CN106967658B

CN106967658B - Method for improving Fab antibody expression quantity

Info

Publication number: CN106967658B
Application number: CN201710099209.1A
Authority: CN
Inventors: 张守涛; 郭亚楠; 田庆南
Original assignee: Zhengzhou University
Current assignee: Zhengzhou University
Priority date: 2017-02-23
Filing date: 2017-02-23
Publication date: 2020-09-15
Anticipated expiration: 2037-02-23
Also published as: CN106967658A

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a method for improving Fab antibody expression quantity in genetic engineering. The method comprises the following steps: constructing a recombinant plasmid pVEGF-Fab, preparing specific protease-deficient cell mutant strains (delta pepN, delta DegQ, delta dcp and delta pepP), transforming, inducing and expressing the Fab antibody and the like. The modification of the host cell strain is special and novel, and the prepared host cell strain can better relieve the inhibition or degradation effect after Fab expression due to the deletion of the specific protease, so that the Fab expression quantity is improved, and therefore, the Fab expression preparation method has better application value for the expression and preparation of specific Fab antibody, and simultaneously provides better reference and reference for the expression and preparation of other antibody proteins, and therefore, the Fab expression preparation method has better practical value and scientific research significance.

Description

Method for improving Fab antibody expression quantity

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a method for improving Fab antibody expression quantity in genetic engineering.

Background

Bacterial cells (e.g.E.coli,E.coli) Are commonly used for the production of recombinant proteins. Compared with a eukaryotic cell expression system, the bacterial expression system has the advantages of low cost, easy large-scale fermentation, easy automatic control of conditions and the like, and is an efficient and economic way for expressing recombinant protein through escherichia coli. The use of bacterial cells (e.g., E.coli) for the production of recombinant proteins has other numerous advantages, particularly due to the general nature of bacterial cells as host cells that allow for gene insertion by plasmids. Coli is used to produce a number of recombinant proteins including human insulin and Fab antibody proteins, among others.

Fab is an antigen-binding fragment of an IgG molecule, and is a heterodimer formed by the disulfide bond binding of Fd chain and L chain. Since Fab antibody fragments are free of Fc fragments, complex glycosylation and post-translational modifications are not required, and therefore need not be produced by mammalian cell systems. Coli has the advantages of clear self genetic background, easy operation, short production period, low cost, high expression level, easy separation and purification of the expression product, and the like, and is the most common prokaryotic expression system for preparing recombinant antibody fragments on a large scale. The content of protease and the content of hybrid protein in the periplasm space of the escherichia coli are low, so that the expression of Fab in the periplasm space is more favorable for producing and preparing the Fab antibody with high activity.

Despite the many advantages of using bacterial cells to produce Fab recombinant proteins, there are significant limitations, including better protease sensitivity of Fab proteins. The reason for this is that the most challenging problem of Fab expression in e.coli is the formation of 4 intra-and 1 inter-chain disulfide bonds, which are linked to the structural and functional integrity of the Fab molecule. In general, proteases play an important role in the turnover of old and misfolded proteins in the periplasm and cytoplasm of E.coli. When bacterial proteases act, the recombinant proteins can be degraded, thereby significantly reducing the yield of active protein. In E.coli, a number of bacterial proteases have been identified including DegP-Q, Tsp, prlC, pepA-T, tsh, espc, eatA, clpA, clpP, ClpX, dcp, DegS, lon, and the like.

The results for a portion of the protein studies are listed below:

aminopeptidase N (Aminopeptidase N, pepN), protein molecular weight 99kDa, belongs to protein family M1, and zinc ion is found in its active center. Aminopeptidase N is well conserved among various species such as mammals, insects, plants and bacteria. In E.coli, aminopeptidase N is considered to be the major aminopeptidase which relies on ATP to degrade intracellular proteins. In response to nutritional deficiencies, aminopeptidase N plays a major role in protein degradation, making the degraded amino acids available as nutrients. Further, it was found that inhibition of phenanthroline, puromycin, ubenimex, etc. can inhibit the enzyme activity.

The E.coli degQ gene, which codes for the protein degQ of 455 amino acid residues, which belongs to the serine endopeptidase family. Under stress conditions, the primary function of degQ is to degrade the large amount of denatured and unfolded proteins that accumulate in the periplasmic cavity of e. degQ can efficiently open the peptide bond between Val-Xaa and Ile-Xaa.

The E.coli dcp gene encodes a protein dcp of 681 amino acid residues, which is a C-terminal exopeptidase in which zinc ions are found in its active center. The dcp enzyme has a wide range of specificities and can cleave dipeptides from the C-terminus of proteins and various peptides.

The E.coli pepP gene, which encodes the protein pepP of 441 amino acid residues, which belongs to the N-terminal exopeptidase, and whose active center is found as a manganese ion. The dcp enzyme can release any proline-linked amino acid residue, including proline, from the N-terminus of proteins and various peptides.

