CN106967739B - Fusion gene beta TrCP-CypA with HIV-1 inhibiting effect and construction method thereof - Google Patents
Fusion gene beta TrCP-CypA with HIV-1 inhibiting effect and construction method thereof Download PDFInfo
- Publication number
- CN106967739B CN106967739B CN201710055996.XA CN201710055996A CN106967739B CN 106967739 B CN106967739 B CN 106967739B CN 201710055996 A CN201710055996 A CN 201710055996A CN 106967739 B CN106967739 B CN 106967739B
- Authority
- CN
- China
- Prior art keywords
- cypa
- hiv
- gene
- trcp
- beta trcp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y502/00—Cis-trans-isomerases (5.2)
- C12Y502/01—Cis-trans-Isomerases (5.2.1)
- C12Y502/01008—Peptidylprolyl isomerase (5.2.1.8), i.e. cyclophilin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Abstract
A fusion gene beta TrCP-CypA with the function of inhibiting HIV-1 and a construction method thereof; the fusion gene betaTrCP-CypA can inhibit HIV-1 virus, and the gene sequence is shown as SEQ ID NO. 1. The construction method of the gene comprises the following steps: artificially synthesizing to obtain optimized beta TrCP gene N-terminal DNA; amplifying a DNA fragment at the N end of the beta TrCP gene by taking the DNA sequence at the N end of the beta TrCP gene as a template and taking B1 and B2 as primers; amplifying a CypA part by taking a CypAcDNA plasmid as a template and taking B3 and B4 as primers to obtain a CypA DNA fragment; respectively taking a 1 mu L beta TrCP gene N-end part PCR product fragment and a 1 mu L CypA DNA PCR product fragment as templates, carrying out PCR amplification on a fusion gene beta TrCP-CypA and DNA containing 5 silk glycines in the middle by taking B1 and B4 as primers, amplifying a target strip, and cloning into a proper expression vector for expression. The fusion gene beta TrCP-CypA constructed by the invention can degrade HIV-1Gag, thereby achieving the effect of inhibiting HIV-1.
Description
Technical Field
The invention relates to a fusion gene, in particular to a fusion gene beta TrCP-CypA with the function of inhibiting HIV-1 and a construction method thereof.
Background
Human Immunodeficiency Virus (HIV) is commonly referred to as AIDS virus, which induces acquired immune deficiency syndrome in humans. Since the first report in 1984 that the human immunodeficiency virus (HIV-1) is the causative agent of AIDS, a large number of top scientists have been working around the world to overcome this epidemic. HAART and other therapies have significantly reduced the incidence and mortality of AIDS. However, since HIV-1 replication can only be inhibited and intracellular infectious viruses cannot be eliminated, long-term uninterrupted administration is required, and the phenomenon of virus rebound occurs once the administration is stopped. A series of problems are brought to patients by taking a large amount of antiviral drugs for a long time, for example, some drugs have mitochondrial toxicity, serious gastrointestinal reaction and other side effects on the patients.
At present, related vaccines aiming at HIV-1 are also available in the aspect of AIDS prevention, and due to the problem of H1V gene variation, HIV-1 can escape from the monitoring of the immune system, which is a main obstacle in the development of HIV-1 vaccines. Therefore, the effect of simply applying the vaccine to prevent and treat AIDS is not ideal.
The current drugs acting on the HIV-1 co-receptor also seem to circumvent the HIV-1 mutation problem, but act only to prevent HIV-1 from entering the cell and not to degrade or kill the virus.
Current therapies such as HAART against HIV-1 have significantly reduced the incidence and mortality of aids. However, since HIV-1 replication can only be inhibited and intracellular infectious viruses cannot be eliminated, long-term uninterrupted administration is required, and the phenomenon of virus rebound occurs once the administration is stopped.
In recent years, with the growing awareness of the ubiquitin-proteasome pathway (UPP), a targeted ubiquitination protein degradation technology, also called protein knock-down technology, is proposed by utilizing the functional characteristics of the UPP that specifically degrades protein substrates, and the core of the targeted ubiquitination protein degradation technology is to construct a certain E3 capable of specifically binding with a target protein, wherein the E3 contains two domains, namely a functional domain and a binding domain. Compared with the technologies such as gene silencing and the like, the technology for target ubiquitination degradation of protein has advantages, for example, in the aspect of knocking down objects, the technology for target ubiquitination degradation of protein can effectively knock down a certain type of modified target protein, and has more advantages in the aspect of action aging, flexibility and application scale.
Disclosure of Invention
The invention aims to solve the technical problems and provide a fusion gene beta TrCP-CypA with HIV-1 inhibiting effect based on design and a construction method thereof, wherein the constructed fusion gene beta TrCP-CypA can degrade HIV-1Gag and inhibit HIV-1 virus.
