CN106995821B

CN106995821B - Jurkat-KI-R5 cell line and construction method and application thereof

Info

Publication number: CN106995821B
Application number: CN201610052703.8A
Authority: CN
Inventors: 付雪梅
Original assignee: Shenzhen Childrens Hospital
Current assignee: Shenzhen Childrens Hospital
Priority date: 2016-01-26
Filing date: 2016-01-26
Publication date: 2021-05-14
Anticipated expiration: 2036-01-26
Also published as: CN106995821A

Abstract

The invention relates to Jurkat-KI-R5 as well as a construction method and application thereof, wherein a powerful enhancer/promoter Combination (CAG) is homologous recombined and knocked into a promoter region of a CCR5 gene of a CD4+ Jurkat T cell through a CRISPR/Cas9 gene editing technology, and a genetically modified cell line is named as Jurkat-KI-R5 cell. The Jurkat-KI-R5 cell CAG promoter is precisely recombined to the position specified by the CCR5 promoter, so that CCR5 is stably and highly expressed. In contrast to the parental Jurkat cell line, Jurkat-KI-R5 cells are highly susceptible to HIV-1 infection. Therefore, Jurkat-KI-R5 cells provide an urgent cell platform for AIDS research.

Description

Jurkat-KI-R5 cell line and construction method and application thereof

Technical Field

The invention relates to biotechnology, in particular to a Jurkat-KI-R5 cell line and a construction method and application thereof.

Background

Despite the tremendous efforts in the past decades in the development of antiretroviral therapy to prevent and treat hiv, aids remains one of the most important infectious diseases worldwide. According to the united nations aids planning agency report, the global prevalence of aids in 2013 increased from 8.1 million aids carriers in 1990 to 35.3 million aids in 2012. In addition, drug resistant HIV strains have recently been reported. Therefore, the development of new therapeutic approaches for the clearance of HIV in patients is an important therapeutic approach. An HIV host cell line capable of unlimited proliferation is very important for the development of AIDS research and treatment.

HIV is primarily targeted to macrophages and CD4+ T cells in vivo. Additionally, CCR5 and CXCR4 co-receptors are essential for HIV infection of T cells. Therefore, the establishment of CD4+ T cells stably expressing the HIV-1 co-receptor CCR5 would be very useful for HIV research. However, existing cell lines either underexpress CCR5 and do not support R5HIV-1 infection, or are unable to stably express CCR5 from a transgenic CCR5 expression vector that is randomly integrated into the genome. Thus, one bottleneck problem in HIV research is the lack of a T cell line that stably expresses both CD4 and CCR 5. Even the previously established CCR5 transgenic T cell line resulted in unstable expression of the transgene because of random integration of the expression vector into the genome. Therefore, establishing a new human CD4+ T cell line with high expression of endogenous CCR5 gene plays an important role in developing a new strategy for treating HIV.

Disclosure of Invention

Based on this, one of the objects of the present invention is to provide a method for constructing Jurkat-KI-R5 cell line, and the constructed Jurkat-KI-R5 cell line can express CCR5 at high level.

The technical scheme for achieving the purpose is as follows.

A method for establishing Jurkat-KI-R5 cell line comprises the following steps:

A. culturing Jurkat cells;

B. constructing pU6-CCR5-gRNA vector: carrying out enzyme digestion on the pU6-gRNA vector by BbsI restriction endonuclease, and recovering; inserting a DNA double chain, wherein the DNA double chain is formed by annealing SEQ ID NO.2 and SEQ ID NO.3, and obtaining a pU6-CCR5-gRNA vector by competent cell transformation and plasmid extraction;

C. constructing a repair template DNA vector, wherein the repair template DNA vector sequentially comprises a CCR5 gene upstream homology arm, a LoxP site, a CAG promoter, a resistance screening gene Puro-IRES-Neo, a LoxP site, a CAG promoter and a CCR5 gene downstream homology arm from a 5 'end to a 3' end;

D. co-transfecting a linearized repair template DNA vector, a pU6-CCR5-gRNA plasmid and a plasmid capable of expressing hCas9 into Jurkat cells, adding a culture solution after transfection to recover the growth of the cells, adding a culture medium containing puromycin for culture, screening and separating out monoclonals to obtain the Jurkat-KI-R5 cell line.