In order to better express recombinant protein and avoid the influence of E.coli protease on recombinant protein, some specific protease-deficient bacterial strains are usually used for recombinant protein expression, such as Lac, rec, gal, ara, arg, thi, pro and other protease-deficient bacterial strains. However, these deficient strains often also have some unspecific effects on the growth of the host cell (E.coli), for example: the growth speed, stability, recombinant protein expression yield, toxicity and other influences of the bacterial cells further cause the loss of the industrial application prospect.

In summary, due to the deletion of specific strains and the diversification of modification possibilities, there is no suitable modification method for genetic engineering to increase the expression level of Fab antibodies in the prior art.

Disclosure of Invention

The invention aims to provide the preparation method of the Fab antibody, which can better improve the protein expression quantity of the Fab antibody, by modifying the Escherichia coli genome, thereby laying a foundation for the research and treatment of related diseases.

The technical solution adopted in the present application is detailed as follows.

A method for increasing the expression level of Fab antibody, which comprises the following steps:

(1) constructing a recombinant plasmid pVEGF-Fab according to the conventional transgenic operation method; when the recombinant plasmid is constructed, for example, a pETDuet-1 plasmid is used for constructing a double expression vector, the pETDuet-1 plasmid has two independent promoters, so that the encoding gene of the Fab antibody is properly optimized, and the gene optimization principle is as follows:

adding an independent periplasmic guide peptide sequence from gram-negative bacteria to the N ends of a light chain and a heavy chain Fd of a Fab encoding gene respectively, and specifically:

the OmpA amino acid sequence was added before the light chain: KKTAIAIAVALAGFATVAQA, respectively;

addition of OmpA amino acid sequence before heavy chain Fd segment: KKTAIAIAVALAGFATVAQA, respectively;

(2) preparing a specific recombinant escherichia coli expression strain, which comprises the following specific steps:

firstly, artificially synthesizing an integration box of pepN, DegQ, dcp and pepP, connecting the integration box with pKO3 plasmid, and respectively constructing recombinant plasmids pKO3-pepN, pKO3-DegQ, pKO3-dcp and pKO 3-pepP;

the constructed recombinant plasmid pKO3-pepN contains a knock-out mutated pepN gene shown as SEQ ID NO.1, and the recombinant plasmid contains an ApaI restriction marker;

the constructed recombinant plasmid pKO3-DegQ contains a mutation-knocked-out DegQ gene shown as SEQ ID NO.2, and the recombinant plasmid contains an ApaI restriction marker;

the constructed recombinant plasmid pKO3-dcp contains a mutation-knocked-out dcp gene shown as SEQ ID NO.3, and the recombinant plasmid contains an ApaI restriction marker;

the constructed recombinant plasmid pKO3-pepP contains a knock-out mutant pepP gene shown as SEQ ID NO.4, and the recombinant plasmid contains an ApaI restriction marker;

secondly, the constructed recombinant plasmids pKO3-pepN, pKO3-DegQ, pKO3-dcp and pKO3-pepP are simultaneously transformed into escherichia coli competent cells and screened to obtain protease-deficient cell mutants (delta pepN, delta DegQ, delta dcp and delta pepP);

the Escherichia coli is a K-12 strain family, and specifically comprises the following components:

W3110(F-λ-rph-1 INV(rrnD,rrnE)ilvG（ATCC27325），

MG1655(F-λ-ilvG-rfb-50 rph-1)（ATCC700926），

w3101 (F-. lambda. -ilvG-IN (rrnD-rrnE)1 rph-1 galT22), etc.;

preferably, the wild-type W3110 strain, i.e., K-12W 3110;

(3) and (2) transforming the recombinant plasmid pVEGF-Fab constructed in the step (1) into the chemically competent protease-deficient cell mutant strain (delta pepN, delta DegQ, delta dcp and delta pepP) reconstructed and prepared in the step (2), and further performing induced expression.

Generally, the relevant gene engineering operation technology in the application is mature, but the modification of the host cell strain is special and novel, and the prepared host cell strain can better relieve the inhibition or degradation effect after Fab expression due to the deletion of specific protease, so that the Fab expression quantity is improved, and therefore, the Fab expression preparation method has better application value for the expression preparation of specific Fab antibody, and simultaneously provides better reference and reference for the expression and preparation of other antibody proteins, so that the Fab expression preparation method has better practical value and scientific research significance.

Drawings

FIG. 1 shows the growth of the W3110mutant (pepN, DegQ, dcp and pepP) compared to the wild type W3110; when Fab expression is induced, compared with a wild type, the growth of a mutant strain after gene mutation has no obvious influence;

FIG. 2 shows Fab expression of the W3110mutants (pepN, DegQ, dcp and pepP) compared to wild-type W3110; compared with the wild type, the mutant strain obviously improves the expression level of Fab;

FIG. 3 shows the growth of the W3110mutant (pepN, DegQ, dcp and pepP) compared to the wild type W3110; mutations in the gene have no significant effect on the growth of the mutant compared to the wild type.

Detailed Description

The present application is further illustrated by the following examples, which are intended to briefly describe some of the biological materials, reagents, devices, etc. in the following examples before describing the specific examples.