A fusion gene betaTrCP-CypA with HIV-1 inhibiting effect can inhibit HIV-1 virus, and its gene sequence is shown in SEQ ID NO. 1.
The construction method of the ubiquitin ligase based fusion gene beta TrCP-CypA for inhibiting HIV-1 comprises the following steps:
step one, optimizing the N-terminal sequence of the beta-TrCP gene by using DNASTAR and the like according to the N-terminal sequence of the human beta-TrCP gene recorded with a login number of NM-003939 in GenBank to obtain an optimized N-terminal sequence of the human beta-TrCP gene, and then performing artificial synthesis to obtain optimized N-terminal DNA of the beta-TrCP gene; the optimized base sequence of the beta TrCP gene N-terminal DNA is shown in a sequence table SEQ ID NO. 2;
step two, designing a primer, wherein the sequence of the primer is as follows:
B1：5' GGAATTCGCCACCATGGACCCAGCAGAAGCAGTG3'；
B2：5' ACTGTGTCTTCCGCATCTCCAG3'；
B3：5' CTGGAGATGCGGAAGACACAGTGGCTCAGGATCAGGCTCAGGA
TCAGGCTCAATGGTCAACCCCACCGTGTTCT 3'; (underlined is DNA containing 5 serine glycine structures)
B4：5' CGGGATCCTTCGAGTTGTCCACAGTCAGCA3'；
C1：5' GGAATTCGCCACCATGGTCAACCCCACCGTGTTC3'；
Step three, amplifying the N-end part of the beta TrCP gene by taking the N-end DNA sequence of the beta TrCP gene as a template and taking B1 and B2 as primers to obtain a DNA fragment at the N-end of the beta TrCP gene; amplifying CypA part by taking CypAcDNA (SEQ ID NO: 3) plasmid as a template and B3 and B4 as primers to obtain a CypA cDNA fragment; respectively taking a PCR product of the N-terminal part fragment of the 1 mu LbetaTrCP gene and a PCR product of the 1 mu L CypA DNA fragment as templates, and carrying out PCR amplification on the fusion gene betaTrCP-CypA by taking B1 and B4 as primers to obtain a target strip with the size of 1300 bp. Are used separatelyEcorI/BamHI double enzyme digestion fusion gene beta TrCP-CypA and pcDNA3.1his vector, and cloning the enzyme digested fusion gene beta TrCP-CypA into the pcDNA3.1his vector.
In the third step, B1 and B2 are used as primers to amplify the N-terminal sequence of the beta TrCP gene, the pre-denaturation is carried out for 15s at 98 ℃, then 10s at 98 ℃, 15s at 58 ℃, 60s at 72 ℃ and 28 cycles, the CypAcDNA plasmid is used as a template, B3 and B4 are used as primers to amplify the CypA part, and the amplification conditions are as follows: pre-denaturation at 98 ℃ for 15s, further 10s at 98 ℃, 15s at 58 ℃ and further 30s at 72 ℃ for 28 cycles.
In the third step, B1 and B4 are used as primers for PCR amplification of a fusion gene beta TrCP-CypA, and the amplification conditions are as follows: pre-denaturation at 98 ℃ for 15s, further 98 ℃ 10s, 58 ℃ 15s, further 72 ℃ 90s, 30 cycles.
The beneficial effects are that:
current therapies such as HAART against HIV-1 have significantly reduced the incidence and mortality of aids. However, because only HIV-1 replication can be inhibited, viruses infected in cells cannot be eliminated, so that long-term uninterrupted medication is needed, and the phenomenon of virus rebound occurs once the medication is stopped; the invention solves the technical problem, and the constructed fusion gene betaTrCP-CypA can degrade HIV-1Gag so as to inhibit the assembly of HIV-1 virus or degrade Gag in HIV-1, thereby achieving the effect of inhibiting HIV-1.
Drawings
FIG. 1 is a schematic view of a pcDNA3.1mycis (-) (abbreviated as pcDNA3.1His) vector;
FIG. 2 pSPA X2 vector containing the HIV-1Gag gene;
FIG. 3 is a PCR amplification chart of constructing beta TrCP-N-terminal and C-terminal CypA by using the beta TrCP-CYPA fusion gene; wherein, M is DL2000 Marker, 1, represents the amplification of the C-terminal CypA gene of the beta TrCP-CYPA fusion gene, and 2 represents the amplification map of the beta TrCP-N-terminal gene;
FIG. 4 shows PCR amplification of beta TrCP-CypA gene 1: PCR amplification product map of beta TrCP-CypA gene M: DL2000 DNA molecular weight standard;
FIG. 5 PCR amplification of CypA constructed from pcDNA3.1his/CYPA gene, M DL2000 Marker, 1. amplification of CypA gene;
FIG. 6 Westernblotting identification chart of expression of pcDNA3.1his/betaTrCP-CypA and pcDNA3.1his/CypA, NC: empty vector group, 1: pcDNA3.1his/betaTrCP-CypA, 2: pcDNA3.1his/CypA;
FIG. 7 Western blot analysis degradation analysis of HIV-1Gag by betaTrCP-CypA, 2. mu.g of pcDNA3.1his/betaTrCP-CypA plasmid, 2. mu.g of pSPA X20.4. mu.g, 2.CypA control group transfected pcDNA3.1his/CypA 2. mu.g, 0.4. mu.g of pSPA X2 plasmid, 3. control group transfected pcDNA3.1his 2. mu.g, 0.4. mu.g of pSPA X2 plasmid;
FIG. 8 is a graph of the inhibition rate of betaTrCP-CypA against HIV-1 studied by ELISA;
FIG. 9 luciferase Activity method study of the effect of betaTrCP-CypA on the inhibition of HIV-1, pcDNA3.1his: control group pcDNA3.1/His group CypA pcDNA3.1His/CypA group, beta TrCP-CypA group D: 293t cell control group.
Detailed Description
The construction method of the fusion gene beta TrCP-CypA with the function of inhibiting HIV-1 comprises the following steps:
(1) construction of fusion gene of beta TrCP-CypA for inhibiting HIV-1: the N-terminal sequence of the beta TrCP gene is optimized by using DNASTAR and the like. After optimization, the optimized primers are synthesized by Shanghai Bioengineering company, after optimization, Premier5.0 software is used for designing primers, the part of the beta TrCPN is amplified, CypA is amplified by taking CypAcDNA plasmid as a template, after purification, 1 mu L is taken as a template, beta TrCP-CypA fusion genes are amplified by outside primer PCR, and after double enzyme digestion, the beta TrCP-CypA fusion genes are cloned into a pcDNA3.1his vector. The DNA fragment was confirmed by Shanghai bioscience sequencing.
(2) Western blot detection of expression of beta TrCP-CypA and CypA recombinant proteins, 293T cells were cultured and EnTranster was usedTMD4000 transfection reagent pcDNA3.1his/betaTrCP-CypA or pcDNA3.1his/CypA 2. mu.g (EnTranster)TMD4000 and plasmid ratio of 3: 1) were transferred to each well, and 293T cells were transfected with pcDNA3.1his empty vector as a control. After 48h, the cells were collected and detected by Western blot.
(3) Degradation assay of HIV-1Gag by beta TrCP-CypA 293T cells were seeded into six-well plates one day before transfection with plasmid pSPA X2Co-transfected with pcDNA3.1his/betaTrCP-CypA and plasmid pcDNA3.1his. Experiment was divided into 3 groups:
experimental group pSPAX20.4 mug and pcDNA3.1his/betaTrCP-CypA2 mug;
CypA control group pSPA X20.4 mug and pcDNA3.1/CypA2 mug,
control group pSPA X20.4 mug and pcDNA3.1his2 mug, collecting cells after 48 hours of transfection, absorbing culture solution, washing 1 time with 1 mL precooled PBS, absorbing PBS, cracking the cells with IP and Western cell lysate in Byunyan, adding PMSF into the lysate to enable the final concentration of PMSF to be 1mM, taking 100 muL of cell lysate and the harvested cells to be mixed uniformly, centrifuging at 4 ℃ for 12000 r/min for 30 min, collecting supernatant, detecting protein with a Western blot after protein quantification by a BCA protein concentration determination kit, simultaneously using an internal reference of β -actin, transferring the protein to a PVDF membrane after 12% SDS-PAGE, sealing, adding HIV-1p24 monoclonal antibody and β -actin monoclonal antibody after 5% skim milk sealing h, incubating with a goat anti-mouse secondary antibody coupled with HRP after membrane washing, and carrying out L color development after membrane washing for 2 hours at room temperature
(4) Research on inhibition of HIV-1 by beta TrCP-CypA through ELISA method
293t cells were cultured at 4 xl 0 per well3The individual cells were seeded in a 96-well plate,the experiment was divided into 4 groups: (1) the beta TrCP-CypA group pcDNA3.1His/beta TrCP-CypA0.15 mug and the HIV-1 skeleton plasmid pNL43 Luc-R-E-0.05 mug; (2) the CypA group pcDNA3.1His/CypA0.15 mug, HIV-1 skeleton plasmid pNL43Luc R-E-0.05 mug; (3) a control group pcDNA3.1/His0.15 mug, an HIV-1 skeleton plasmid pNL43 Luc-R-E-0.05 mug, and (4) a 293t cell control group. The next day, EntransterTMTransferring the-D-4000 and the plasmid into each hole according to the ratio of 3: 1, changing the liquid after 6h, and continuously culturing for 24-48 h. After 48h, the supernatant was assayed for p24 concentration. The cells were left to lyse before luciferase activity was detected.
