CN106967706B - A kind of Taq polymerase freeze drying protectant - Google Patents
A kind of Taq polymerase freeze drying protectant Download PDFInfo
- Publication number
- CN106967706B CN106967706B CN201710377774.XA CN201710377774A CN106967706B CN 106967706 B CN106967706 B CN 106967706B CN 201710377774 A CN201710377774 A CN 201710377774A CN 106967706 B CN106967706 B CN 106967706B
- Authority
- CN
- China
- Prior art keywords
- taq polymerase
- freeze
- taq
- freeze drying
- drying protectant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/96—Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention provides a kind of Taq polymerase freeze drying protectants, in terms of 100ml Taq polymerase freeze drying protectant, are added after 1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches in the mixed solution of 85ml Taq polymerase buffer and 15ml glycerol to obtain the final product.Taq polymerase freeze drying protectant of the invention allows Taq polymerase to carry out effective freezing dry process.After the Taq polymerase freeze-drying for adding freeze drying protectant, PCR experiment, remnant enzyme activity 70% can still provide for.And Taq polymer enzyme freeze-dried powder can be stored in 4 DEG C of refrigerators, convenient for storage and transport.Taq polymer enzyme freeze-dried powder stability is good.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of Taq polymerase freeze drying protectant.
Background technique
Taq polymerase is isolated from thermus aquaticus Thermus Aquaticus (Taq) with thermal stability
Archaeal dna polymerase.It is frequently used for polymerase chain reaction (PCR), this is a kind of method of DNA amplification short-movie segment number.97.5
The half-life period of DEG C Taq enzyme only has 9 minutes.And in low temperature environment, the activity of Taq enzyme will be greatly reduced, thus make Increased Plasma Half-life,
Increase the holding time.Therefore, Taq polymerase -20 DEG C of preservations, this method can effectively can save in enzyme storage buffer
Taq polymerase enzymatic activity.But enzyme storage buffer is lost in the enzyme activity that refrigerating process and course of defrosting will cause Taq polymerase.
Vacuum freeze drying is referred to as lyophilized, and is to freeze wet stock or solution under lower temperature (- 10 DEG C~-50 DEG C)
Form solid-state, then so that moisture therein is directly sublimed into gaseous state without liquid under vacuum (1.3~13 pa), finally make material
The dry technology of dehydration.And Taq polymerase is during the freeze-drying process due to cryogenic effect, freezing effect and Dehydration meeting
The denaturation for leading to its active component reduces Taq polymerase residual activity and even inactivates.
Summary of the invention
In view of this, matching according to the following steps the purpose of the present invention is to provide a kind of Taq polymerase freeze drying protectant
System:
In terms of 100ml Taq polymerase freeze drying protectant, in the mixing of 85ml Taq polymerase buffer and 15ml glycerol
In solution be added 1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches to get.
Preferably, in Taq polymerase freeze drying protectant of the present invention, the Taq polymerase buffer is Tris-
HCl buffer (PH 8.0).
Preferably, in Taq polymerase freeze drying protectant of the present invention, the Taq polymerase freeze drying protectant makes
It is that Taq polymerase freeze drying protectant is added in Taq polymerase enzyme solution with method；The Taq polymerase frozen-dried protective of the addition
The weight ratio of agent and Taq polymerase is 1:1.
Another object of the present invention is to provide the methods that a kind of freeze-drying of Taq polymerase saves, comprising the following steps:
1) it, extracts and obtains Taq enzyme liquid；
2) Taq polymerase freeze drying protectant, is added in Taq enzyme liquid；
3), with pre-freezing temperature for -20 DEG C, pre-freeze 12 hours；
4), pre-freeze is placed on freeze-drying about 14 hours~16 hours in vacuum freeze drier, and it is thick to obtain white powder
Enzyme, -20 DEG C of preservations.
Preferably, in the method that Taq polymerase freeze-drying of the present invention saves, the Taq polymerase freeze drying protectant
To prepare according to the following steps:
In terms of 100ml Taq polymerase freeze drying protectant, 1 is added in 85ml Taq polymerase buffer, 15ml glycerol
Gram mannitol, 1 gram of glucose, 2 grams of soluble starches to get.
Preferably, in the method that Taq polymerase freeze-drying of the present invention saves, the Taq polymerase buffer is
Tris-HCl buffer (PH 8.0).
Preferably, in the method that Taq polymerase freeze-drying of the present invention saves, the Taq polymerase freeze drying protectant
Proportion with Taq polymerase is 1:1.