Biological material:

wild type E.coli W3110, purchased from ATCC (cat. ATCC 27325);

pKO3 plasmid was purchased from Biovector plasmid vector cell gene collection center (Catalogue Biovector-pKO 3);

the synthesis and sequencing of related genes, primer sequences and the like are provided by the synthesis of Jinweizhi organism (Beijing);

experimental reagent:

restriction enzymes SalI, NotI, Nde 1, Xho 1, Nco1, Hind III and ApaI were purchased from NEB (Beijing);

common molecular biological reagents such as IPTG, sucrose, chloramphenicol, agarose, TMB, etc. were purchased from KANGYINGBIO (Beijing) Inc.;

rabbit anti-human CH1, rabbit anti-human k-coupled HRP and other antibodies purchased from Thermo Fisher China

Example 1

The method for improving the expression level of the Fab antibody provided by the application mainly depends on the modification of Escherichia coli. The procedure for preparing mutant cell lines W3110 (. DELTA.pepN,. DELTA.DegQ,. DELTA.dcp and. DELTA.pepP) is briefly described below, taking the original host cell line Escherichia coli W3110 (W3110 (F-l-rph-1 INV (rrnD, rrnE) ilvG) as an example.

(1) Respectively constructing recombinant plasmids pKO3-pepN, pKO3-DegQ, pKO3-dcp and pKO3-pepP

Carrying out SalI and NotI double enzyme digestion on an integration box (a reformed gene sequence) for artificially synthesizing pepN, DegQ, dcp and pepP respectively, carrying out SalI and NotI double enzyme digestion on a pKO3 plasmid simultaneously, and then connecting enzyme digestion products to respectively construct recombinant plasmids pKO3-pepN, pKO3-DegQ, pKO3-dcp and pKO 3-pepP;

it should be explained that the reason for selecting pKO3 plasmid is mainly three points: first, the pKO3 plasmid, using the origin of replication (RepA) of a temperature-sensitive mutant of pSC101 and a chloramphenicol marker, can potentiate and select for chromosomal integration events; secondly, the sacB gene encoding levansucrase is lethal to E.coli grown on sucrose and therefore (same as the chloramphenicol marker and the pSC101 origin) can be used to enhance and select for de-integration and plasmid elimination; thirdly, the pKOS system can remove all selectable markers from the host genome except for the inserted genes.

the constructed recombinant plasmid pKO3-pepP contains a knock-out mutant pepP gene shown in SEQ ID NO.4, and the recombinant plasmid contains an ApaI restriction marker.

(2) Transformation and screening of recombinant plasmids, specifically, the ligation product (i.e., the constructed recombinant plasmid) in step (1) is transformed into chemically competent Escherichia coli W3110 cells (wild-type cells), and further screened to obtain mutant strains, and the specific process is briefly described as follows.

On day 1, 40 μ L of e.coli cells were mixed with pKO3 recombinant plasmid (four plasmids mixed in equal proportions) in cold BioRad 0.2cm electroporation dishes, followed by electroporation at 2500V, 5uF and 200 Ω;

immediately adding 1000 μ L of 2 XPY, culturing at 30 deg.C and 250rpm for 1 hr in an incubator;

the culture broth was serially diluted 1/10 in 2 XPY and 100. mu.L aliquots were plated on 2 XPY agar plates (containing 20. mu.g/mL chloramphenicol), pre-warmed at 30 ℃ and 43 ℃ respectively, and incubated overnight.

On day 2, electroporation efficiency was assessed as the number of colonies grown at 30 ℃, with colonies surviving at 43 ℃ representing potential integration events;

single colonies from the 43 ℃ plate were picked and resuspended in 10mL of 2 XPY; 100 μ L of this was plated on 2 XPY plates (containing 5% (w/v) sucrose) and, when pre-warmed to 30 ℃, the plates producing single colonies were incubated overnight.

On day 3, further screening was performed, and the single colonies retained after screening represent potential simultaneous de-integration and plasmid healing events; if the event of de-integration and healing occurs early in growth, a large portion of the colony set will be clonal;

single colonies were picked and replica plated on 2 XPY agar (containing 20. mu.g/mL chloramphenicol or 5% (w/v) sucrose, and the plates incubated overnight at 30 ℃.

On day 4, colonies growing on sucrose and dying on chloramphenicol represent potential chromosomal replacement and plasmid healing events, positive clones were picked for PCR identification, and correctly identified positive colonies were incubated overnight at 30 ℃ on 2 x PY agar plates containing 5% (w/v) sucrose.

And on the 5 th day, carrying out further sequencing identification on the Escherichia coli positive recombinant bacterial colony which is identified to be correct by PCR, sensitive to chloramphenicol and resistant to sucrose, ensuring that the constructed recombinant Escherichia coli is correctly modified and is stored as a competent cell for later use.

During PCR identification, whether the mutant cell strain W3110 (delta pepN, delta DegQ, delta dcp and delta pepP) carries a correct mutant genome is detected by taking whether non-naturally-occurring ApaI restriction sites exist in PCR amplification products as a detection target, and when the PCR detection is identified, primer sequences are designed as follows:

pepN For：5'-CGAATTGTGTCATAGGTGCGCAGTA-3'，

pepN Rev：5'-GGCTTTACCGTACTGTTGGTGACGCA-3'；

DegQ For：5'-TACTGGATACCATGGCGCACGACTAT-3'，

DegQ Rev：5'-CGGCGTCGTTGATGACGTGTTTATT-3'；

dcp For：5'-CGCACCGTAAACGTTACCACCGGCATA-3'，

dcp Rev：5'-TCGCAGTCGCCAGCAAAATGCATAA-3'；

pepP For：5'-AAGCTGGATAAAGTGACCGGCGAAA-3'，

pepP Rev：5'-TCTGGCGCAGTCGCTTCAATCAAA-3'；

during PCR amplification, a cell lysate (at 95 ℃, a cell single colony is heated in a 1xPCR buffer solution for 10 minutes, and after the cell single colony is cooled to room temperature, the cell single colony is centrifuged at 13200rpm for 10 minutes, and a precipitate is a cell lysate) is used as an amplification template;

the 50 μ L amplification system was designed as follows:

buffer x10 (Roche), 5 μ L;

dNTP mix (Roche, 10mM mix), 1. mu.L;

5' oligonucleotide (5 pmol), 1.5. mu.L;

3' oligonucleotide (5 pmol), 1.5. mu.L;

cell lysate, 2 μ L;

taq DNA polymerase (Roche 5U/. mu.L), 0.5. mu.L;

ultrapure water H₂O，38.5μL；

The PCR reaction program is: 94 ℃ for 1 minute; 94 ℃ for 1 min, 55 ℃ for 1 min, 72 ℃ for 1 min, and 30 cycles; 72 ℃ for 10 minutes.

After the reaction, 25. mu.L of the PCR reaction solution was transferred to a new microcentrifuge tube, and 19. mu.L of H was added₂O, 5. mu.L of buffer 3 (NEB), 1. mu.L of ApaI (Fermentas, mixed well and incubated at 37 ℃ for 2 hours to digest ApaI.

Meanwhile, 5. mu.L of loading buffer (. times.6) was added to the remaining PCR reaction solution, and 20. mu.L of the solution was loaded on 0.8% TAE 200mL agarose gel (Invitrogen) to which olfactory ethidine (5. mu.L of 10mg/mL stock solution) was added, followed by electrophoresis at 100V for 1 hour; during electrophoresis, 10. mu.L of size marker (Perfect DNA marker 0.1-12 kb, Novagen) was loaded into the last electrophoresis tank.

After completion of ApaI digestion, the sample addition buffer (x 6) was added to the solution, and the electrophoretic analysis was performed in the same manner.

The gel after electrophoresis was observed using a UV light transmitting illuminator (transilluminator).

The results of the electrophoretic tests showed that all amplified genomic fragments showed the following bands of the correct size: 3157pb (for pepN), 2130bp (for DegQ) and 2761kb (for dcp) 1677 (for pepP).

Further, after ApaI digestion, the results of electrophoresis confirmed the presence of the introduced ApaI site in the protease deficient strain, but not in the W3110 control. Using genomic DNA amplified with the pepN primer set, bands of 2591 and 517bps were generated by digesting the resulting DNA with ApaI. Genomic DNA was amplified using the DegQ primer set and bands of 1649 and 481bps were generated by digestion of the resulting DNA with ApaI. Genomic DNA was amplified using the dcp primer set and digestion of the resulting DNA with ApaI produced bands of 2051 and 708 bps. Genomic DNA was amplified using the pepP primer set and digestion of the resulting DNA with ApaI produced bands of 1677 and 288 bps.

Example 2

The recombinant plasmid pVEGF-Fab was constructed for Fab antibody expression according to current routine transgenic procedures.

Because pETDuet-1 with two independent promoters is required to be selected as an expression vector for double-gene co-expression, the encoding gene of Fab needs to be properly optimized, and the gene optimization principle is as follows:

the OmpA amino acid sequence was added before the light chain: KKTAIAIAVALAGFATVAQA, synthesizing the total length of light chain DNA by solid phase phosphoramidite tricot method after codon optimization according to an escherichia coli prokaryotic expression system, and inserting 5 'Nde 1 and 3' Xho 1 behind a first promoter;

addition of OmpA amino acid sequence before heavy chain Fd segment: KKTAIAIAVALAGFATVAQA, after codon optimization according to an escherichia coli prokaryotic expression system, synthesizing the full length of heavy chain Fd DNA by a solid phase phosphorescalimide trico method, and inserting the enzyme cutting sites of Nco1 at the 5 'end and Hind III at the 3' end behind a second promoter;

the constructed recombinant plasmid pVEGF-Fab is transformed into the chemically competent protease-deficient cell mutant W3110 (delta pepN, delta DegQ, delta dcp and delta pepP) prepared by modification in example 1 (the specific operation process can be referred to molecular cloning instruction J. SameBruk, D.W. Lassel, the translation of Huangpetang and the like, which is not described in detail).

Example 3

The positive single colony transformed in example 2 was picked up, added to 5mL of 2 XPY (1% phytone, 0.5% yeast extract, 0.5% NaCl) medium containing 10. mu.g/mL tetracycline, and cultured overnight at 37 ℃ with shaking at 250 rpm;

mu.L of the overnight culture was inoculated into 200mL of SM6E medium supplemented with tetracycline (10. mu.g/mL), and incubated overnight at 30 ℃ with shaking at 250 rpm; this step was repeated once until the culture reached OD₆₀₀About 2, and then used directly or stored for a long period of time (long-term storage procedure: centrifugation, cell collection, and then cell resuspension in 100mL of SM6E, glycerol addition at a final concentration of 12.5%, -80 ℃ storage)

2mL of the culture was added to 200mL of SM6E medium containing 10. mu.g/mL tetracycline, and cultured at 30 ℃ with shaking at 250rpm until OD₆₀₀Is about 2.

IPTG was added to a final concentration of 200. mu.M to induce production of recombinant protein. Samples were taken at 1, 2, 4, 6, 12, and 24h after IPTG addition for analysis of bacterial growth and protein expression.

Analysis of bacterial growth, taking a 0.5mL sample of the culture at the above sampling time and recording the OD₆₀₀Value, then OD vs. time (hours)₆₀₀The results are shown in FIG. 1.

The results in FIG. 1 show that: when Fab expression was induced, the genes pepN, DegQ, dcp and pepP, etc., mutated had no significant effect on the growth of the W3110mutant compared to the wild type W3110.

For the measurement of protein expression, 1mL of the culture sample was centrifuged at 12000rpm for 5 minutes, and the pellet was resuspended in 200. mu.L of periplasmic extraction buffer (100 mM Tris.HCl/10mM EDTA pH 7.4);

the periplasmic proteins were released by shaking at 250rpm overnight at 30 ℃;

the next day, the extract was centrifuged at 12000rpm for 10 minutes, the supernatant was preserved and either directly assayed or stored at-20 ℃ as a 'periplasmic extract'; the remaining cell pellet was discarded.

Quantitative analysis is carried out on the expression quantity of the recombinant protein by adopting an ELISA method, and the specific process is as follows:

coating 96-well ELISA with PBS containing 2. mu.g/mL capture antibody (rabbit anti-human CH 1) overnight at 4 ℃;

wash 3 times with 300 μ L of sample/conjugate buffer (PBS, 0.2% BSA, 0.1% Tween 20);

samples and standards were serially 1/2 diluted on plates in 100 μ Ι _ of sample/conjugate buffer, plates were shaken at 250rpm for 1 hour at room temperature;

after 3 washes with 300 μ L of wash buffer (PBS, 0.1% Tween20), 100 μ L of display antibody (rabbit anti-human k-coupled HRP, 1/1000 dilution) was added; the plate was then shaken at 250rpm for 1 hour at room temperature;

after washing 3 times with 300. mu.L of washing buffer, 100. mu.L of TMB substrate solution was added and OD was recorded using a microplate reader₆₃₀(ii) a The Fab concentration in the periplasmic extract was then calculated by comparison with standards.

The results are shown in FIG. 2. The results in FIG. 2 show that the use of the mutant strain W3110mutants (. DELTA.pepN,. DELTA.DegQ,. DELTA.dcp and. DELTA.pepP) significantly increased the expression of Fab when the expression of Fab was induced, as compared with the wild type W3110.

Example 4

The inventors also examined the growth of transformed E.coli mutant W3110(Δ pepN, Δ DegQ, Δ dcp and Δ pepP) by shake flask experiments, and the related experiments are briefly described below.

Picking single colony into 5mL LB culture solution (per liter culture solution, 10g tryptone, 5g yeast extract, 10g NaC), shaking at 37 deg.C and 250rpm for overnight culture; further transferred to 75mL LB medium to OD₆₀₀About = 0.1; then cultured at 37 ℃ with shaking at 250rpm, 0.2mL of the culture sample was taken out per hour and the OD was recorded₆₀₀Value, relative time (hours) to OD₆₀₀The results are plotted in FIG. 3. In shake flask experiments, mutant pepN, DegQ, dcp, and pepP genes had no significant effect on the growth of the W3110mutant compared to wild-type W3110.

SEQUENCE LISTING

<110> Zhengzhou university

<120> a method for increasing Fab antibody expression level

<130>none

<160>4

<170>PatentIn version 3.5

<210>1

<211>2615

<212>DNA

<213>Escherichia coli

<400>1

atgacttaac agccacaagc caaataccgt cacgattatc gtgcgccgga ttaccagatt 60

actgatattg acttgacctt tgacctcgac gcgcaaaaga cggtcgttac cgcggtcagc 120

caggctgtcc gtcatggtgc atcagatgct ccccttcgtc tcaacggcga agacctcaaa 180

ctggtttctg ttcatattaa tgatgagccg tggaccgcct ggaaagaaga agagggcccg 240

cactggttat cagtaatttg ccggagcgtt ttacgcttaa gatcattaat gaaataagcc 300

cggcggcgaa taccgcgctg gaagggcttt atcagtcagg cgatgcgctt tgcacccagt 360

gtgaagccga aggtttccgc catattacgt attatctcga ccgcccggac gtgctggcgc 420

gttttaccac caaaattatt gccgataaaa tcaaatatcc cttcctgctt tccaatggta 480

accgcgttgc gcaaggcgaa ctggaaaacg gacgccattg ggtacagtgg caggacccgt 540

tcccgaaacc gtgctacctg tttgcgctgg tggcaggcga ctttgatgta ctgcgcgata 600

cctttaccac gcgttctggt cgcgaagtag cactggagct gtacgtcgat cgcggcaacc 660

ttgatcgcgc gccgtgggcg atgacctcgc tgaaaaactc catgaaatgg gatgaagaac 720

gctttggcct ggagtatgac ctcgacatct atatgatcgt cgcggtggat ttcttcaata 780

tgggcgcaat ggagaataag gggctgaata tctttaactc caaatatgtg ctggcccgca 840

ccgacaccgc caccgacaaa gattacctcg atattgaacg cgttatcggc catgaatatt 900

tccataactg gaccggtaac cgagtgacct gtcgcgactg gttccagctc agcctgaaag960

aaggtttaac cgtcttccgc gatcaggagt tcagctctga ccttggttcc cgcgcagtta 1020

accgcatcaa taatgtacgc accatgcgcg gattgcagtt tgcagaagac gccagcccga 1080

tggcgcaccc gatccgcccg gatatggtca ttgagatgaa caacttctac accctgaccg 1140

tttacgagaa gggcgcggaa gtgattcgca tgatccacac cctgcttggc gaagaaaact 1200

tccagaaagg gatgcagctt tatttcgagc gtcatgatgg tagtgcagcg acctgtgacg 1260

actttgtgca ggcgatggaa gatgcgtcga atgtcgatct ctcccatttc cgccgttggt 1320

acagccagtc cggtacaccg attgtgaccg tcaaagacga ctacaatccg gaaaccgagc 1380

agtacaccct gaccatcagc cagcgcacgc cagccacgcc ggatcaggca gaaaaacagc 1440

cgctgcatat tccgtttgcc atcgaactgt atgataacga aggcaaagtg atcccgttgc 1500

agaaaggcgg tcatccggtg aattccgtgc tgaacgtcac tcaggcggaa cagacctttg 1560

tctttgataa tgtctacttc cagccggtgc ctgcgctgct gtgcgaattc tctgcgccag 1620

tgaaactgga atataagtgg agcgatcagc aactgacctt cctgatgcgt catgcgcgta 1680

atgatttctc ccgctgggat gcggcgcaaa gtttgctggc aacctacatc aagctgaacg 1740

tcgcgcgtca tcagcaaggt cagccgctgt ctctgccggt gcatgtggct gatgctttcc 1800

gcgcggtact gcttgatgag aagattgatc cagcgctggc ggcagaaatc ctgacgctgc 1860

cttctgtcaa tgaaatggct gaattgttcg atatcatcga cccgattgct attgccgaag 1920

tacgcgaagc actcactcgt actctggcga ctgaactggc ggatgagcta ctggctattt 1980

acaacgcgaattaccagagc gagtaccgtg ttgagcatga agatattgca aaacgcactc 2040

tgcgtaatgc ctgcctgcgt ttcctcgctt ttggtgaaac gcatctggct gatgtgctgg 2100

tgagcaagca gttccacgaa gcaaacaata tgactgatgc gctggcggcg ctttctgcgg 2160

cggttgccgc acagctgcct tgccgtgacg cgctgatgca ggagtacgac gacaagtggc 2220

atcagaacgg tctggtgatg gataaatggt ttatcctgca agccaccagc ccggcggcga 2280

atgtgctgga gacggtgcgc ggcctgttgc agcatcgctc atttaccatg agcaacccga 2340

accgtattcg ttcgttgatt ggcgcgtttg cgggcagcaa tccggcagcg ttccatgccg 2400

aagatggcag cggttacctg ttcctggtgg aaatgcttac cgacctcaac agccgtaacc 2460

cgcaggtggc ttcacgtctg attgaaccgc tgattcgcct gaaacgttac gatgccaaac 2520

gtcaggagaa aatgcgcgcg gcgctggaac agttgaaagg gctggaaaat ctctctggcg 2580

atctgtacga gaagataact aaagcactgg cttga 2615

<210>2

<211>1369

<212>DNA

<213>Escherichia coli

<400>2

atgaaaaaat aaacccagct gttgagtgca ttagcgttaa gtgtcgggtt aactctctcg 60

gcgtcatttc aggccgtcgc gtcgattcca ggccaggttg ccgatcaggg cccctctccc 120

cagtctggct ccaatgctgg aaaaagtgct tccggcagtg gtgagcgtac gggtggaagg 180

aacggccagt cagggacaga aaatcccgga agaattcaaa aagttttttg gtgatgattt 240

accggatcaa cctgcacaac ccttcgaagg tttaggctcc ggtgtcatca tcaacgccag 300

taaaggctat gtgctgacca acaaccatgt gattaatcag gcacagaaaa tcagtattca 360

gctcaatgat gggcgcgagt ttgatgcaaa actgattggt agcgatgacc agagcgatat 420

cgccctgtta caaattcaaa acccgagcaa attaacgcaa atcgctattg ccgactccga 480

taaattgcgc gtcggtgatt ttgccgtagc ggtcggtaac ccatttggcc ttgggcaaac 540

cgccacctct ggcattgttt ccgcattagg ccgcagcggg ttgaatcttg aaggtctgga 600

aaactttatc cagacagatg cttccattaa ccgcggtaac tccggcggtg cactattaaa 660

ccttaacggt gagttaattg gcatcaacac tgcaatcctt gcgcctggcg gcgggagcgt 720

cgggattgga tttgccatcc ccagtaatat ggcgcgaaca ctggcgcagc agcttatcga 780

ctttggtgaa atcaaacgcg gtttgttagg catcaaaggc accgagatga gtgccgatat 840

cgccaaagcc ttcaaccttg acgtgcagcg tggcgcgttt gtcagcgaag tgttgccagg 900

ttctggctcg gcaaaagcgg gcgtcaaagc gggcgatatt attaccagcc tcaacggcaa 960

accgctgaat agctttgctg agttgcgctc tcgtatcgcg accaccgagc cgggcacgaa 1020

agtgaagctt ggcctgctgc gtaacggcaa accactggaa gtagaagtga cgctcgatac 1080

cagcacctct tcgtcggcca gcgctgaaat gatcacgcca gcgctggaag gtgcaacgtt 1140

gagcgatggt cagctaaaag atggcggcaa aggtattaaa atcgatgaag ttgtcaaagg 1200

aagcccagct gctcaggctg gcttgcaaaa agacgatgtg atcattggcg tcaaccgcga 1260

tcgggtgaac tcgattgctg aaatgcgtaa agtgctggcg gcaaaaccgg ccatcatcgc 1320

cctgcaaatt gtacgcggca atgaaagcat ctatctgctg atgcgttaa 1369

<210>3

<211>2049

<212>DNA

<213>Escherichia coli

<400>3

atgacaacaa tgtaatcctt tccttgtgca aagcacactg ccgtatctgg ctccccattt 60

tgatcaaatt gccaatcatc actatcgccc ggcattcgat gagggaatgc agcaaaagcg 120

ggcccagaaa ttgctgccat cgcgcttaac ccgcaaatgc ctgatttcaa caatactatt 180

ctggcactgg aacaaagcgg agaattactt acccgcgtta ccagcgtctt ttttgcgatg 240

actgcggcgc ataccaatga tgaattacag cgtcttgacg agcagttttc cgctgaactg 300

gcggaactgg ctaatgatat ctatctgaac ggtgaattat tcgcgcgggt agatgctgtc 360

tggcagcgcc gtgaatccct ggggcttgat agtgaatcca tccgcctggt ggaggtgatt 420

catcaacgtt ttgtccttgc cggagccaaa cttgcgcaag ctgataaagc aaaattaaaa 480

gtactgaata cagaagctgc gaccctgacc agccagttta accagcgatt actggcagca 540

aataaatccg gcggtctggt tgtgaacgat atcgcgcagc tggcaggaat gagtgagcaa 600

gagattgcgc tggcggcaga ggcggctcgc gagaaaggtc tggataacaa atggctgatt 660

ccgctgctga ataccaccca acaaccggcg cttgccgaaa tgcgcgatcg tgcgacgcgt 720

gaaaaactgt ttattgcggg ctggacgcga gcggaaaaaa atgatgccaa tgatacccgc 780

gctatcattc aacgtctggt ggagatccgt gcacaacagg caacactact tggttttcct 840

cattatgccg catggaaaat cgccgatcag atggcaaaaa cacctgaagc agcacttaac 900

tttatgcggg aaattgttcc agcggcgcgt caacgtgcga gcgatgaatt agcctccata 960

caggcggtta tcgataagca gcagggcggg tttagcgcgc agccgtggga ctgggcattt 1020

tatgcggaac aggtacggcg ggagaaattt gatcttgatg aggcgcagct caagccatat 1080

tttgaattaa acacggtgtt aaatgaaggt gtattctgga ccgcgaatca gctcttcggt 1140

attaagtttg tcgaacgttt tgatattcct gtctaccatc ctgacgttcg tgtgtgggaa 1200

atttttgatc ataatggcgt ggggctggcg ttattttacg gtgatttctt cgcccgtgat 1260

tcaaaaagcg gcggtgcatg gatgggcaat tttgttgagc aatcaacgct taataaaaca 1320

catccggtaa tttataacgt ctgcaattat cagaaacccg ctgccggtga gcctgcgttg 1380

ttactctggg atgatgtcat aaccttattc catgaatttg gtcatacgct gcacggcctt 1440

tttgcccgcc agcgttatgc cacgctttcc ggcaccaaca cgccgcgtga ttttgtcgaa 1500

tttccgtcgc aaatcaacga acactgggca acgcatccgc aggtattcgc tcgctacgcc 1560

cggcattatc agagcggggc agcaatgcct gacgaactgc aacagaaaat gcgtaatgcc 1620

agcctgttca acaaagggta tgagatgagc gaactgctta gcgccgcact tctcgatatg 1680

cgctggcatt gcctggaaga aaacgaagca atgcaggatg tcgatgattt tgaattgcgg 1740

gcgctggtgg cggaaaatat ggatcttcct gctataccgc cacgctatcg cagcagttat 1800

ttcgcccata tttttggtgg cggatatgct gcaggttatt acgcttatct gtggacgcaa 1860

atgttggccg atgatggtta tcagtggttt gttgagcagg gcggattaac gcgtgaaaat 1920

gggctgcgtt ttcgcgaggc gatcctttcc agaggtaaca gcgaagatct ggaacgcctg 1980

tatcgacaat ggcgcggtaa ggcacctaag attatgccga tgctgcaaca tcgtggcttg 2040

aacatataa 2049

<210>4

<211>1327

<212>DNA

<213>Escherichia coli

<400>4

atgagtgaga tatcccggta agagtttcag cgtcgccgtc agggccctgg tggagcaaat 60

gcaacccggc agcgccgcgc tgatttttgc tgcaccagaa gtaacacgta gcgccgacag 120

cgaatacccc tatcgtcaga acagtgactt ctggtacttc accggcttta acgaaccgga 180

agcggtgctg gtgctgatta aaagcgatga cactcataac cacagcgttc tgtttaaccg 240

cgttcgcgac ctgacggcgg agatctggtt tggccgtcgc ttaggccagg atgccgcgcc 300

agagaaactg ggcgttgacc gcgcactggc attcagcgaa atcaatcagc aactttatca 360

actacttaac ggcctggatg tggtttacca tgcccagggc gaatatgcat atgctgatgt 420

aatcgtgaac agtgcgctgg aaaaactgcg taaaggttcg cggcaaaatc tcaccgcacc 480

ggcaacgatg atcgactggc gtcctgttgt tcatgaaatg cgcctgttca aatcgccaga 540

agagattgcc gtactccgcc gcgcgggaga aatcaccgcc atggcacata cacgggcgat 600

ggaaaaatgc cgtccgggaa tgttcgagta ccatctggaa ggcgaaattc accacgaatt 660

taaccgccac ggtgcgcgct atccgtccta taacaccatt gtcggcagcg gtgaaaacgg 720

ctgcattctg cactacaccg aaaacgagtg tgaaatgcgc gacggcgacc tggtgttgat 780

tgacgcgggt tgtgaataca aaggttacgc tggcgatatt acccgcacct tcccggtcaa 840

cggcaaattc acccaggccc agcgtgaaat ctacgacatt gtgctggagt ctctcgaaac 900

cagcctgcgc ctgtatcgtc cgggaacttc cattctggaa gtcactggtg aagtggtgcg 960

catcatggtt agcggcctgg taaaactcgg catcctgaaa ggtgatgttg atgaactgat 1020

cgctcagaac gcccatcgtc ctttctttat gcatggcctt agccactggt taggactgga 1080

tgtccatgac gtgggtgttt atggtcagga tcgctcgcgc attctggaac cgggcatggt 1140

actgaccgta gagccagggc tgtatattgc gccggatgca gaagtgccag aacaatatcg 1200

cggtatcggc attcgtattg aagacgacat tgtgattacc gaaaccggta acgaaaacct 1260

caccgccagc gtggtgaaaa agccggaaga aatcgaagcg ttgatggttg ctgcgagaaa 1320

gcaatga 1327

Claims

1. A method for increasing the expression level of a Fab antibody, which comprises the steps of:

(1) constructing a recombinant plasmid pVEGF-Fab according to the conventional transgenic operation method;

the constructed recombinant plasmid pKO3-pepN contains a knock-out mutated pepN gene shown as SEQ ID NO. 1;

the constructed recombinant plasmid pKO3-DegQ contains a knockout mutated DegQ gene shown in SEQ ID NO. 2;

the constructed recombinant plasmid pKO3-dcp contains a mutated dcp gene which is knocked out and shown in SEQ ID NO. 3;

the constructed recombinant plasmid pKO3-pepP contains a knock-out mutant pepP gene shown in SEQ ID NO. 4;

secondly, simultaneously transforming the constructed recombinant plasmids pKO3-pepN, pKO3-DegQ, pKO3-dcp and pKO3-pepP into escherichia coli competent cells, and screening to obtain pepN, DegQ, dcp and pepP gene-deficient cell mutants;

(3) and (2) transforming the recombinant plasmid pVEGF-Fab constructed in the step (1) into the chemically competent pepN, DegQ, dcp and pepP gene-deficient cell mutant strain modified and prepared in the step (2), and further performing induced expression of an Fab antibody.

2. The method for increasing the expression level of Fab antibody according to claim 1, wherein in step (2), the E.coli strain is K-12 strain family.

3. The method according to claim 2, wherein the E.coli strain is W3110, MG1655 or W3101.

4. The method for increasing the expression level of Fab antibody according to claim 1, wherein in step (1), the construction of the recombinant plasmid is carried out using pETDuet-1 plasmid.

5. The method according to claim 4, wherein the Fab antibody encoding gene is optimized in the step (1) by the following steps:

the OmpA amino acid coding sequence is added before the light chain;

the OmpA amino acid coding sequence was added before the heavy chain Fd stretch.