(5) And (4) adding 100 muL of reporter gene cell lysate into the cells in the step (4) to crack the cells (using a firefly luciferase reporter gene detection kit on the Biyun day). Add 100. mu.l luciferase assay reagent, gun homogenize or mix by other suitable means, and then measure RLU (relative light unit). Fluorescence values were determined using reporter cell lysates as a blank control, and the higher the fluorescence value the higher the level of HIV-1 replication, which ratio reflects the level of HIV-1 replication by comparison with the fluorescence value of uninfected HIV-1 cells.
Relevant examples of experiments
Experimental example 1
pcDNA3.1his/beta TrCP-CypA construction based on the N-terminal sequence of human beta TrCP gene (GenBank accession number: NM-003939), the N-terminal sequence of beta TrCP gene was optimized using DNASTAR etc. After optimization, the primer is synthesized by Shanghai Bioengineering company, Premier5.0 software is used for designing primers, B1 and B2 are used as primers for amplifying betaTrCPN end parts, and a PrimeSTAR HS DNA polymerase enzyme system and the like is added to 50 mu l. The amplification conditions were: pre-denaturation at 98 ℃ for 15s, further 98 ℃ 10s, 58 ℃ 15s, further 72 ℃ 60s, 28 cycles, amplification of CypA part by taking CypAcDNA plasmid as template and B3 and B4 as primers, and addition of PrimeSTAR HS DNA polymerase enzyme and the like to 50 μ l system. The amplification conditions were: pre-denaturation at 98 ℃ for 15s, pre-denaturation at 98 ℃ for 10s, pre-denaturation at 58 ℃ for 15s, re-denaturation at 72 ℃, for 30s, and for 28 cycles, respectively amplifying target bands with sizes of about 800bp and 500bp as shown in FIG. 3, respectively taking 1 muL as a template, performing PCR amplification on a beta TrCP-CypA fusion gene by taking B1' and B4 as primers, pre-denaturation at 98 ℃ for 15s, re-denaturation at 98 ℃ for 10s, pre-denaturation at 58 ℃ for 15s, re-denaturation at 72 ℃ for 90s, and for 30 cycles, amplifyingThe target band is increased, and the size is about 1300bp, as shown in FIG. 4EcorII/BamHI the PCR product and pcDNA3.1his vector are cloned into pcDNA3.1his vector. The DNA fragment was confirmed by Shanghai bioscience sequencing.
Constructing a system of pcDNA3.1his/CypA, amplifying CypA gene by using PUC/CypA as a template and C1 and B4 as primers, and adding PrimeSTAR HS DNA polymerase enzyme and the like to 50 mu l. The amplification conditions were: pre-denaturation at 98 ℃ for 15s, further 98 ℃ for 10s, further 58 ℃ for 15s, further 72 ℃ for 30s, and 30 cycles, the results are shown in FIG. 5, usingEcorI/BamHI the PCR product and pcDNA3.1his vector are cloned into pcDNA3.1his vector. The DNA fragment was confirmed by Shanghai bioscience sequencing.
Experimental example 2
Western blot detection of expression of beta TrCP-CypA and CypA recombinant proteins
293T cells were cultured, and the day before transfection, the 293T cells were cultured at 1X 106The density of each well is laid on a 6-well plate for culture. On day 2, Entranster was usedTM2 mug of each of pcDNA3.1his/betaTrCP-CypA and pcDNA3.1his/CypA (the ratio is 3: 1) is respectively transferred into each hole by a D4000 transfection reagent, and 293T cells are transfected by empty vectors of pcDNA3.1his as controls. Fresh medium was changed on day 2 after transfection, and cells were harvested 48h later to extract total cell protein. And (3) carrying out protein quantification by using a BCA protein concentration determination kit, and then detecting by using Western blot. After the protein is transferred to a PVDF membrane after 12 percent SDS-PAGE, the protein is sealed, then a His-tag monoclonal antibody (pcDNA3.1his/betaTrCP-CypA and pcDNA3.1hisCypA contain His labels) is respectively added for incubation, and then goat anti-mouse IgG marked by HRP is added for incubation and membrane washing, and then a chemiluminescence kit is used for developing. Western blot results show that specific reaction bands appear at the relative molecular masses of about 52kD and 21kD of the beta TrCP-CypA proteins, while the bands are not seen in the 293T cell protein of the control group (see FIG. 6).
Experimental example 3
Degradation assay of HIV-1Gag by beta TrCP-CypA 293T cells were seeded into six-well plates one day before transfection with plasmid pSPA X2Co-transfected with pcDNA3.1his/betaTrCP-CypA and plasmid pcDNA3.1his. Reference EntransTMInstructions for D4000 transfection reagents. Experiment was divided into 3 groups: (1) experimental group pSPA X20.4 mug and pcDNA3.1his/betaTrCP-CypA2 mug; (2) CypA control group pSPA X20.4 mug and pcDNA3.1/CypA2 mug, (3) control group pSPA X20.4 mug and pcDNA3.1his2 mug, collecting cells after 48 hours of transfection, sucking out culture solution, washing 1 time with 1 mL precooled PBS, sucking out PBS, cracking the cells with IP and Western cell lysis solution on Biyun days, adding PMSF into the lysis solution to enable the final concentration of PMSF to be 1mmol/L, uniformly mixing 100 muL of cell lysis solution with the harvested cells, centrifuging at 4 ℃ at 12000 r/min for 30 min, collecting supernatant, carrying out protein quantification by using a BCA protein concentration determination kit, detecting by Western blot, simultaneously using an internal reference of β -actin as a control, transferring the protein to a PVDF membrane after 12% SDS-PAGE, sealing, adding HIV-1p24 monoclonal antibody and β -actin monoclonal antibody respectively after 5% skim milk is sealed for h, incubating after membrane washing, adding HRP anti-rat, carrying out room temperature incubation for 2 hours, and carrying out ECL color development after membrane washing.
Western blot analysis shows that the amount of HIV-1Gag protein is obviously reduced in the experimental group transfected with beta TrCP-Cypa (see figure 7), which indicates that the beta TrCP-CypA can actually reduce the stability of HIV-1 Gag. CypA appears to have some protective effect on HIV-1Gag (band increase).
Experimental example 4
Research on inhibition of HIV-1 by beta TrCP-CypA through ELISA method
293t cells were cultured at 4 xl 0 per well3Individual cells were seeded in 96-well plates and experiments were divided into 4 groups: (1) the beta TrCP-CypA group pcDNA3.1His/beta TrCP-CypA0.15 μ g, HIV-1 framework plasmid pNL43 Luc-R-E- (pNL43 Luc R-E- (obtained from the National Institutes of Health (NIH) AIDS Research and Reference regent program) 0.05 μ g, (2) the CypA group pcDNA3.1His/CypA0.15 μ g, HIV-1 framework plasmid pNL43Luc R-E-0.05 μ g, (3) the control group pcDNA3.1/His0.15 μ g, HIV-1 framework plasmid pNL43 Luc-R-E-0.05 μ g, (4) the 293t cell group, each group having 3 multiple wells, and the Entrans on the next dayTMTransferring the EntransTM-D-4000 and the plasmid into each hole according to the proportion of 3: 1 by using a-D4000 transfection reagent, changing the liquid after 6 hours, and continuously culturing for 24-48 hours. After 48h, the supernatant was assayed for p24 concentration. The cells were left to lyse before luciferase activity was detected. The method comprises the following specific steps:
1) experimental design: the coated plate is removed from the sealed bag and the microporous plate strips are placed on the plate frame according to the required number. Blank 2 wells and 2 replicates of HIV-1 calibrator A, B, C, D, E at different concentrations were set.
2) Addition of conjugate 1: add 125. mu.L of conjugate per well.
3) Sample addition: the sample and calibrator were added in an amount of 75. mu.L each.
4) Incubating: fully oscillating and mixing uniformly by using a micro oscillator, covering a reaction plate by using a sealing plate film, and incubating for 60 minutes at 37 ℃;
5) washing the plate: and taking out the microporous plate, sucking all liquid in the microporous plate, adding 400 mu L of diluted washing solution into each hole, soaking for at least 10 seconds, and sucking to dry. Thus washing the board
And then, finally, patting dry on clean absorbent paper.
6) Adding an enzyme: with the exception of blank wells, 2100. mu.L of conjugate was added per well.
7) Incubating: the reaction plate was covered with a new sealing plate and incubated at 37 ℃ for 30 minutes.
8) Washing the plate: the microplate was removed, washed 5 times as above and finally patted dry on clean absorbent paper.
9) Adding a substrate solution: 50. mu.L (or 1 drop) of the substrate color developing solution A was added to each well, and 50. mu.L (or 1 drop) of the substrate color developing solution B was added thereto.
10) Incubating: fully oscillating and mixing uniformly by using a micro oscillator, covering a reaction plate by using a sealing plate film, and incubating for 15 minutes at 37 ℃;
11) adding a stop solution: add 50. mu.L of stop buffer (or 1 drop) to each well and mix by gentle shaking.
12) Reading: setting the wavelength of the microplate reader at 450nm, adjusting the zero point by using a blank hole, and then measuring the A value of each hole.
And taking the average value of the light absorption values of the HIV-1 standard substance as a vertical axis and the average value of the concentration of the HIV-1 standard substance as a horizontal axis to draw a standard curve.