In one embodiment, the repair template DNA vector has a sequence shown in SEQ ID NO. 4.

In one embodiment, the parameters of electrotransfection are: 0.4cm electric shock cup, 250volt, 975 muF, cell number 5x10⁵-5x10⁶The mass of DNA is 1.8-2.2 mug.

In one embodiment, the plasmid capable of expressing hCas9 is the pCAG-hCas9 plasmid.

In one embodiment, the puromycin concentration in the culture medium is 1.5-2.0. mu.g/ml.

Another objective of the invention is to provide a Jurkat-KI-R5 cell line, which can be used as a platform for developing AIDS treatment drugs.

The technical scheme for achieving the purpose is as follows.

Jurkat-KI-R5 cell line obtained according to the above construction method.

Another object of the present invention is to provide the use of the above Jurkat-KI-R5 cell line.

The Jurkat-KI-R5 cell line is applied to the development of AIDS treatment medicines.

The Jurkat-KI-R5 cell line is used as a platform for developing AIDS treatment.

In order to activate the expression of the endogenous CCR5 gene, the invention knocks a powerful enhancer/promoter Combination (CAG) into the promoter region of the CCR5 gene of CD4+ Jurkat T cells by CRISPR/Cas9 gene editing technology through homologous recombination, and the genetically modified cell line is named as Jurkat-KI-R5 cells. Flow cytometric analysis confirmed the expression of CCR5 on the cell surface of Jurkat-KI-R5T. Jurkat-KI-R5 was tested for HIV infection by measuring the level of supernatant P24 after HIV infection.

The precise recombination of the CAG promoter of the Jurkat-KI-R5 cell of the invention to the designated position of the CCR5 promoter results in stable high expression of CCR5, and in contrast to the parent Jurkat cell line, the Jurkat-KI-R5 cell is very susceptible to HIV-1 infection. Therefore, Jurkat-KI-R5 cells provide an urgent cell platform for AIDS research. By taking Jurkat-KI-R5 cells as a system, the invention establishes a CRISPR/CAS 9-mediated technology for efficiently knocking out CCR5 gene, and lays a foundation for gene therapy of AIDS.

Drawings

FIG. 1 shows the construction of a repair template DNA vector.

FIG. 2 is a depiction of the knocking-in of the CAG enhancer/promoter combination into the promoter site of the endogenous CCR5 gene of Jurkat cells by homologous recombination using CRISPR/CAS9 technology, wherein,

(a) the configuration of the human endogenous CCR5 gene locus, a black box represents an exon of CCR5, two homologous arms, Up-Arm and Dn-Arm, are shown in the figure, and an asterisk designates a target point of gRNA;

(b) configuration of the allele after homologous recombination;

(c) PCR identification of CAG knock-in clones. Amplifying 1297bp wild type fragments by the primers a and B, and amplifying 750bp fragments of recombined alleles by the primers A and B;

(d) southern blotting verifies the homologous recombination of the allele;

(e) CCR5 CD4⁺Jurkat-KI-R5 cell surface high expression;

(f) Jurkat-KI-R5 cells support HIV-1 infection.

Detailed Description

In order to clearly understand the technical contents of the present invention, the following embodiments are described in detail with reference to the accompanying drawings. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

Example 1: establishment of Jurkat-KI-R5 cells

1.1 cell culture

Jurkat cells (

Number:TIB-152^TM) The culture density is maintained at 0.5-2x10⁶cells/mL, cultured in basal medium RPMI1640 supplemented with 10% heat-inactivated fetal bovine serum, 100units/mL penicillin, 100. mu.g/mL streptomycin and 2 mmol/L-glutamine.

1.2DNA vector construction

DNA vectors encoding the humanized Cas9 protein were purchased from Addgene (cat # 51142). A DNA vector pU6-CCR5-gRNA for generating gRNA targeting a CCR5 gene site was constructed from a pU6-gRNA plasmid (Addgene Cat.: 53062) by ligating the annealed DNA duplex of the relevant targeting sequence to two BbsI cleavage sites or other Type IIS restriction enzyme (Type IIS restriction enzyme) sites. The targeted DNA site is GTGCACAGGGTGGAACAAGA. Two sides of a plasmid of the repair template are respectively provided with two homology arms of CCR5 genes, wherein the upstream homology arm is at the upstream of an ATG (initiation codon) of a CCR5 gene, the downstream homology arm comprises an ATG (initiation codon) of a CCR5 gene and the downstream thereof, a neomycin/puromycin resistance screening gene is arranged next to the upstream homology arm, LOXP sites are arranged at two sides of the gene, and a CAG promoter for over-expressing the CCR5 gene is arranged behind the resistance screening gene. The donor plasmid was verified by DNA sequencing analysis. The specific construction steps are as follows:

1.2.1 construction of pU6-CCR5-gRNA vector

The pU6-gRNA vector was digested with BbsI restriction enzyme, and the recovered gel was used for the next step of ligation of the inserted DNA fragment. The inserted DNA fragment is formed by annealing two single-stranded nucleotides into a DNA double strand, and the DNA fragment comprises a targeting sequence and a related sequence connected with a vector nick, wherein the targeting sequence is GTGCACAGGGTGGAACAAGA (SEQ ID NO.1), the single-stranded DNA sequence 1(Oligo-F) is 5'-TGCACAGGGTGGAACAAGAGTTTT-3' (SEQ ID NO.2), and the single-stranded DNA sequence 2(Oligo-R) is 5'-TCTTGTTCCACCCTGTGCACGGTG-3' (SEQ ID NO. 3). SEQ ID NO.2 is reverse complementary to the italic part of SEQ ID NO. 3. According to the kit specification, the vector after recovery of the restriction enzyme glue and the annealed inserted DNA fragment are connected under the action of T7 ligase, and the correct pU6-CCR5-gRNA vector is determined to be used for the next cell transfection experiment after competent cell transformation, plasmid extraction, restriction enzyme identification and DNA sequence sequencing. The method comprises the following specific steps:

in a 10ul ligation system, 5ul of ligation product is sucked and added into 50ul of DH5Alpha competent cells dissolved on ice, the mixture is flicked evenly and incubated on ice for 30 minutes, then water bath at 42 ℃ is used for heat shock for 30-60 seconds, ice incubation for 2-5 minutes after heat shock is carried out, then about 950ul of LB culture medium or SOC culture medium is added for resuscitation at 37 ℃ for 30-60 minutes, and the mixture is evenly coated on an LB-Agar bacterial culture plate with ampicillin. After bacterial clones grow out, the monoclone is selected, and the small extraction is carried out according to the instruction of the plasmid small extraction kit. After a small extraction, 200ng of plasmid is taken, cut by restriction endonucleases NheI and NotI (including but not limited to the two restriction endonucleases, and any other enzyme capable of identifying the plasmid can be used) according to the instruction, and the correct plasmid is selected for DNA sequencing to determine that the correct sequence is inserted into the plasmid. The correct pU6-CCR5-gRNA vector was used for the next cell transfection experiment.

1.2.2 construction of repair template vectors

The repair template DNA vector is constructed by a conventional molecular cloning technology, and the specific sequence is as follows: the sequence of the italic part is the upstream homology arm of the CCR5 gene, the sequence of the underlined part is a LoxP site, the sequence of the underlined italic part is a CAG promoter, the sequence of the bold part is a resistance screening gene Puro-IRES-Neo, and the sequence of the shaded part is the downstream homology arm of the CCR5 gene. The structure is shown in fig. 1. The complete sequence is preferably shown in SEQ ID NO.4 in this example. The donor plasmid was constructed and verified by sequence analysis using the Gibson assembly method.

SEQ ID NO.4:

GATATCCTGCAGCCCAATTCCGATCATATTCAATAACCCTTAAT

TAGGTCTGAAGAGGAGTTTACGT

TGCAGCGTTGACAATTAATCATCGGCATAGTATATCGGCATAG

TATAATACGACAAGGTGAGGAACTAAACC

CGCCCGCCCC

ACGACCCGCAGCGCCCGACCGAAAGGAGCGCACGACCCCATGCATCGTCTAGAGCTCGCTGATCAGCC

TCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGA

AGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTC

ATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCAT

GCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGACTAGAGCTTGC

GGAACCCTTAAT

TAGGTCCCTCGAGGGCAATTGA

T

1.3Jurkat cell transfection and selection

The linearized repair template plasmid, the pU6-CCR5-gRNA plasmid and the pCAG-hCas9 plasmid (Addge Inc., plasmid number 51142. and any other plasmid capable of expressing hCas9, including but not limited to Addge Inc. other plasmids and self-constructed plasmids capable of expressing hCas9 protein) were co-transfected into Jurkat cells using a type II Gene pulse cell electroporator (Biorad Gene Pulser Xcell). The specific parameters of electrotransfection are: 0.4cm electric shock cup, 250volt, 975 muF, cell number 1X10⁶The mass of DNA was 2. mu.g. After transfection, the cells were allowed to resume growth by adding a culture medium for 48 hours, followed by culture for 14 days in a medium containing puromycin at a concentration of 1.75. mu.g/ml (the medium is a medium for conventional culture of Jurkat cells, and may be any other medium capable of culturing Jurkat cells). In the purineSingle clones were isolated from cells surviving the mycin screening and plated in 96-well plates to give Jurkat-KI-R5 cells.

Example 2: Jurkat-KI-R5 cells for analytical detection

2.1 flow cytometric assay

Expression analysis of surface human CCR5 and CD4 proteins was performed on Jurkat-KI-R5 cells using a BD LSR-II flow cytometer. The data were further analyzed by FACS Diva (Becton Dickinson) and FlowJo software. 1x10⁶Cells were washed with PBS and stained with DAPI, APC anti-hCR 5(BD antibody) and PE anti-CD4(BD antibody) for 30 min at room temperature. After staining, cells were washed twice with PBS, resuspended in FACS buffer and then machine analyzed.

See FIG. 2 for (e) CCR5 at CD4⁺Jurkat-KI-R5 is highly expressed on the cell surface.

As can be seen in FIG. 2(e), the Jurkat-KI-R5CCR5 peak of the APC channel of the left panel is shifted to the right, while the CD4 of the PE channel of the right panel is not significantly shifted as a whole. The results indicate that cell surface CCR5 expression of Jurkat-KI-R5 is significantly elevated compared to wild-type Jurkat cells.

2.2PCR detection

The knockdown cell line after homologous recombination (Jurkat-KI-R5) was identified using PCR technology. Forward primer a (5'-tctatgaccttccctgggactt-3', SEQ ID NO.5) and reverse primer d (5'-cttgttccaccctgtgcataa-3', SEQ ID NO.6) were used to determine the site of the wild type allele upstream of the targeted gene. Forward primer A (5'-tttcgacaccgaagcagagt-3', SEQ ID NO.7) and reverse primer D (5'-gtgcatgttctttgtgggct-3', SEQ ID NO.8) were used to identify the downstream portion of the targeted gene. For PCR identification of the knockin target cell line after homologous recombination, the same forward primer as in the wild type identification was used, and a reverse primer of interest was additionally designed. Reverse primer B (5'-tcgaacgtaaactcctcttcagac-3' SEQ ID NO.9) was used to verify the upstream arm after homologous recombination, while reverse primer B (5'-cgtgctggttattgtgctgtc-3' SEQ ID NO.10) was used to identify the downstream arm after homologous recombination. Referring to (b) of FIG. 2, the position of the probe and the size of the SacI restriction fragment are shown. PCR primers (a, D, A and D) were used to determine the wild type allele. Primers (a, B, a and B) were used to screen knock-in alleles; the sizes of the PCR amplicons are shown. The PCR amplification procedure was: 4 minutes at 1.94 ℃; 45 seconds at 2.94 ℃; 30 seconds at 3.57 ℃; repeating to step 2 for 39 cycles at 4.72 ℃ for 45 seconds; 5.72 ℃ for 5 minutes; 6. maintaining the temperature at 4 ℃.

PCR identification of CAG knock-in clones.

As for the amplification results, please refer to (c) in FIG. 2, primers A and B amplify a 1297bp wild-type fragment, and primers A and B amplify a 750bp fragment of the recombined allele.

The primer used in the upper left panel of FIG. 2(c) is a + b, and it can be seen from the position diagram of the primer in FIG. 2(b) that only the 1297bp knock-in allele of the upstream arm is amplified by Jurkat-KI-R5. The primers used in the upper right panel of FIG. 2(c) are a + d, and it can be seen from FIG. 2(a) that the cells containing the wild-type allele all amplified a 1072bp wild-type fragment. The primer used in the bottom left panel of FIG. 2(c) is A + B, and it can be seen from the primer position map of FIG. 2(B) that only Jurkat-KI-R5 amplified the 750bp knock-in allele of the downstream arm. The primers used in the bottom right panel of FIG. 2(c) are A + D, and it can be seen from FIG. 2(a) that cells containing the wild-type allele all amplified a 1368bp wild-type fragment. As described above, Jurkat-KI-R5 belongs to the heterozygote type knock-in cell, one allele is knock-in and the other allele is wild type.

2.3Southern blotting analysis

Genomic DNAs of wild-type Jurkat cells and genetically recombined Jurkat-KI-R5 cells were extracted, and 15. mu.g of each DNA sample was digested with the restriction enzyme SacI. Digested DNA was separated on a 1.0% agarose gel under the following conditions: 30-35V,160mA,16 hours. Then transferring the separated DNA fragments to a nitrocellulose membrane by capillary absorption³²The P-labeled DNA probe is used for labeling the CCR5 gene and verifying whether the gene is knocked in accurately. Referring to (d) in FIG. 2, Jurkat-KI-R5 contains both Wild Type (WT) and knock-in (KI) specific bands, indicating that the gene has knocked into one of the alleles, in agreement with the PCR amplification results in FIG. 2(c), Jurkat-KI-R5 being a heterozygous knock-in cell.

The downstream (Dn) probe sequence was: atgcctttgtcggggagaagttcagaaactacctcttagtcttcttccaaaagcacattgccaaacgcttctgcaaatgctgttctattttccagcaagaggctcccgagcgagcaagctcagtttacacccgatccactggggagcaggaaatatctgtgggcttgtgacacggactcaagtgggctggtgacccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggg gtggggtgggagaggtcttttttaaaaggaagttactgttatagagggtctaagattcatccatttatttggcatctgtttaaagtagattagatcttttaagcccatcaattatagaaagccaaatcaaaatatgttgatgaaaaatagcaacctttttatctccccttcacatgcatcaagttattgacaaactctcccttcactccgaaagttccttatgtatatttaaaagaaagcctcagagaattgctgattcttgagtttagtgatctgaacagaaataccaaaattatttcagaaatgtacaactttttacctagtacaaggcaacatataggttgtaaatgtgtttaaaacaggtctttgtcttgctatggggagaaaagacatgaatatgattagtaaagaaatgacacttttcatgtgtgatttcccctccaaggtatggttaataagtttcactgacttagaaccaggcgagagacttgtg (SEQ ID NO. 11).

The internal (In) probe sequence was: gccacaaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgacgcccgccccacgacccgcagcgcccgaccgaaaggagcgcacgaccccatgcatcgtctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctcgactagagcttgcggaaccct (SEQ ID NO. 12).

2.4 detection of HIV infection

Wild type Jurkat cells and Jurkat-CCR5 cells were infected with 0.3MOI Bal HIV-1 for 2 hours. The positive control was MOLT-4 cells infected by the same method, and the negative control was uninfected MOLT-4 cells. Supernatants were collected at day 3 and day 7 post infection and tested for concentration levels of P24. All tests were repeated three times. Statistical analysis of the data was handled by the Prism6 program. See (f) in fig. 2. On day three of HIV-1 infection, p24 was not detected by the negative control MOLT4-no virus, p24 was detected at a high concentration by the positive control MOLT4-virus, indicating that the experiment was rationally designed, and at the same time, p24 was not detected by the wild-type Jurkat, and the p24 concentration level of Jurkat-KI-R5 was comparable to that of the positive control and significantly different from that of the wild-type Jurkat (p 0.0002); on day seven of HIV-1 infection, p24 was not detected by the negative control MOLT4-no virus, p24 was detected at a high concentration by the positive control MOLT4-virus, indicating that the experiment was rationally designed, and p24 was not detected by the wild-type Jurkat, and the p24 concentration level of Jurkat-KI-R5 was comparable to that of the positive control and significantly different from that of the wild-type Jurkat (p 0.0001); the results showed that HIV-1 only infected Jurkat-KI-R5 cells, and was unable to infect wild-type Jurkat cells.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Claims

1. A method for constructing a Jurkat-KI-R5 cell line, comprising the following steps:

obtaining Jurkat cells in culture;

constructing pU6-CCR5-gRNA vector: carrying out enzyme digestion on the pU6-gRNA vector by BbsI restriction endonuclease, and recovering; inserting a DNA double strand, wherein the DNA double strand is formed by annealing SEQ ID NO.2 and SEQ ID NO. 3; transforming competent cells, and extracting plasmids to obtain a pU6-CCR5-gRNA vector;

constructing a repair template DNA vector, wherein the repair template DNA vector sequentially comprises a CCR5 gene upstream homology arm, a LoxP site, a CAG promoter, a resistance screening gene Puro-IRES-Neo, a LoxP site, a CAG promoter and a CCR5 gene downstream homology arm from the 5 'end to the 3' end;

co-transfecting a linearized repair template DNA vector, a pU6-CCR5-gRNA plasmid and a plasmid capable of expressing hCas9 into Jurkat cells, adding a culture solution after transfection to recover the growth of the cells, adding a culture medium containing puromycin for culture, and screening and separating out a monoclonal to obtain a Jurkat-KI-R5 cell line;

the sequence of the repair template DNA carrier is shown in SEQ ID NO. 4; the plasmid capable of expressing hCas9 is pCAG-hCas9 plasmid.

2. The method of claim 1, wherein the puromycin concentration in the culture medium is 1.5 to 2.0 μ g/ml.

3. The method of claim 1, wherein the transfection is an electrotransfection, and the parameters of the electrotransfection are: 0.4cm electric shock cup, 250volt, 975 muF, cell number 5x10⁵-5x10⁶The mass of DNA is 1.8-2.2 mug.

4. Jurkat-KI-R5 cell line obtained by the method according to any one of claims 1 to 3.

5. The use of the Jurkat-KI-R5 cell line of claim 4 for non-diagnostic, non-therapeutic purposes in the development of aids therapeutic drugs.

6. The use of the Jurkat-KI-R5 cell line of claim 4 for non-diagnostic, non-therapeutic purposes as a platform for the development of aids therapy.