CN106967706A - A kind of Taq polymerase freeze drying protectant - Google Patents
A kind of Taq polymerase freeze drying protectant Download PDFInfo
- Publication number
- CN106967706A CN106967706A CN201710377774.XA CN201710377774A CN106967706A CN 106967706 A CN106967706 A CN 106967706A CN 201710377774 A CN201710377774 A CN 201710377774A CN 106967706 A CN106967706 A CN 106967706A
- Authority
- CN
- China
- Prior art keywords
- taq polymerase
- taq
- freeze
- freeze drying
- drying protectant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/96—Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
Abstract
The invention provides a kind of Taq polymerase freeze drying protectant, in terms of 100ml Taq polymerase freeze drying protectants, produced after adding 1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches in mixed solution of the 85ml Taq polymerases buffer solution with 15ml glycerine.The Taq polymerase freeze drying protectant of the present invention allows Taq polymerase to carry out effective freezing dry process.After the Taq polymerase freeze-drying for adding freeze drying protectant, PCR experiment is can still provide for, its remnant enzyme activity is 70%.And Taq polymer enzyme freeze-dried powders can be stored in 4 DEG C of refrigerators, be easy to store and transport.Taq polymer enzyme freeze-dried powder stability is good.
Description
Technical field
The invention belongs to biological technical field, and in particular to a kind of Taq polymerase freeze drying protectant.
Background technology
Taq polymerase is isolated from thermus aquaticus Thermus Aquaticus (Taq) with heat endurance
Archaeal dna polymerase.It is frequently used for polymerase chain reaction (PCR), and this is a kind of method of DNA amplification short-movie segment number.97.5
The half-life period of DEG C Taq enzyme only has 9 minutes.And in low temperature environment, the activity of Taq enzyme can be substantially reduced, so that Increased Plasma Half-life,
Increase the holding time.Therefore, Taq polymerase can -20 DEG C of preservations in enzyme storage buffer, this method can preserve effectively
Taq polymerase enzymatic activity.But enzyme storage buffer can cause the enzyme activity of Taq polymerase to lose in refrigerating process and course of defrosting.
Vacuum freeze drying is referred to as lyophilized, is to freeze wet stock or solution at relatively low temperature (- 10 DEG C~-50 DEG C)
Form solid-state, then moisture therein is directly sublimed into gaseous state without liquid under vacuum (1.3~13 handkerchief), finally make material
The dry technology of dehydration.And Taq polymerase during freeze-drying due to cryogenic effect, freezing effect and Dehydration meeting
Cause the denaturation of its active component, make the reduction of Taq polymerase residual activity or even inactivate.
The content of the invention
In view of this, it is an object of the invention to provide a kind of Taq polymerase freeze drying protectant, match somebody with somebody according to following steps
System：
In terms of 100ml Taq polymerase freeze drying protectants, in the mixing of 85ml Taq polymerases buffer solution and 15ml glycerine
1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches are added in solution, are produced.
Preferably, in Taq polymerase freeze drying protectant of the present invention, the Taq polymerase buffer solution is Tris-
HCl buffer solutions (PH 8.0).
Preferably, in Taq polymerase freeze drying protectant of the present invention, the Taq polymerase freeze drying protectant makes
It is that Taq polymerase freeze drying protectant is added in Taq polymerase enzyme liquid with method；The Taq polymerase frozen-dried protective of the addition
The weight ratio of agent and Taq polymerase is 1:1.
Another object of the present invention is to provide a kind of Taq polymerase the lyophilized method preserved, comprise the following steps：
1), extract and obtain Taq enzyme liquid；
2) Taq polymerase freeze drying protectant, is added in Taq enzyme liquid；
3), using pre-freezing temperature as -20 DEG C, pre-freeze 12 hours；
4) freeze-drying about 14 hours~16 hours in vacuum freeze drier, are placed in after pre-freeze, white powder are obtained thick
Enzyme, -20 DEG C of preservations.
Preferably, in the lyophilized method preserved of Taq polymerase of the present invention, the Taq polymerase freeze drying protectant
To be prepared according to following steps：
In terms of 100ml Taq polymerase freeze drying protectants, 1 is added in 85ml Taq polymerases buffer solution, 15ml glycerine
Gram mannitol, 1 gram of glucose, 2 grams of soluble starches, are produced.
Preferably, in the lyophilized method preserved of Taq polymerase of the present invention, the Taq polymerase buffer solution is
Tris-HCl buffer solutions (PH 8.0).
Preferably, in the lyophilized method preserved of Taq polymerase of the present invention, the Taq polymerase freeze drying protectant
Proportioning with Taq polymerase is 1:1.
Preferably, in the lyophilized method preserved of Taq polymerase of the present invention, the unit volume of the Taq polymerase
Unit of activity be 2.5U/ μ l.
From subsequent embodiment upper and of the present invention, advantages of the present invention at least that：
1), Taq polymerase freeze drying protectant of the invention allows Taq polymerase to carry out effective freezing dry process.
After the Taq polymerase freeze-drying for adding freeze drying protectant, PCR experiment is can still provide for, its remnant enzyme activity is 70%.
2), Taq polymer enzyme freeze-dried powder can be stored in 4 DEG C of refrigerators, be easy to store and transport.Taq polymer enzyme freeze-dried powders
Stability is good.
Embodiment
In one embodiment of the invention there is provided a kind of Taq polymerase freeze drying protectant, the Taq polymerase freezes
Dry protective agent is to be prepared according to following steps：
In terms of 100ml Taq polymerase freeze drying protectants, in the mixing of 85ml Taq polymerases buffer solution and 15ml glycerine
1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches are added in solution, are produced.
Preferably, in another embodiment of the present invention, the Taq polymerase buffer solution is Tris-HCl buffer solutions
(PH 8.0)。
Preferably, in another embodiment of the present invention, the application method of the Taq polymerase freeze drying protectant be
Taq polymerase freeze drying protectant is added in Taq polymerase enzyme liquid；The Taq polymerase freeze drying protectant of the addition polymerize with Taq
The weight ratio of enzyme is 1:1.
In yet another embodiment of the present invention, a kind of lyophilized method preserved of Taq polymerase is additionally provided, including it is following
Step：
1), extract and obtain Taq enzyme liquid；
2) Taq polymerase freeze drying protectant, is added in Taq enzyme liquid；
3), using pre-freezing temperature as -20 DEG C, pre-freeze 12 hours；
4) freeze-drying about 14 hours~16 hours in vacuum freeze drier, are placed in after pre-freeze, white powder are obtained thick
Enzyme, -20 DEG C of preservations.
Preferably, in the lyophilized method preserved of Taq polymerase of the present invention, the Taq polymerase freeze drying protectant
To be prepared according to following steps：
In terms of 100ml Taq polymerase freeze drying protectants, 1 is added in 85ml Taq polymerases buffer solution, 15ml glycerine
Gram mannitol, 1 gram of glucose, 2 grams of soluble starches, are produced.
Preferably, in another embodiment of the present invention, the Taq polymerase buffer solution is Tris-HCl buffer solutions
(PH 8.0)。
Preferably, in another embodiment of the present invention, the Taq polymerase freeze drying protectant and Taq polymerase
Match as 1:1 weight ratio.
Preferably, in another embodiment of the present invention, the unit of activity of the unit volume of the Taq polymerase is
2.5U/μl。
Below in conjunction with the embodiment in the present invention, the technical scheme in the present invention is clearly and completely described.It is aobvious
So, described embodiment is only a part of embodiment of the invention, rather than whole embodiments.Based on the reality in the present invention
Example is applied, the every other embodiment that those of ordinary skill in the art are obtained under the premise of creative work is not made all belongs to
In the scope of protection of the invention.
Embodiment 1
1st, the competent escherichia coli cell BL21 (DE3) of -80 DEG C of preservations is taken out, Suo Laibao companies are placed in ice purchased from Beijing
Upper to thaw, pipette suctions out 50 μ l and moved into sterile centrifugation tube.
2nd, the μ l (Wuhan Chu Ling bioengineering Co., Ltd, pTrc-Taq protease plasmids) of Taq plasmids 1 are added, are gently mixed
It is placed in after even and stands 30min on ice, 42 DEG C of water-baths is placed 45 seconds~60 seconds, and 2~3min is placed on ice.
3rd, 500 μ l LB liquid mediums are added in centrifuge tube, 37 DEG C of shaking table vibration recovery 1h, rotating speed are placed in after gently mixing
60~80rpm.
4th, pipette suctions out 100 μ l coatings and drawn on the agar plate containing 100 μ g/ml ampicillins, 37 DEG C of incubated overnights.
5th, picking single bacterium colony, is inoculated in LB culture mediums of the 50mL containing 100 μ g/ml ampicillins, 37 DEG C of trainings of 220rpm
Support overnight.
6th, the Escherichia coli of 10ml incubated overnights are taken to be inoculated in LB culture mediums of the 1L containing 100 μ g/ml ampicillins,
220rpm 37 DEG C of cultures 6~7h, OD600For 0.8~1.0, addition 1mmol/l IPTG, continue to cultivate 12h.
7th, 3000rpm, 4 DEG C, centrifugation 10min collects bacterium, supernatant discarding.
8th, Tris-HCl buffer solutions (PH 8.0) 30ml of the lysozyme containing 4mg/ml is added, is fully resuspended, incubation at room temperature
15min.75 DEG C of water-bath 1h (period shakes up for several times).
9th, after said mixture cooled on ice, 12000rpm 4 DEG C, centrifuges 10min, collects supernatant.
10th, supernatant dialysis 12h in 4 DEG C, Tris-HCl buffer solutions (PH 8.0), obtains the thick enzymes of Taq of clear
Liquid.
11st, the mannitol of hybrid protection agent 1%, 1% glucose, 2% soluble starch and 15% are added in Taq crude enzyme liquids
(pre-freezing temperature is -20 DEG C to glycerine pre-freeze；Pre-freeze 12h；It is about 5mm to fill liquid thickness).
12nd, freeze-drying about 14~16h in vacuum freeze drier is placed in after pre-freeze, white powder Taq enzyme is obtained.
13rd, Taq enzyme albumen Tris-HCl buffer solutions (PH 8.0) 1:1 dilution, PCR detections.
PCR reaction systems (50 μ l systems) are template DNA (SEQ ID NO1) 2 μ l, sense primer (SEQ ID
NO2ATCACTGCATAATTCGTGTCGCT) 1 μ l, anti-sense primer (SEQ ID NO3CGATCCCAACCTCCAGAACAT) 1 μ l,
10 × Buffer (contains Mg2+) 5 μ l, dNTP (each 2.5mM) 4 μ l, Taq enzyme 2-3 μ l, plus ddH2O to 50 μ l.PCR reaction conditions are
94 DEG C of step (1) temperature, time 3-5min；(2) 94 DEG C of temperature, time 0.5min；(3) 52 DEG C of temperature, time 0.5min；(4)
72 DEG C of temperature, time 2.5min (about 2.5kb)；(5) 72 DEG C of temperature, time 10min.Step (2) to (4) repeats 25-30 and followed
Ring.10 μ l PCR reaction products agarose gel electrophoresis detection after reaction terminates.Taq polymerase remnant enzyme activity is 70.0%.
Comparative example is not used the Taq enzyme freeze-dried powder of protection liquid, the processing of identical PCR conditions, the residual activity of Taq enzyme less than
The 50% of crude enzyme liquid.
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Beijing Institute of Technology
<120>A kind of Taq polymerases freeze drying protectant
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 2502
<212> DNA
<213> Thermus Aquaticus
<400> 1
atggaattcg ggatgctgcc cctctttgag cccaagggcc gggtcctcct ggtggacggc 60
caccacctgg cctaccgcac cttccacgcc ctgaagggcc tcaccaccag ccggggggag 120
ccggtgcagg cggtctacgg cttcgccaag agcctcctca aggccctcaa ggaggacggg 180
gacgcggtga tcgtggtctt tgacgccaag gccccctcct tccgccacga ggcctacggg 240
gggtacaagg cgggccgggc ccccacgccg gaggactttc cccggcaact cgccctcatc 300
aaggagctgg tggacctcct ggggctggcg cgcctcgagg tcccgggcta cgaggcggac 360
gacgtcctgg ccagcctggc caagaaggcg gaaaaggagg gctacgaggt ccgcatcctc 420
accgccgaca aagaccttta ccagctcctt tccgaccgca tccacgtcct ccaccccgag 480
gggtacctca tcaccccggc ctggctttgg gaaaagtacg gcctgaggcc cgaccagtgg 540
gccgactacc gggccctgac cggggacgag tccgacaacc ttcccggggt caagggcatc 600
ggggagaaga cggcgaggaa gcttctggag gagtggggga gcctggaagc cctcctcaag 660
aacctggacc ggctgaagcc cgccatccgg gagaagatcc tggcccacat ggacgatctg 720
aagctctcct gggacctggc caaggtgcgc accgacctgc ccctggaggt ggacttcgcc 780
aaaaggcggg agcccgaccg ggagaggctt agggcctttc tggagaggct tgagtttggc 840
agcctcctcc acgagttcgg ccttctggaa agccccaagg ccctggagga ggccccctgg 900
cccccgccgg aaggggcctt cgtgggcttt gtgctttccc gcaaggagcc catgtgggcc 960
gatcttctgg ccctggccgc cgccaggggg ggccgggtcc accgggcccc cgagccttat 1020
aaagccctca gggacctgaa ggaggcgcgg gggcttctcg ccaaagacct gagcgttctg 1080
gccctgaggg aaggccttgg cctcccgccc ggcgacgacc ccatgctcct cgcctacctc 1140
ctggaccctt ccaacaccac ccccgagggg gtggcccggc gctacggcgg ggagtggacg 1200
gaggaggcgg gggagcgggc cgccctttcc gagaggctct tcgccaacct gtgggggagg 1260
cttgaggggg aggagaggct cctttggctt taccgggagg tggagaggcc cctttccgct 1320
gtcctggccc acatggaggc cacgggggtg cgcctggacg tggcctatct cagggccttg 1380
tccctggagg tggccgagga gatcgcccgc ctcgaggccg aggtcttccg cctggccggc 1440
caccccttca acctcaactc ccgggaccag ctggaaaggg tcctctttga cgagctaggg 1500
cttcccgcca tcggcaagac ggagaagacc ggcaagcgct ccaccagcgc cgccgtcctg 1560
gaggccctcc gcgaggccca ccccatcgtg gagaagatcc tgcagtaccg ggagctcacc 1620
aagctgaaga gcacctacat tgaccccttg ccggacctca tccaccccag gacgggccgc 1680
ctccacaccc gcttcaacca gacggccacg gccacgggca ggctaagtag ctccgatccc 1740
aacctccaga acatccccgt ccgcaccccg cttgggcaga ggatccgccg ggccttcatc 1800
gccgaggagg ggtggctatt ggtggccctg gactatagcc agatagagct cagggtgctg 1860
gcccacctct ccggcgacga gaacctgatc cgggtcttcc aggaggggcg ggacatccac 1920
acggagaccg ccagctggat gttcggcgtc ccccgggagg ccgtggaccc cctgatgcgc 1980
cgggcggcca agaccatcaa cttcggggtc ctctacggca tgtcggccca ccgcctctcc 2040
caggagctag ccatccctta cgaggaggcc caggccttca ttgagcgcta ctttcagagc 2100
ttccccaagg tgcgggcctg gattgagaag accctggagg agggcaggag gcgggggtac 2160
gtggagaccc tcttcggccg ccgccgctac gtgccagacc tagaggcccg ggtgaagagc 2220
gtgcgggagg cggccgagcg catggccttc aacatgcccg tccagggcac cgccgccgac 2280
ctcatgaagc tggctatggt gaagctcttc cccaggctgg aggaaatggg ggccaggatg 2340
ctccttcagg tccacgacga gctggtcctc gaggccccaa aagagagggc ggaggccgtg 2400
gcccggctgg ccaaggaggt catggagggg gtgtatcccc tggccgtgcc ccaggaggtg 2460
gaggtgggga taggggagga ctggctctcc gccaaggagt ga 2502
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
atcactgcat aattcgtgtc gct 23
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
cgatcccaac ctccagaaca t 21
Claims (7)
1. a kind of Taq polymerase freeze drying protectant, it is characterised in that prepared according to following steps：
In terms of 100ml Taq polymerase freeze drying protectants, in 85ml Taq polymerases buffer solution and the mixed solution of 15ml glycerine
It is middle to add 1 gram of mannitol, 1 gram of glucose, 2 grams of soluble starches, produce.
2. Taq polymerase freeze drying protectant according to claim 1, it is characterised in that the Taq polymerase buffer solution is
Tris-HCl buffer solutions (PH 8.0).
3. Taq polymerase freeze drying protectant according to claim 1, it is characterised in that the Taq polymerase frozen-dried protective
The application method of agent is that Taq polymerase freeze drying protectant is added in Taq polymerase enzyme liquid；The Taq polymerase of the addition freezes
The weight ratio of dry protective agent and Taq polymerase is 1:1.
4. a kind of lyophilized method preserved of Taq polymerase, comprises the following steps：
1), extract and obtain Taq enzyme liquid；
2) Taq polymerase freeze drying protectant, is added in Taq enzyme liquid；
3), using pre-freezing temperature as -20 DEG C, pre-freeze 12 hours；
4) freeze-drying about 14 hours~16 hours in vacuum freeze drier, are placed in after pre-freeze, the thick enzyme of white powder is obtained ,-
20 DEG C of preservations.
5. the lyophilized method preserved of Taq polymerase according to claim 4, it is characterised in that the Taq polymerase is freezed
Protective agent is to be prepared according to following steps：
In terms of 100ml Taq polymerase freeze drying protectants, 1 gram of addition is sweet in 85ml Taq polymerases buffer solution, 15ml glycerine
Reveal alcohol, 1 gram of glucose, 2 grams of soluble starches, produce.
6. the lyophilized method preserved of Taq polymerase according to claim 4, it is characterised in that the Taq polymerase buffering
Liquid is Tris-HCl buffer solutions (PH 8.0).
7. the lyophilized method preserved of Taq polymerase according to claim 4, it is characterised in that the Taq polymerase is freezed
The weight ratio of protective agent and Taq polymerase is 1:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710377774.XA CN106967706B (en) | 2017-05-25 | 2017-05-25 | A kind of Taq polymerase freeze drying protectant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710377774.XA CN106967706B (en) | 2017-05-25 | 2017-05-25 | A kind of Taq polymerase freeze drying protectant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106967706A true CN106967706A (en) | 2017-07-21 |
| CN106967706B CN106967706B (en) | 2019-11-12 |
Family
ID=59326689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710377774.XA Expired - Fee Related CN106967706B (en) | 2017-05-25 | 2017-05-25 | A kind of Taq polymerase freeze drying protectant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106967706B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112481253A (en) * | 2019-09-12 | 2021-03-12 | 广东菲鹏生物有限公司 | Freeze-drying protection prescription for PCR premix |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1793330A (en) * | 2005-11-07 | 2006-06-28 | 浙江工商大学 | Process for preparing high actived alctic acid bacteria product |
| CN101066260A (en) * | 2006-11-17 | 2007-11-07 | 姚瑶 | Coenzyme Q10 emulsion and its freeze dried prepn and their prepn process |
| CN105310080A (en) * | 2015-10-26 | 2016-02-10 | 中山大学 | Probiotic microcapsules as well as preparation method and application thereof |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
| CN106511380A (en) * | 2016-10-25 | 2017-03-22 | 重庆市畜牧科学院 | Coprophilous fungus composition and preparation method and purpose thereof |
-
2017
- 2017-05-25 CN CN201710377774.XA patent/CN106967706B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1793330A (en) * | 2005-11-07 | 2006-06-28 | 浙江工商大学 | Process for preparing high actived alctic acid bacteria product |
| CN101066260A (en) * | 2006-11-17 | 2007-11-07 | 姚瑶 | Coenzyme Q10 emulsion and its freeze dried prepn and their prepn process |
| CN105310080A (en) * | 2015-10-26 | 2016-02-10 | 中山大学 | Probiotic microcapsules as well as preparation method and application thereof |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
| CN106511380A (en) * | 2016-10-25 | 2017-03-22 | 重庆市畜牧科学院 | Coprophilous fungus composition and preparation method and purpose thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112481253A (en) * | 2019-09-12 | 2021-03-12 | 广东菲鹏生物有限公司 | Freeze-drying protection prescription for PCR premix |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106967706B (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5556771A (en) | Stabilized compositions of reverse transcriptase and RNA polymerase for nucleic acid amplification | |
| EP1303184B1 (en) | Preservation and storage medium for biological materials | |
| Uzunova-Doneva et al. | Anabiosis and conservation of microorganisms | |
| Bozoǧlu et al. | Survival kinetics of lactic acid starter cultures during and after freeze drying | |
| AU732057B2 (en) | Method and formulation for stabilization of enzymes | |
| AU2001268057A1 (en) | Preservation and storage medium for biological materials | |
| Ulrich et al. | Induction and characterization of β-galactosidase in an extreme thermophile | |
| US11649512B2 (en) | Freeze-dried composition | |
| CN105274192A (en) | Nucleic acid amplification reaction mixture particle and application thereof | |
| CN106967706B (en) | A kind of Taq polymerase freeze drying protectant | |
| CN107254428A (en) | A kind of Expression Systems for Lactic Acid Bacteria for expressing antifreeze peptide builds and its applied | |
| WO2003024211A9 (en) | Composition for stabilizing biological materials | |
| Sidyakina et al. | Viability and genetic stability of the bacterium Escherichia coli HB101 with the recombinant plasmid during preservation by various methods | |
| Staab et al. | Viability of lyophilized anaerobes in two media | |
| CN113817710A (en) | Agarase freeze-drying protective agent and agarase preservation method | |
| KR102063456B1 (en) | Method for improving viability and storage stability by supercooling cold adaptation of lactic acid bacteria | |
| Mohammadipanah et al. | Protective effects of Cryoprotectants and Lyoprotectants on the survival of Persipeptide producing Streptomyces zagrosensis UTMC 1154 | |
| Park et al. | In vitro assembly of thermostable Csm complex in CRISPR–Cas type III/A system | |
| KR102042521B1 (en) | Method for improving viability and storage stability by supercooling cold adaptation of Weissella cibaria WiKim28 | |
| KR102042522B1 (en) | Method for improving viability and storage stability by supercooling cold adaptation of Leuconostoc mesenteroides WiKim32 | |
| Szabó et al. | Effect of aminoglycoside antibiotics on the autolytic enzyme of Streptomyces griseus | |
| CN117535275A (en) | DNA polymerase freeze-drying protective agent and application thereof | |
| Blöndal et al. | Cloning, sequence analysis and overexpression of a Rhodothermus marinus gene encoding a thermostable thymidine kinase | |
| JP2003144144A (en) | Method for preserving liquid containing microbial cell or treated product thereof | |
| Tsutsaeva et al. | Long-term storage of industrial microbial strains |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191112 Termination date: 20200525 |