The measured absorbance of the sample was used to determine the concentration of HIV-1p24 in the sample on the standard curve.
Inhibition was calculated as (pcDNA3, 1his group concentration-experimental group p24 concentration)/pcDNA 3,1his group p24 concentration × 100%.
As a result, the beta TrCP-CypA embodies a better inhibition effect, and the inhibition effect reaches more than 70%. The beta TrCP-CypA has good anti-HIV-1 activity. The inhibition rate of the CypA group is probably due to the fact that CypA inhibits the secretion of p24, and the intracellular p24 is increased (see figure 8).
Experimental example 5
Study on inhibition of HIV-1 by luciferase Activity beta TrCP-CypA
100 μ L of reporter gene cell lysate was added to the cells in 5 above to lyse the cells (using the firefly luciferase reporter detection kit on Biyuntian). Add 100 μ L luciferase detection reagent, use the gun to beat evenly or with other appropriate way after mixing to determine RLU (relative light unit). Fluorescence values were determined using reporter cell lysates as a blank control, and the higher the fluorescence value the higher the level of HIV-1 replication, which ratio reflects the level of HIV replication by comparison with the fluorescence value of uninfected HIV-1 cells. As a result, beta TrCP-CypA shows a better inhibition effect (see figure 9), which indicates that beta TrCP-CypA has good anti-HIV-1 activity.
SEQUENCE LISTING
<110> university of Henan science and technology
<120> fusion gene beta TrCP-CypA with HIV-1 inhibiting effect and construction method thereof
<130>1
<160>9
<170>PatentIn version 3.3
<210>1
<211>1293
<212>DNA
<213> human
<400>1
atggacccag cagaagcagt gcttcaggag aaggctctca agtttatgaa ctcctccgag 60
agggaggact gcaacaacgg cgagcctcct aggaagatca tcccagagaa gaactccctg 120
cgccagacct acaacagctg tgcccgcctt tgccttaacc aggagaccgt ctgtttggct 180
tcaaccgcta tgaagaccga gaactgcgtg gccaagacaa agctcgccaa cggaactagc 240
tccatgatcg tgcctaagca gagaaagctc agcgcctctt acgagaagga gaaggaactg 300
tgcgtcaagt acttcgagca gtggagcgag agcgaccagg tggagttcgt ggagcacttg 360
atctcccaga tgtgccacta ccagcacgga cacatcaact cctacctcaa gcctatgctc 420
cagagggact tcatcactgc cctgccagct agagggttgg accatatcgc cgaaaacatc 480
ctgagctacc tggatgccaa gagcctgtgc gctgcagaat tggtgtgcaa agagtggtac 540
agagtcacaa gcgatggcat gctgtggaag aaactgattg agcggatggt caggacagat 600
tctctgtgga ggggactggc cgagagaaga ggatgggggc aatatctgtt taagaacaag 660
ccacctgatg ggaatgctcc acctaacagt ttctacagag ccctgtaccc caagattatt 720
caggatattg agacaattga gtcaaactgg agatgcggaa gacacagtgg ctcaggatca 780
ggctcaggat caggctcaat ggtcaacccc accgtgttct tcgacattgc cgtcgacggc 840
gagcccttgg gccgcgtctc ctttgagctg tttgcagaca aggtcccaaa gacagcagaa 900
aattttcgtg ctctgagcac tggagagaaa ggatttggtt ataagggttc ctgctttcac 960
agaattattc cagggtttat gtgtcagggt ggtgacttca cacgccataa tggcactggt 1020
ggcaagtcca tctatgggga gaaatttgaa gatgagaact tcatcctaaa gcatacgggt 1080
cctggcatct tgtccatggc aaatgctgga cccaacacaa atggttccca gtttttcatc 1140
tgcactgcca agactgagtg gttggatggc aagcatgtgg tgtttggcaa agtgaaagaa 1200
ggcatgaata ttgtggaggc catggagcgc tttgggtcca ggaatggcaa gaccagcaag 1260
aagatcacca ttgctgactg tggacaactc gaa 1293
<210>2
<211>798
<212>DNA
<213> human
<400>2
atggacccag cagaagcagt gcttcaggag aaggctctca agtttatgaa ctcctccgag 60
agggaggact gcaacaacgg cgagcctcct aggaagatca tcccagagaa gaactccctg 120
cgccagacct acaacagctg tgcccgcctt tgccttaacc aggagaccgt ctgtttggct 180
tcaaccgcta tgaagaccga gaactgcgtg gccaagacaa agctcgccaa cggaactagc 240
tccatgatcg tgcctaagca gagaaagctc agcgcctctt acgagaagga gaaggaactg 300
tgcgtcaagt acttcgagca gtggagcgag agcgaccagg tggagttcgt ggagcacttg 360
atctcccaga tgtgccacta ccagcacgga cacatcaact cctacctcaa gcctatgctc 420
cagagggact tcatcactgc cctgccagct agagggttgg accatatcgc cgaaaacatc 480
ctgagctacc tggatgccaa gagcctgtgc gctgcagaat tggtgtgcaa agagtggtac 540
agagtcacaa gcgatggcat gctgtggaag aaactgattg agcggatggt caggacagat 600
tctctgtgga ggggactggc cgagagaaga ggatgggggc aatatctgtt taagaacaag 660
ccacctgatg ggaatgctcc acctaacagt ttctacagag ccctgtaccc caagattatt 720
caggatattg agacaattga gtcaaactgg agatgcggaa gacacagtgg ctcaggatca 780
ggctcaggat caggctca 798
<210>3
<211>498
<212>DNA
<213> human
<400>3
atggtcaacc ccaccgtgtt cttcgacatt gccgtcgacg gcgagccctt gggccgcgtc 60
tcctttgagc tgtttgcaga caaggtccca aagacagcag aaaattttcg tgctctgagc 120
actggagaga aaggatttgg ttataagggt tcctgctttc acagaattat tccagggttt 180
atgtgtcagg gtggtgactt cacacgccat aatggcactg gtggcaagtc catctatggg 240
gagaaatttg aagatgagaa cttcatccta aagcatacgg gtcctggcat cttgtccatg 300
gcaaatgctg gacccaacac aaatggttcc cagtttttca tctgcactgc caagactgag 360
tggttggatg gcaagcatgt ggtgtttggc aaagtgaaag aaggcatgaa tattgtggag 420
gccatggagc gctttgggtc caggaatggc aagaccagca agaagatcac cattgctgac 480
tgtggacaac tcgaataa 498
<210>4
<211>34
<212>DNA
<213> Artificial sequence
<400>4
ggaattcgcc accatggacc cagcagaagc agtg 34
<210>5
<211>22
<212>DNA
<213> Artificial sequence
<400>5
tgagcctgat cctgagcctg at 22
<210>6
<211>74
<212>DNA
<213> Artificial sequence
<400>6
ctggagatgc ggaagacaca gtggctcagg atcaggctca ggatcaggct caatggtcaa 60
ccccaccgtg ttct 74
<210>7
<211>43
<212>DNA
<213> Artificial sequence
<400>7
atcaggctca ggatcaggct caatggtcaa ccccaccgtg ttc 43
<210>8
<211>30
<212>DNA
<213> Artificial sequence
<400>8
cgggatcctt cgagttgtcc acagtcagca 30
<210>9
<211>34
<212>DNA
<213> Artificial sequence
<400>9
ggaattcgcc accatggtca accccaccgt gttc 34
Claims (1)
1. The application of a fusion gene beta TrCP-CypA in preparing an HIV-1 virus inhibitor is disclosed, wherein the gene sequence of the fusion gene beta TrCP-CypA is shown as SEQ ID NO: 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710055996.XA CN106967739B (en) | 2017-01-25 | 2017-01-25 | Fusion gene beta TrCP-CypA with HIV-1 inhibiting effect and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710055996.XA CN106967739B (en) | 2017-01-25 | 2017-01-25 | Fusion gene beta TrCP-CypA with HIV-1 inhibiting effect and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106967739A CN106967739A (en) | 2017-07-21 |
| CN106967739B true CN106967739B (en) | 2020-05-05 |
Family
ID=59334836
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710055996.XA Active CN106967739B (en) | 2017-01-25 | 2017-01-25 | Fusion gene beta TrCP-CypA with HIV-1 inhibiting effect and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106967739B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006014422A2 (en) * | 2004-07-06 | 2006-02-09 | The Trustees Of Columbia University In The City Of New York | Polynucleotide encoding a trim-cyp polypeptide, compositions thereof, and methods of using same |
| EP1981333A2 (en) * | 2006-02-03 | 2008-10-22 | Nelson M. Karp | Animal model for hiv induced disease |
| WO2010054141A2 (en) * | 2008-11-06 | 2010-05-14 | The Trustees Of Columbia University In The City Of New York | Polynucleotides encoding a human trim-cyp fusion polypeptide, compositions thereof, and methods of using same |
| CN103656675A (en) * | 2012-09-07 | 2014-03-26 | 中国疾病预防控制中心性病艾滋病预防控制中心 | DNA (Deoxyribonucleic Acid) vaccine based on CyPA (Cyclophilin A) and Gag (Glycosaminoglycan) |
-
2017
- 2017-01-25 CN CN201710055996.XA patent/CN106967739B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006014422A2 (en) * | 2004-07-06 | 2006-02-09 | The Trustees Of Columbia University In The City Of New York | Polynucleotide encoding a trim-cyp polypeptide, compositions thereof, and methods of using same |
| EP1981333A2 (en) * | 2006-02-03 | 2008-10-22 | Nelson M. Karp | Animal model for hiv induced disease |
| WO2010054141A2 (en) * | 2008-11-06 | 2010-05-14 | The Trustees Of Columbia University In The City Of New York | Polynucleotides encoding a human trim-cyp fusion polypeptide, compositions thereof, and methods of using same |
| CN103656675A (en) * | 2012-09-07 | 2014-03-26 | 中国疾病预防控制中心性病艾滋病预防控制中心 | DNA (Deoxyribonucleic Acid) vaccine based on CyPA (Cyclophilin A) and Gag (Glycosaminoglycan) |
Non-Patent Citations (3)
| Title |
|---|
| High Frequency of Alternative Splicing of Human Genes Participating in the HIV-1 Life Cycle: A Model Using TSG101, βTrCP, PPIA, INI1, NAF1, and PML;Manuel Favre等;《JAIDS JOURNAL OF ACQUIRED IMMUNE DEFICIENCY SYNDROMES》;20031001;第34卷(第2期);第127-133 * |
| 优化重叠延伸PCＲ 条件构建BTRCP-CypA融合基因;孟祥平等;《生物技术》;20131215;第23卷(第6期);第51页摘要部分、第52-53页第1.3.1小和表1、第53页第2.1节 * |
| 密码子优化BTRCP-CypA融合基因的PCR 合成;孟祥平等;《基因组学与应用生物学》;20171125;第36卷(第11期);第4445-4450页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106967739A (en) | 2017-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Patel et al. | Intradermal-delivered DNA vaccine provides anamnestic protection in a rhesus macaque SARS-CoV-2 challenge model | |
| Pal et al. | Immunization of rhesus macaques with a polyvalent DNA prime/protein boost human immunodeficiency virus type 1 vaccine elicits protective antibody response against simian human immunodeficiency virus of R5 phenotype | |
| JP6971492B2 (en) | HIV preimmunization and immunotherapy | |
| Guillaume et al. | Nipah virus: vaccination and passive protection studies in a hamster model | |
| Larder et al. | Infectious potential of human immunodeficiency virus type 1 reverse transcriptase mutants with altered inhibitor sensitivity. | |
| US20210121561A1 (en) | Methods of producing cells resistant to hiv infection | |
| ES2639568T3 (en) | Method to design a drug regimen for HIV-infected patients | |
| CN107190013B (en) | Zika virus vaccine taking human Ad5 replication-defective adenovirus as vector | |
| Lévy et al. | Lentiviral vectors displaying modified measles virus gp overcome pre-existing immunity in in vivo-like transduction of human T and B cells | |
| Qiu et al. | Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions | |
| Luo et al. | Adenovirus E4orf6 assembles with Cullin5‐ElonginB‐ElonginC E3 ubiquitin ligase through an HIV/SIV Vif‐like BC‐box to regulate p53 | |
| JP2020515234A (en) | HIV immunotherapy without a prior immunization step | |
| Zemba et al. | Construction of infectious feline foamy virus genomes: cat antisera do not cross-neutralize feline foamy virus chimera with serotype-specific Env sequences | |
| Pérez et al. | A single dose of an MVA vaccine expressing a prefusion-stabilized SARS-CoV-2 spike protein neutralizes variants of concern and protects mice from a lethal SARS-CoV-2 infection | |
| CN111607571B (en) | Replicative oncolytic adenovirus for specifically activating immune co-stimulation pathway and preparation method and application thereof | |
| CN113384700B (en) | Target LY6E capable of effectively inhibiting Ebola virus infection and application thereof | |
| Wu et al. | A pan-coronavirus peptide inhibitor prevents SARS-CoV-2 infection in mice by intranasal delivery | |
| CN106701687B (en) | Hybridoma cell strain and rabies virus phosphoprotein monoclonal antibody generated by same | |
| Carr et al. | Isolation of a simian immunodeficiency virus from a malbrouck (Chlorocebus cynosuros) | |
| CN106967739B (en) | Fusion gene beta TrCP-CypA with HIV-1 inhibiting effect and construction method thereof | |
| CN101353667B (en) | HIV stain drug-resistant phenotype analytical cell model and special pseudotype lentivirus therefor | |
| CN101792491B (en) | Recombinant adenovirus HIV vaccine based on multipleseries epi-position and preparation method thereof | |
| Li et al. | Booster vaccination is required to elicit and maintain COVID-19 vaccine-induced immunity in SIV-infected macaques | |
| WO2013127300A1 (en) | Polypeptide for use in inhibiting hiv, pharmaceutical composition of the polypeptide, and use thereof | |
| CN106701692B (en) | Recombinant adeno-associated virus capable of expressing HIV-1 invasion inhibitor ECLD to inhibit HIV-1 infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |