CN106955284A - Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths - Google Patents
Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths Download PDFInfo
- Publication number
- CN106955284A CN106955284A CN201710109408.6A CN201710109408A CN106955284A CN 106955284 A CN106955284 A CN 106955284A CN 201710109408 A CN201710109408 A CN 201710109408A CN 106955284 A CN106955284 A CN 106955284A
- Authority
- CN
- China
- Prior art keywords
- medicine
- signal paths
- regulating
- sfn
- stem cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
- A61K31/26—Cyanate or isocyanate esters; Thiocyanate or isothiocyanate esters
Landscapes
- Health & Medical Sciences (AREA)
- Emergency Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of a kind of medicine for suppressing leukemic stem cells renewal and propagation by regulating and controlling Shh signal paths, belong to cancer therapy drug technical field.Technical scheme main points are：Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths, the functional component of the medicine is sulforaphane, and leukemic stem cells are acute leukemia stem cell KG1a.The present invention has inquired into SFN to acute leukemia stem cell KG1a self-renewing and the effect of propagation first, as a result show that SFN suppresses self-renewing and the propagation of acute leukemia stem cell by regulating and controlling Shh signal paths, this is not only theoretic breakthrough, and with potential clinical meaning, SFN can provide new thinking as a kind of potential drug candidate for treating leukaemia for the treatment of acute leukemia.
Description
Technical field
The present invention relates to cancer therapy drug technical field, and in particular to a kind of to suppress leukaemia by regulating and controlling Shh signal paths
A kind of medicine that stem cell updates and bred.
Background technology
Sulforaphane（Sulforaphane, SFN）Be it is a kind of be present in broccoli and other brassicaceous vegetables it is different
Rhodanate material, with anti-proliferative capacity, it has now been found that SFN is a variety of to oophoroma, carcinoma of urinary bladder, prostate cancer etc. pernicious
The growth of tumour cell is inhibited, is a kind of new anticancer component.But, effects of the SFN to hematopoietic tumor cell
And mechanism then report it is less.
Acute leukemia is a class candidate stem cell malignant clone disease, leukaemia because proliferation out of control, differentiation
Obstacle, the apoptosis mechanism such as be obstructed largely are bred in marrow and other hematopoietic tissues, and infiltrate other tissues and organ, while just
Normal hematopoiesis is suppressed.Recent study find in leukaemic's body in addition to containing a large amount of leukaemias, there is also
The few leukemic stem cells of a group ratio（Leukemia stem cells, LSCs）, can self-renewing, infinite multiplication,
It is divided into leukaemia initial cell.The immunological marker of leukemic stem cells have CD34+, CD38-, CD71-, HLA-DR-, CD90-,
CDll7- and CDl23+, and generally acknowledged CD34+, CD38-, CDl23+ is the outstanding feature on LSC surfaces.Leukaemia is specific
Under the conditions of it is reversible switch to LSCs, LSCs number be influence patient educate after one of key factor.Current viewpoint thinks white blood
Disease recurrence, resistance and educate rear bad related to LSCs.Chemotherapy is only capable of killing leukaemia initial cell, and, this portion invalid to LSCs
Stem cell is divided to be Drug-resistant Recurrent and educate rear bad root.LSCs is only removed to be possible to effect a radical cure leukaemia.It is all kinds of into
In human leukemia, with acute myeloid leukemia（Acute myeloid leukaemia, AML）Incidence of disease highest, and chemotherapy alleviation
Rate is relatively low.And chemotherapy has serious toxic and side effect, the limitation of these chemotherapy promotes researcher to strive to find one kind always
It is more efficient, specific it is higher and low toxic and side effect can substitute or therapeutic alliance leukaemia medicine.
Hedgehog signal paths are relevant with the self-renewing of cell.Under normal circumstances, the signal path, which is in, closes shape
State.The missing of the signal can cause the deformity of multiple internal organs, and its abnormal activation then forms relevant with kinds of tumors.Sonic
hedgehog（Shh）As one of Hedgehog gene family members, occur with Several Kinds of Malignancy, development has close pass
System, separately has multiple studies have shown that Shh signal paths maintain the self-renewing characteristic of tumor stem cell.
KGla cell deriveds are in the cell line of male's acute myeloid leukemia resistance, its height expression CD34 and CD123, low table
Up to CD38, in leukaemia stem/progenitor cells early development stage, it has the feature of leukemic stem cells, is to study white blood at present
The ideal model of sick stem cell.The present invention acts on KG1a cells with the SFN of various concentrations, observes it to KG1a cell self-renewals
With the influence of multiplication capacity, analysis SFN suppresses effect and the mechanism of KG1a cells propagation.
The content of the invention
Present invention solves the technical problem that there is provided a kind of by regulating and controlling Shh signal paths suppression leukemic stem cells more
New and propagation medicine.
The present invention is adopted the following technical scheme that to solve above-mentioned technical problem, and white blood is suppressed by regulating and controlling Shh signal paths
A kind of medicine that sick stem cell updates and bred, it is characterised in that：The functional component of the medicine is sulforaphane.
Further preferably, described leukemic stem cells are acute leukemia stem cell KG1a.
The present invention has inquired into self-renewings and the effect of propagation of the SFN to acute leukemia stem cell KG1a first, as a result
Show that SFN suppresses self-renewing and the propagation of acute leukemia cellses by regulating and controlling Shh signal paths, this is not only theoretic
Break through, and with potential clinical meaning, SFN can be acute white as a kind of potential drug candidate for treating leukaemia
The treatment of blood disease provides new thinking.
Brief description of the drawings
Fig. 1 is that SFN is acted on after KGla cells to CD34+/CD38-, CD34+/CDl23+ and CDl23+/CD38- expression shadow
Ring figure；
Fig. 2 is that SFN is acted on after KGla cells on KGla ability of cell proliferation influence figures；
Fig. 3 is that SFN acts on KGla cells different time to KGla ability of cell proliferation influence figures；
Fig. 4 is that SFN is acted on after KGla cells on KGla cell self-renewals and multiplication capacity influence figure；
Fig. 5 be positive regulation factor S hh, Smo after qPCR technology for detection SFN effect KGla cells in Shh signal paths and
Gli1 variation diagrams；
Fig. 6 is that western bloting technology for detection SFN acts on the positive regulation factor in Shh signal paths after KGla cells
Shh, Smo and Gli1 variation diagram.
Embodiment
The above to the present invention is described in further details by the following examples, but this should not be interpreted as to this
The scope for inventing above-mentioned theme is only limitted to following embodiment, and all technologies realized based on the above of the present invention belong to this hair
Bright scope.
Embodiment
Experiment material：
Sulforaphane（Lot number 28911701）Purchased from LKT Laboratories companies of the U.S., purity 98%.1640 culture medium and tire
Cow's serum is U.S.'s Gibco Products.CCK-8 kits are purchased from Dojindo companies of Japan, PE Mouse Anti-Human
CD34, FITC Mouse Anti-Human CD123 and APC Mouse Anti-Human CD38 are U.S. company BD product,
Methyl cellulose bundle cell Cloning Medium is stem cell company of the U.S., RNA extracts kits, Reverse Transcriptase kit, SuperReal
PreMax（SYBR Green）Purchased from Shanghai Tiangeng biotech firm, rabbit-anti people Shh mAb, Smo mAb, Gli1 mAb are the U.S.
Abcam Products, anti-human GAPDH pAb, and HRP- goat-anti rabbit pAb provide for century Kang Wei company.Flow cytometer
（FACSCaibur types）For U.S. company BD product, MK3 ELIASAs, the type real-time fluorescence quantitative PCR instrument of ABI 7300 and ND2000
The U.S. of ultramicrospectrophotometer system Thermo Products, gel image analysis system is given birth to by Genegenius companies of Britain
Production, flow cytometer is U.S. company BD.Eclipse Ti-s inverted microscopes are purchased from Nikon companies of Japan, are the U.S.
Thermal Products.
Experimental procedure：
1st, cell culture
Human acute myeloid leukemia cell KGla cell lines are preserved by this room, with the RPMI1640 culture mediums of hyclone containing 10wt%
Penicillin l00U/mL, streptomysin 100ug/mL, 100 μm of ol/L of glutamine are previously added in culture, culture medium, volume is placed in
Fraction is 5% CO2In 37 DEG C of cultures in incubator, liquid passage, growth period cell of taking the logarithm are changed in time according to cell growth state
Do follow-up test.
2nd, flow cytometer showed
Exponential phase cell is collected, 1500r/min centrifugation 5min, PBS washing 3 times, with 1mL PBS re-suspended cells, is counted, taken
50uL cell suspensions, add CD38APC 1uL, CD123FITC 1uL, CD34PE 1uL, and lucifuge reaction 20min is washed off with PBS
Unreacted fluorescence, adds 500uL PBS re-suspended cells, and often pipe obtains 10000 cells, with CellQuest analysis softwares point
Analysis.
3rd, cell proliferation experiment
By the exponential phase KG1a cells of Secondary Culture, count, be 1 × 10 according to every hole cell density5/ L is inoculated in 96 holes
In culture plate, be separately added into final concentration be respectively 0,2,4,6,8,10,12 μm of ol/L SFN（0.9% NS dissolved dilutions be 2 ×
103μmol/L）, 37 DEG C are cultivated after 24h, 48h, 72h, and CCK-8 reagents 10uL is added per hole and continues to be incubated 4h, is examined in enzyme linked immunological
The OD values that instrument OD values are each hole of measurement at 450nm are surveyed, experiment is repeated 3 times, averaged.Comparative survival rate of cells=（Experimental group-
Blank group）/（Control group-blank group）×100%.Meanwhile, observation under an optical microscope is taken pictures.According to KG1a cell survival rates,
Cell growth curve is drawn, suitable SFN concentration is chosen and does subsequent experimental.
4th, tumour ball is tested
Methylcellulose cell clonal formation culture medium is placed on 4 DEG C of refrigerator overnights, next day takes out, and shakes and mixes, takes respectively
Go out 3mL culture mediums to be positioned in centrifuge tube, exponential phase cells rinsed with PBS connects according to 1 × 103 cells/mL concentration
Plant to methylcellulose cell culture and concentrate after concussion mixings, move in culture dish, be placed in the CO that volume fraction is 5%2Culture
Continue culture in 37 DEG C in case.Taken pictures after 7 days under the colony number and colony size of observation of cell, microscope.
5th, western bloting analyze Shh albumen
Exponential phase cell is collected, ice-cold SDS lysis buffers dissolve 20min, 12000 × g centrifugation 15min, taken out
Leach protein, BCA protein concentrations detection kit determines protein content, and albumen applied sample amount is 30 μ g, 10wt% SDS-PAGE electrophoresis；
Electricity goes to pvdf membrane, 5wt% skimmed milk power closing, 1:Overnight, TBST is washed after film 3 times 1000 4 DEG C of primary antibodies, and 1:5000 secondary antibodies
Room temperature 2h, then washed 3 times with TBST, the development of ECL chemical luminescence for liquid is taken pictures.Experimental result is analyzed with Image J.
7th, QPCR detects Smo, Gli1 and Shh mRNA expression
Exponential phase cell is collected, total serum IgE is extracted with Trizol methods, RNA purity and concentration are detected with nucleic acid-protein quantitative instrument,
Purity is between 1.8-2.0, and concentration is in 1-3 μ g/ μ L.Reverse transcription synthesis cDNA is carried out with Reverse Transcriptase kit, transcription system is
20uL.Shh (F) 5 '-CGCACCTGCTCTTTGTGG-3 ', (R) 5 '-GGAGCGGTTAGGGCTACTCT-3 '；Smo(F) 5’-
TCGCTACCCTGCTGTTATTC-3 ', (R) 5 '-GACGCAGGACAGAGTCTCAT-3 '；Gli1(F) 5’-
CTGGATCGGATAGGTGGTCT-3 ', (R) 5 '-CAGAGGTTGGGAGGTAAGGA-3 '；Bata-actin is reference gene.
PCR reaction conditions：95 DEG C of pre-degeneration 1min, 40 circulations are carried out by 95 DEG C of 5s, 55 DEG C of 30s and 72 DEG C of extension 1min.Amplification
After end, product is heated to 95 DEG C of reaction 20min from 60 DEG C, to determine the specificity of PCR primer, 2-∆∆CTIt is used as target gene
Relative expression quantity.
Experimental result：
The influence that the SFN of table 1 is expressed KG1a cells CD34, CD38 and CD123
| CD34+CD38- | CD34+CD123+ | CD123+CD38- | |
| Before effect | 97.72% | 78.37% | 79.2% |
| After effect | 79.81%* | 6.14%* | 3.2%* |
*Compared with before effect, P<0.05
1st, flow cytomery result, which is shown, is rich in leukemic stem cells in KG1a cells, CD34+/CD38- accounts for 97.72%,
CDl23+/CD38- accounts for 79.2%, is a kind of cell line for meeting research leukemic stem cells.Acted on using 8 μm of ol/L SFN
Find that CD34+/CD38-, CD34+/CDl23+ and CDl23+/CD38- expression are decreased obviously after KG1a cells（Fig. 1）.Table 1 shows
Show that SFN acts on the expression of CD34+/CD38-, CD34+/CDl23+ and CDl23+/CD38- after KG1a cells and is decreased obviously, with
Compared before SFN effects* P﹤ 0.05.
2nd, detected using cell proliferation experiment CCK8 kits and find that SFN has the effect for suppressing KG1a cells propagation, and
And the multiplication capacity of KG1a cells is gradually on a declining curve with the increase of SFN concentration and action time（Fig. 2）.In optical microphotograph
Microscopic observation ability of cell proliferation also complies with result above, and 8 μm of ol/L SFN is acted on after KG1a cells, with time lengthening
The quantity of KG1a cells is reduced（Fig. 3）.
3rd, cell clone experiment shows that KG1a cells can form colony on methylcellulose cell clone culture base
Ability, further illustrates the stem cell properties of KG1a cells, with continuous self-renewing and multiplication capacity, is carried out using SFN
After intervention, it is found that the colony number number of KG1a formation and the volume of tumour ball are suppressed（Fig. 4）.
4th, acted on using 8 μm of ol/L of qPCR and western bloting technology for detection SFN after KG1a cells, Shh letters
There is lowering phenomenon in positive regulation factor S hh, Smo and Gli1 in number path, experimental result in triplicate,* P﹤ 0.05（Fig. 5
And Fig. 6）.
Embodiment above describes general principle, principal character and the advantage of the present invention, the technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, the original for simply illustrating the present invention described in above-described embodiment and specification
Reason, under the scope for not departing from the principle of the invention, various changes and modifications of the present invention are possible, and these changes and improvements are each fallen within
In the scope of protection of the invention.
SEQUENCE LISTING
<110>Xinxiang College of Medical Science
<120>Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths
<130> 2017
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> RNA
<213>Artificial sequence
<400> 1
CGCACCTGCTCTTTGTGG 18
<210> 2
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
GGAGCGGTTAGGGCTACTCT 20
<210> 3
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
TCGCTACCCTGCTGTTATTC 20
<210> 4
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
GACGCAGGACAGAGTCTCAT 20
<210> 5
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
CTGGATCGGATAGGTGGTCT 20
<210> 6
<211> 20
<212> RNA
<213>Artificial sequence
<400> 1
CAGAGGTTGGGAGGTAAGGA 20
Claims (2)
1. suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths, it is characterised in that：The medicine
The functional component of thing is sulforaphane.
2. according to claim 1 suppress one kind that leukemic stem cells update and bred by regulating and controlling Shh signal paths
Medicine, it is characterised in that：Described leukemic stem cells are acute leukemia stem cell KG1a.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710109408.6A CN106955284A (en) | 2017-02-27 | 2017-02-27 | Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710109408.6A CN106955284A (en) | 2017-02-27 | 2017-02-27 | Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106955284A true CN106955284A (en) | 2017-07-18 |
Family
ID=59470709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710109408.6A Pending CN106955284A (en) | 2017-02-27 | 2017-02-27 | Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106955284A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101120948A (en) * | 2006-08-08 | 2008-02-13 | 普文英 | Compound composition with chemical protecting, cancer preventing and treating use |
| CN101474170A (en) * | 2008-12-04 | 2009-07-08 | 中国人民解放军第三军医大学 | Application of isosulfocyanate compound in preparing medicament for treating leukemia |
| US20160279094A1 (en) * | 2015-03-24 | 2016-09-29 | Loic Pierre Deleyrolle | Dietary and natural product management of negative side effects of cancer treatment |
-
2017
- 2017-02-27 CN CN201710109408.6A patent/CN106955284A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101120948A (en) * | 2006-08-08 | 2008-02-13 | 普文英 | Compound composition with chemical protecting, cancer preventing and treating use |
| CN101474170A (en) * | 2008-12-04 | 2009-07-08 | 中国人民解放军第三军医大学 | Application of isosulfocyanate compound in preparing medicament for treating leukemia |
| US20160279094A1 (en) * | 2015-03-24 | 2016-09-29 | Loic Pierre Deleyrolle | Dietary and natural product management of negative side effects of cancer treatment |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rickard et al. | Malignant ascites in ovarian cancer: cellular, acellular, and biophysical determinants of molecular characteristics and therapy response | |
| Lee et al. | Hepatocytes direct the formation of a pro-metastatic niche in the liver | |
| Sundar et al. | The role of cancer stem cells in glioblastoma | |
| CN106399306B (en) | Target sgRNA, genophore and its application that people lncRNA-UCA1 inhibits bladder cancer | |
| Lee et al. | Regulatory role of quiescence in the biological function of cancer stem cells | |
| Zhang et al. | Tumorspheres derived from HCC cells are enriched with cancer stem cell-like cells and present high chemoresistance dependent on the Akt pathway | |
| Kamohara et al. | The search for cancer stem cells in hepatocellular carcinoma | |
| Gu et al. | Astragalus mongholicus Bunge-Curcuma aromatica Salisb. suppresses growth and metastasis of colorectal cancer cells by inhibiting M2 macrophage polarization via a Sp1/ZFAS1/miR-153-3p/CCR5 regulatory axis | |
| Tang et al. | Androgens drive sexual dimorphism in liver metastasis by promoting hepatic accumulation of neutrophils | |
| CN106955284A (en) | Suppress a kind of medicine that leukemic stem cells update and bred by regulating and controlling Shh signal paths | |
| WO2023078023A1 (en) | Application of cd38 car-t cell in acute myelosis of chronic myelogenous leukemia | |
| CN102816792B (en) | A kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity | |
| Liu et al. | Commensal bacterial hybrid nanovesicles improve immune checkpoint therapy in pancreatic cancer through immune and metabolic reprogramming | |
| CN103948926A (en) | Use of miR-9 inhibitor in preparation of tumor growth inhibition drugs | |
| CN107488734A (en) | Applications of the miR 19a 3p in prostate cancer with osseous metastasis diagnostic reagent and medicine is prepared | |
| CN110438081B (en) | Malignant clone cell strain of mantle cell lymphoma and establishing method and application thereof | |
| CN114027256A (en) | Construction method and application of SD rat in-situ liver cancer model with high liver hardness background | |
| CN105457041A (en) | Application of miR-26a in non-small cell lung cancer (NSCLC) | |
| CN102218068A (en) | Application of PPARgamma stimulant 15d-PGJ2 to preparation of targeting liver cancer stem cell drugs | |
| Cheng et al. | Inhibitive effect of IL-24 gene on CD133+ laryngeal cancer cells | |
| WO2022110010A1 (en) | Use of immune activator, antigen and antibody in preparation of product for preventing and treating tumors | |
| Xin et al. | Using a novel CD133+ immune magnetic particle to separate gastric adenocarcinoma stem cells from peripheral blood and the pluripotency study about the separated cells | |
| CN101787368B (en) | siRNA for restraining Z38 gene expression of human being and application thereof in preparing breast-tumor resisting medicine | |
| WO2023125696A2 (en) | Activated lymphocyte expansion method having stable and controllable quality, and anti-tumor use thereof | |
| CN106282239A (en) | MiR-21 is at the regulation and control CML stem cell research method to imatinib mesylate primary drug resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170718 |
|
| RJ01 | Rejection of invention patent application after publication |