Preferably, in the method that Taq polymerase freeze-drying of the present invention saves, the unit volume of the Taq polymerase
Unit of activity be 2.5U/ μ l.
By subsequent embodiment upper and of the present invention as it can be seen that advantages of the present invention at least that:
1), Taq polymerase freeze drying protectant of the invention allows Taq polymerase to carry out effective freezing dry process.
After the Taq polymerase freeze-drying for adding freeze drying protectant, PCR experiment, remnant enzyme activity 70% can still provide for.
2), Taq polymer enzyme freeze-dried powder can be stored in 4 DEG C of refrigerators, convenient for storage and transport.Taq polymer enzyme freeze-dried powder
Stability is good.
Specific embodiment
In one embodiment of the invention, a kind of Taq polymerase freeze drying protectant is provided, the Taq polymerase freezes
Dry protective agent is to prepare according to the following steps:
In terms of 100ml Taq polymerase freeze drying protectant, in the mixing of 85ml Taq polymerase buffer and 15ml glycerol
In solution be added 1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches to get.
Preferably, in another embodiment of the present invention, the Taq polymerase buffer is Tris-HCl buffer
(PH 8.0)。
Preferably, in another embodiment of the present invention, the application method of the Taq polymerase freeze drying protectant be
Taq polymerase freeze drying protectant is added in Taq polymerase enzyme solution；The Taq polymerase freeze drying protectant of the addition polymerize with Taq
The weight ratio of enzyme is 1:1.
In yet another embodiment of the present invention, a kind of method that Taq polymerase freeze-drying saves is additionally provided, including following
Step:
1) it, extracts and obtains Taq enzyme liquid；
2) Taq polymerase freeze drying protectant, is added in Taq enzyme liquid；
3), with pre-freezing temperature for -20 DEG C, pre-freeze 12 hours；
4), pre-freeze is placed on freeze-drying about 14 hours~16 hours in vacuum freeze drier, and it is thick to obtain white powder
Enzyme, -20 DEG C of preservations.
Preferably, in the method that Taq polymerase freeze-drying of the present invention saves, the Taq polymerase freeze drying protectant
To prepare according to the following steps:
In terms of 100ml Taq polymerase freeze drying protectant, 1 is added in 85ml Taq polymerase buffer, 15ml glycerol
Gram mannitol, 1 gram of glucose, 2 grams of soluble starches to get.
Preferably, in another embodiment of the present invention, the Taq polymerase buffer is Tris-HCl buffer
(PH 8.0)。
Preferably, in another embodiment of the present invention, the Taq polymerase freeze drying protectant and Taq polymerase
Proportion is 1:1 weight ratio.
Preferably, in another embodiment of the present invention, the unit of activity of the unit volume of the Taq polymerase is
2.5U/μl。
Below in conjunction with the embodiment in the present invention, the technical solution in the present invention is clearly and completely described.It is aobvious
So, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based on the reality in the present invention
Example is applied, every other embodiment obtained by those of ordinary skill in the art without making creative efforts all belongs to
In the scope of protection of the invention.
Embodiment 1
1, the competent escherichia coli cell BL21 (DE3) of -80 DEG C of preservations is taken out, Suo Laibao company is placed in ice purchased from Beijing
Upper defrosting, pipette are sucked out 50 μ l and move into sterile centrifugation tube.
2,1 μ l of Taq plasmid (Wuhan Chu Ling bioengineering Co., Ltd, pTrc-Taq protease plasmid) is added, gently mixes
Even be placed on stands 30min on ice, and 42 DEG C of water-baths are placed 45 seconds~60 seconds, places 2~3min on ice.
3,500 μ l LB liquid mediums are added in centrifuge tube, mixes gently and is placed on 37 DEG C of shaking table oscillation recovery 1h, revolving speed
60~80rpm.
4, pipette is sucked out 100 μ l coating and draws on the agar plate containing 100 μ g/ml ampicillins, and 37 DEG C are incubated overnight.
5, picking single colonie is inoculated in LB culture medium of the 50mL containing 100 μ g/ml ampicillins, 37 DEG C of 220rpm trainings
It supports overnight.
6, the Escherichia coli for taking 10ml to be incubated overnight are inoculated in LB culture medium of the 1L containing 100 μ g/ml ampicillins,
220rpm 37 DEG C of cultures 6~7h, OD600It is 0.8~1.0,1mmol/l IPTG is added, continues to cultivate 12h.
7,3000rpm, 4 DEG C, centrifugation 10min collects bacterium, discards supernatant.
8, Tris-HCl buffer (PH 8.0) 30ml of the lysozyme containing 4mg/ml is added, is sufficiently resuspended, incubation at room temperature
15min.75 DEG C of water-bath 1h (period shakes up for several times).
9, after said mixture cooled on ice, 12000rpm 4 DEG C, is centrifuged 10min, collects supernatant.
10, supernatant dialysis 12h in 4 DEG C, Tris-HCl buffer (PH 8.0), obtains the thick enzyme of Taq of clear
Liquid.
11,1% mannitol of hybrid protection agent, 1% glucose, 2% soluble starch and 15% are added in Taq crude enzyme liquid
(pre-freezing temperature is -20 DEG C to glycerol pre-freeze；Pre-freeze 12h；Filling liquid thickness is about 5mm).
12, pre-freeze, which is placed in vacuum freeze drier, is freeze-dried about 14~16h, obtains white powder Taq enzyme.
13, Taq enzyme albumen is diluted with Tris-HCl buffer (PH 8.0) 1:1, PCR detection.
PCR reaction system (50 μ l system) is template DNA (SEQ ID NO1) 2 μ l, upstream primer (SEQ ID
NO2ATCACTGCATAATTCGTGTCGCT) 1 μ l, downstream primer (SEQ ID NO3CGATCCCAACCTCCAGAACAT) 1 μ l,
10 × Buffer (contains Mg2+) 5 μ l, dNTP (each 2.5mM) 4 μ l, Taq enzyme 2-3 μ l add ddH2O to 50 μ l.PCR reaction condition is
94 DEG C of temperature of step (1), time 3-5min；(2) 94 DEG C of temperature, time 0.5min；(3) 52 DEG C of temperature, time 0.5min；(4)
72 DEG C of temperature, time 2.5min (about 2.5kb)；(5) 72 DEG C of temperature, time 10min.Step (2) to (4) repeats 25-30 and follows
Ring.10 μ l PCR reaction product agarose gel electrophoresis detect after reaction.Taq polymerase remnant enzyme activity is 70.0%.
Comparative example is not used the Taq enzyme freeze-dried powder of protection liquid, the processing of identical PCR condition, the residual activity of Taq enzyme less than
The 50% of crude enzyme liquid.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Beijing Institute of Technology
<120>a kind of Taq polymerase freeze drying protectant
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 2502
<212> DNA
<213> Thermus Aquaticus
<400> 1
atggaattcg ggatgctgcc cctctttgag cccaagggcc gggtcctcct ggtggacggc 60
caccacctgg cctaccgcac cttccacgcc ctgaagggcc tcaccaccag ccggggggag 120
ccggtgcagg cggtctacgg cttcgccaag agcctcctca aggccctcaa ggaggacggg 180
gacgcggtga tcgtggtctt tgacgccaag gccccctcct tccgccacga ggcctacggg 240
gggtacaagg cgggccgggc ccccacgccg gaggactttc cccggcaact cgccctcatc 300
aaggagctgg tggacctcct ggggctggcg cgcctcgagg tcccgggcta cgaggcggac 360
gacgtcctgg ccagcctggc caagaaggcg gaaaaggagg gctacgaggt ccgcatcctc 420
accgccgaca aagaccttta ccagctcctt tccgaccgca tccacgtcct ccaccccgag 480
gggtacctca tcaccccggc ctggctttgg gaaaagtacg gcctgaggcc cgaccagtgg 540
gccgactacc gggccctgac cggggacgag tccgacaacc ttcccggggt caagggcatc 600
ggggagaaga cggcgaggaa gcttctggag gagtggggga gcctggaagc cctcctcaag 660
aacctggacc ggctgaagcc cgccatccgg gagaagatcc tggcccacat ggacgatctg 720
aagctctcct gggacctggc caaggtgcgc accgacctgc ccctggaggt ggacttcgcc 780
aaaaggcggg agcccgaccg ggagaggctt agggcctttc tggagaggct tgagtttggc 840
agcctcctcc acgagttcgg ccttctggaa agccccaagg ccctggagga ggccccctgg 900
cccccgccgg aaggggcctt cgtgggcttt gtgctttccc gcaaggagcc catgtgggcc 960
gatcttctgg ccctggccgc cgccaggggg ggccgggtcc accgggcccc cgagccttat 1020
aaagccctca gggacctgaa ggaggcgcgg gggcttctcg ccaaagacct gagcgttctg 1080
gccctgaggg aaggccttgg cctcccgccc ggcgacgacc ccatgctcct cgcctacctc 1140
ctggaccctt ccaacaccac ccccgagggg gtggcccggc gctacggcgg ggagtggacg 1200
gaggaggcgg gggagcgggc cgccctttcc gagaggctct tcgccaacct gtgggggagg 1260
cttgaggggg aggagaggct cctttggctt taccgggagg tggagaggcc cctttccgct 1320
gtcctggccc acatggaggc cacgggggtg cgcctggacg tggcctatct cagggccttg 1380
tccctggagg tggccgagga gatcgcccgc ctcgaggccg aggtcttccg cctggccggc 1440
caccccttca acctcaactc ccgggaccag ctggaaaggg tcctctttga cgagctaggg 1500
cttcccgcca tcggcaagac ggagaagacc ggcaagcgct ccaccagcgc cgccgtcctg 1560
gaggccctcc gcgaggccca ccccatcgtg gagaagatcc tgcagtaccg ggagctcacc 1620
aagctgaaga gcacctacat tgaccccttg ccggacctca tccaccccag gacgggccgc 1680
ctccacaccc gcttcaacca gacggccacg gccacgggca ggctaagtag ctccgatccc 1740
aacctccaga acatccccgt ccgcaccccg cttgggcaga ggatccgccg ggccttcatc 1800
gccgaggagg ggtggctatt ggtggccctg gactatagcc agatagagct cagggtgctg 1860
gcccacctct ccggcgacga gaacctgatc cgggtcttcc aggaggggcg ggacatccac 1920
acggagaccg ccagctggat gttcggcgtc ccccgggagg ccgtggaccc cctgatgcgc 1980
cgggcggcca agaccatcaa cttcggggtc ctctacggca tgtcggccca ccgcctctcc 2040
caggagctag ccatccctta cgaggaggcc caggccttca ttgagcgcta ctttcagagc 2100
ttccccaagg tgcgggcctg gattgagaag accctggagg agggcaggag gcgggggtac 2160
gtggagaccc tcttcggccg ccgccgctac gtgccagacc tagaggcccg ggtgaagagc 2220
gtgcgggagg cggccgagcg catggccttc aacatgcccg tccagggcac cgccgccgac 2280
ctcatgaagc tggctatggt gaagctcttc cccaggctgg aggaaatggg ggccaggatg 2340
ctccttcagg tccacgacga gctggtcctc gaggccccaa aagagagggc ggaggccgtg 2400
gcccggctgg ccaaggaggt catggagggg gtgtatcccc tggccgtgcc ccaggaggtg 2460
gaggtgggga taggggagga ctggctctcc gccaaggagt ga 2502
<210> 2
<211> 23
<212> DNA
<213>artificial sequence
<400> 2
atcactgcat aattcgtgtc gct 23
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<400> 3
cgatcccaac ctccagaaca t 21
Claims (2)
1. a kind of Taq polymerase freeze drying protectant, which is characterized in that prepare according to the following steps:
In terms of 100ml Taq polymerase freeze drying protectant, in the mixed solution of 85ml Taq polymerase buffer and 15ml glycerol
1 gram of mannitol of middle addition, 1 gram of glucose, 2 grams of soluble starches to get；
The pH of the Taq polymerase buffer is 8.0；
The application method of the Taq polymerase freeze drying protectant is that Taq polymerase frozen-dried protective is added in Taq polymerase enzyme solution
Agent；The Taq polymerase freeze drying protectant of the addition and the weight ratio of Taq polymerase are 1:1.
2. a kind of method that Taq polymerase freeze-drying saves, comprising the following steps:
1) it, extracts and obtains Taq enzyme liquid；
2) Taq polymerase freeze drying protectant, is added in Taq enzyme liquid；
3), with pre-freezing temperature for -20 DEG C, pre-freeze 12 hours；
4), pre-freeze is placed on freeze-drying 14 hours~16 hours in vacuum freeze drier, obtains the thick enzyme of white powder, and -20
DEG C save；
The Taq polymerase freeze drying protectant is to prepare according to the following steps: in terms of 100ml Taq polymerase freeze drying protectant,
In 85ml Taq polymerase buffer, 15ml glycerol be added 1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches to get；
The Taq polymerase buffer is that the pH of Tris-HCl buffer is 8.0；
The weight ratio of the Taq polymerase freeze drying protectant and Taq polymerase is 1:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710377774.XA CN106967706B (en) | 2017-05-25 | 2017-05-25 | A kind of Taq polymerase freeze drying protectant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710377774.XA CN106967706B (en) | 2017-05-25 | 2017-05-25 | A kind of Taq polymerase freeze drying protectant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106967706A CN106967706A (en) | 2017-07-21 |
| CN106967706B true CN106967706B (en) | 2019-11-12 |
Family
ID=59326689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710377774.XA Expired - Fee Related CN106967706B (en) | 2017-05-25 | 2017-05-25 | A kind of Taq polymerase freeze drying protectant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106967706B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112481253A (en) * | 2019-09-12 | 2021-03-12 | 广东菲鹏生物有限公司 | Freeze-drying protection prescription for PCR premix |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1793330A (en) * | 2005-11-07 | 2006-06-28 | 浙江工商大学 | Process for preparing high actived alctic acid bacteria product |
| CN101066260A (en) * | 2006-11-17 | 2007-11-07 | 姚瑶 | Coenzyme Q10 emulsion and its freeze dried prepn and their prepn process |
| CN105310080A (en) * | 2015-10-26 | 2016-02-10 | 中山大学 | Probiotic microcapsules as well as preparation method and application thereof |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
| CN106511380A (en) * | 2016-10-25 | 2017-03-22 | 重庆市畜牧科学院 | Coprophilous fungus composition and preparation method and purpose thereof |
-
2017
- 2017-05-25 CN CN201710377774.XA patent/CN106967706B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1793330A (en) * | 2005-11-07 | 2006-06-28 | 浙江工商大学 | Process for preparing high actived alctic acid bacteria product |
| CN101066260A (en) * | 2006-11-17 | 2007-11-07 | 姚瑶 | Coenzyme Q10 emulsion and its freeze dried prepn and their prepn process |
| CN105310080A (en) * | 2015-10-26 | 2016-02-10 | 中山大学 | Probiotic microcapsules as well as preparation method and application thereof |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
| CN106511380A (en) * | 2016-10-25 | 2017-03-22 | 重庆市畜牧科学院 | Coprophilous fungus composition and preparation method and purpose thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106967706A (en) | 2017-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nakapong et al. | High expression level of levansucrase from Bacillus licheniformis RN-01 and synthesis of levan nanoparticles | |
| AU732057B2 (en) | Method and formulation for stabilization of enzymes | |
| Uzunova-Doneva et al. | Anabiosis and conservation of microorganisms | |
| EP1303184A1 (en) | Preservation and storage medium for biological materials | |
| AU2001268057A1 (en) | Preservation and storage medium for biological materials | |
| US11649512B2 (en) | Freeze-dried composition | |
| Ulrich et al. | Induction and characterization of β-galactosidase in an extreme thermophile | |
| CN105274192A (en) | Nucleic acid amplification reaction mixture particle and application thereof | |
| JPWO2012020759A1 (en) | Mutant reverse transcriptase | |
| CA2888455C (en) | Inhibition-resistant polymerases | |
| CN106967706B (en) | A kind of Taq polymerase freeze drying protectant | |
| TWI719140B (en) | New polyphosphate-dependent glucokinase and method for preparing glucose 6-phosphate using the same | |
| CN107254428A (en) | A kind of Expression Systems for Lactic Acid Bacteria for expressing antifreeze peptide builds and its applied | |
| WO2014205882A1 (en) | High-fidelity dna polymerase, and preparation and use thereof | |
| Joner et al. | Purification and properties of L-asparaginase A from Acinetobacter calcoaceticus | |
| Sidyakina et al. | Viability and genetic stability of the bacterium Escherichia coli HB101 with the recombinant plasmid during preservation by various methods | |
| CN102206634A (en) | Construction method for DNA molecular cloning quick connection vector, and related DNA molecules thereof | |
| CN109321620A (en) | A kind of albumen synthesis lyophilized preparation and its preparation method and application | |
| KR102063456B1 (en) | Method for improving viability and storage stability by supercooling cold adaptation of lactic acid bacteria | |
| Park et al. | In vitro assembly of thermostable Csm complex in CRISPR–Cas type III/A system | |
| Mohammadipanah et al. | Protective effects of Cryoprotectants and Lyoprotectants on the survival of Persipeptide producing Streptomyces zagrosensis UTMC 1154 | |
| Rumian et al. | Comparative investigations on activity of Lactobacillus bulgaricus during lyophilization | |
| WO1995017415A1 (en) | In vitro phage lambda dna packaging extract | |
| PL229262B1 (en) | Enzyme with high lytic activity in relation to the cells of Enterococcus and method for modification of this gene, allowing the overproduction of the active gene in bacterial cells | |
| Kerjan et al. | Isolation and properties of a cyclic guanosine-monophosphate sensitive intracellular ribonuclease from Bacillus subtilis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191112 Termination date: 20200525 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |