phthogenic bacteria for clinical bacteremia |
-
2017
- 2017-04-05 CN CN201710217225.6A patent/CN107012215B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814797A (en) * | 2005-12-02 | 2006-08-09 | 浙江大学 | Method for identifying 28 frequent phthogenic bacteria for clinical bacteremia |
Non-Patent Citations (3)
| Title |
|---|
| S. CORBIERE MOROT-BIZOT等: "Development of a multiplex PCR for the identification of Staphylococcus genus and four staphylococcal species isolated from food", 《JOURNAL OF APPLIED MICROBIOLOGY》 * |
| 刘芳等: "应用PCR-DGGE指纹图谱技术分析盐水鸭贮藏过程中的细菌多样性", 《南京农业大学学报》 * |
| 徐维艳等: "低温肉制品中腐败菌研究进展", 《江苏农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108896758A (en) * | 2018-05-09 | 2018-11-27 | 中国农业科学院兰州兽医研究所 | A kind of kit based on molten junket big coccus plate agglutination test antigen composition, preparation method and applications |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107012215B (en) | 2021-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| De Carli et al. | Virulence gene content in Escherichia coli isolates from poultry flocks with clinical signs of colibacillosis in Brazil | |
| Esteban et al. | A survey of food-borne pathogens in free-range poultry farms | |
| Yang et al. | Vibrio cholerae was found in cultured bullfrog | |
| CN110184372A (en) | A kind of detection ox source Klebsiella Pneumoniae specific primer and its methods and applications | |
| Ghaffoori | Prevalence of Campylobacter jejuni in chicken meat marketed in Baghdad province | |
| CN107012215A (en) | The specific primer and multiple PCR detection kit of the corrupt pathogen of detection | |
| CN111549124A (en) | Molecular marker for detecting staphylococcus aureus mastitis of dairy cows and application thereof | |
| CN104004842A (en) | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals | |
| CN106701976B (en) | The cause of disease multiple PCR detection kit of one breeder common bacteria disease | |
| Kundu et al. | Isolation of multidrug-resistant Escherichia coli from turkeys in Dinajpur, Bangladesh, and their antibiogram profile | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| Nayel et al. | Molecular typing of Clostridium perfringens isolates from soil, healthy, and diseased sheep in Egypt by multiplex PCR | |
| Ahmed et al. | Isolation and molecular diagnosis of the main bacterial species causing Pneumonia in small ruminants in the Duhok Abattoir-Kurdistan region of Iraq | |
| CN110241060B (en) | Mink klebsiella pneumoniae and application thereof | |
| CN106701994A (en) | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer | |
| Villard et al. | Enterotoxin D producing strains of Staphylococcus aureus are typeable by pulsed-field gel electrophoresis (PFGE) | |
| Shabana et al. | Molecular characterization of Yersinia enterocolitica isolated from chicken meat samples. | |
| Villani et al. | Presence and characterisation of verotoxin producing E. coli in fresh Italian pork sausages, and preparation and use of an antibiotic-resistant strain for challenge studies | |
| CN105132555B (en) | The PCR detection kit and detection method of a kind of pneumonia infection Klebsiella of Chinese giant salamander, Andrias davidianus | |
| Khan et al. | The prevalence of Clostridium perfringens in retail meat of Mardan, Pakistan | |
| CN103820536A (en) | Detecting method for of salmonella enteritidis | |
| Bouvier et al. | Comparative Evaluation of a Novel Phage Protein Ligand Assay and Immunomagnetic Separation Method To Isolate the Seven Top Serogroups of Escherichia coli (O157, O26, O103, O145, O111, O45, and O121) in Foods at Risk | |
| CN108950033B (en) | Nano PCR kit for simultaneously detecting enterohemorrhagic escherichia coli O45 and O145 and application thereof | |
| Ahmed et al. | Molecular Sequencing Study of Salmonella spp Which Isolated from Cattle Meat and Human Stool | |
| Hussain | Isolation and diagnosis of some pathogenic bacterial species contamination from red meat in shops and markets in Thi-Qar city. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Chen Qiwei Inventor after: Zheng Fuying Inventor after: Gong Xiaowei Inventor after: Liu Yongsheng Inventor before: Zheng Fuying Inventor before: Chen Qiwei Inventor before: Gong Xiaowei Inventor before: Liu Yongsheng |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |