CN102816792B - A kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity - Google Patents
A kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity Download PDFInfo
- Publication number
- CN102816792B CN102816792B CN201210293661.9A CN201210293661A CN102816792B CN 102816792 B CN102816792 B CN 102816792B CN 201210293661 A CN201210293661 A CN 201210293661A CN 102816792 B CN102816792 B CN 102816792B
- Authority
- CN
- China
- Prior art keywords
- activity
- trail
- expression
- cell
- apoptosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention belongs to biological technical field, and in particular to a kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity.Using the present invention can also modulate tumor tissue and Intracellular transcription factor NF κ B and activity, death receptor DR4 and DR5 expression and activity, JNK and c Jun phosphorylation and activity, the expression of p53 albumen and activity, promote apoptosis molecule Bax, Bid, t Bid, capsase 3, capsase 8, capsase 9 expresses and its promoted anti-apoptotic activity, anti-apoptotic proteins c FLIP and Bcl 2 is expressed and activity, promotion tumor tissues and Apoptosis.The invention further relates to application of the above method in the medicine with apoptosis-inducing Drug combination is prepared.
Description
First, technical field：
The invention belongs to biological technical field, and in particular to a kind of regulating heat shock protein 70 is expressed, the side of quantity and activity
Method and its application.
2nd, background technology：
The statistics of ministry of Health of China shows：Annual people of nascent tumor patient populations about 212.7 ten thousand of China or so at present,
Wherein, there is 1,060,000 or so malignant tumour new life patient every year；Meanwhile the whole nation there are about 268.5 ten thousand or so the existing trouble of tumour
The existing patient 148.5 ten thousand or so of person, wherein malignant tumour.By taking the morbidity and mortality of lung cancer as an example, the U.S. there are about 16 every year
Ten thousand people die from lung cancer, wherein 75% patient is non-small cell lung cancer（NSCLC）.In China main cities, the incidence of disease of lung cancer is
It is the first to occupy various Cancer Mortalities.China has nearly 800,000 people to die from lung cancer, wherein Patients with Non-small-cell Lung about every year
Account for 80-85%（McCracken M etc., 2007, CACancer J Clin57:190-205）.Because the development process of lung cancer is fast,
It is not easy to find in early days, late period easily shifts, therefore its death rate is very high.Existing treatment method（Such as radiotherapy, chemotherapy）Side effect
Greatly, drug resistance be present, therapeutic effect is limited, therefore, seeks new therapy target and new treatment method seems and very must
Will.
Apoptosis is clinically the most frequently used oncotherapy principle at present, and either chemotherapy or radiotherapy is all by luring
Lead apoptosis of tumor cells and play antitumor action, but tumour cell can usually produce the resistance to Apoptosis, so as to pole
Earth effect Apoptosis treats the effect of tumour.For example, tumor necrosin relative death inducing ligand（TRAIL）It is tumour
Necrosin（TNF）Superfamily member relays TNF, the 3rd apoptosis molecule found after Fas-L.There is TRAIL selectivity to kill
Hinder the effect of tumour cell, can induced various types of tumors cell and transformed cells occur apoptosis, but normal tissue and cell are without withering
Inducing action is died, and TRAIL has obvious compared with the inflammatory reaction caused by TNF, Fas-L during inducing cell apoptosis
Less advantage, therefore TRAIL has turned into the focus molecule of the antineoplastic of a new generation（Walczak H etc., 1999, Nat
Med5:157-163）, at present TRAIL as antineoplastic the U.S. just II clinical trial phases, China complete
III clinical trial phases, it is mainly used in treating refractory neoplasm such as lung cancer etc., shows preferable therapeutic effect.However, in experiment
It was found that still there are many patients to include drug resistance of the patients with lung cancer appearance to TRAIL, TRAIL therapeutic effect is greatly reduced,
TRAIL treatment crowd is limited, therefore, how to overcome the drug resistance in the treatment of the cell death inducers such as TRAIL to turn into
A problem in the urgent need to address.
Heat shock protein HSP, except helping albumen correctly to fold etc. in addition to basic role as molecular chaperones, also with directly or
Indirect mode take part in the regulation of Apoptosis, and its action target spot is related to each main kinases or the pass of different apoptotic signal paths
Key modulin（Jaattela M, 1999, Exp Cell Res248:30-43）, consequently, it is possible to being to cause TRAIL medicines
One of the reason for tolerance.Studies have reported that, suppress prostate cancer tumor cells in vitro using the specific inhibitor of HSP90
Interior HSP90 has reversed repellence of the prostate gland cancer cell to TRAIL（Ma Y etc., 2006, Mol Cancer Ther5:170-
178）.The research is prompted：HSP90 is probably a target for modulation of the reversing tumor cell to TRAIL repellences.Currently for
HSP90 comes into clinical research as the medicine geldanamycin and 17-AAG of therapy target, although however,
Geldanamycin and 17-AAG has good antitumor activity, but still has limitation, is mainly manifested in stability and dissolving
Spend limited, molecular weight is big, can be metabolized by Cytochrome P450, and bioavailability is low, and geldanamycin have it is serious
Hepatotoxicity, these are all restricted its clinical practice.Due to HSP family members include HSP110, HSP90,
HSP70, intermediate molecular weight HSP and small-molecular-weight HSP five extended familys, therefore, other heat shock proteins, such as HSP27, HSP70,
Cancer target and ideas of cancer therapy and method can be used as
3rd, the content of the invention
The purpose of the present invention is difficult aiming at drug resistance present in the cell death inducer therapeutic process such as TRAIL
Topic, a kind of tumour cell that increases is explored to the new method of TRAIL sensitiveness, develop a kind of new, effective lung cancer therapy plan
Slightly.
In order to achieve the above object, the invention provides a kind of tumor tissues or cell by cell apoptosis susceptibility of increasing
Method, it is characterized in that increasing tumor tissues or thin by suppressing the expression of tumor tissues or intracellular heat shock protein A subunit
Sensitiveness of the born of the same parents to Apoptosis.
Further, the invention provides a kind of modulate tumor tissue or intracellular heat shock protein A subunit quantity and work
Property method, it is characterized in that being reached by the intracellular heat shock protein A subunit quantity of influence of routine and the method or means of activity
Increase tumor tissues or cell to thin to by suppressing quantity and the activity of tumor tissues or intracellular heat shock protein A subunit
The purpose of the sensitiveness of born of the same parents' apoptosis.For example, suppress HSP70mRNA transcription, Huo Zheli by screening the inhibitor of HSP70 transcriptions
The suppression for being reduced HSP70mRNA quantity with RNA perturbation techniques or Antisense RNA Technique or being synthesized using HSP70 protein
Agent reduces the quantity of HSP70 protein or the inhibitor using HSP70 by accelerating the degraded of HSP70 protein
Suppress HSP70 function and activity.
Further, the invention provides a kind of method of modulate tumor tissue or Intracellular transcription factor NF- kB activities,
It is characterized in that reach increase tumor group by the intracellular HSP70 of the suppression expression of routine, the method for quantity or activity or means
Knit or the purpose of Intracellular transcription factor NF- kB activities.
Further, the invention provides a kind of modulate tumor tissue or intracellular death receptor DR4 and DR5 expressions
Method, it is characterized in that reaching raising by the intracellular HSP70 of the suppression expression of routine, the method for quantity or activity or means
The purpose of tumor tissues or cell DR4 and DR5 expression.
Further, the invention provides the phosphorylation or activity of a kind of modulate tumor tissue or intracellular JNK and c-Jun
Method, it is characterized in that reaching raising by the intracellular HSP70 of the suppression expression of routine, the method for quantity or activity or means
The purpose of tumor tissues or intracellular JNK and c-Jun phosphorylation or activity.
Further, the invention provides a kind of method of modulate tumor tissue or intracellular p53 protein actives, its feature
It is to reach to improve tumor tissues or thin by the intracellular HSP70 of the suppression expression of routine, the method for quantity or activity or means
The purpose of intracellular p53 protein actives.
Further, the invention provides a kind of modulate tumor tissue or intracellular mitochondrial apoptotic signal pathway to promote
The method of apoptosis molecule Bax, Bid, t-Bid expression, it is characterized in that passing through expressing, counting for the intracellular HSP70 of suppression of routine
The method or means of amount or activity reach improve tumor tissues or intracellular Bax, Bid, t-Bid, capase3, capase8,
Capase9 expression, the purpose for promoting tumor tissues or Apoptosis.
Further, the invention provides a kind of modulate tumor tissue or intracellular anti-apoptotic proteins c-FLIP and Bcl-2
The method of expression, it is characterized in that being reached by the intracellular HSP70 of the suppression expression of routine, the method for quantity or activity or means
Reduce tumor tissues or intracellular c-FLIP and Bcl-2 expression, the purpose for promoting tumor tissues or Apoptosis.
Further, the invention provides heat shock protein expression and tumour cell in a kind of modulate tumor tissue or cell
The therapeutic strategy of apoptosis therapy Drug combination, it is characterized in that the table that tumor tissues or intracellular heat shock protein 70 will be lowered
Reach to increase drug susceptibility of the tumour cell to anti-tumor medicine, increase anti-tumor medicine inducing apoptosis of tumour cell
Ability, so as to significantly improving its antitumous effect.
Further, the invention provides heat shock protein expression and tumour cell in a kind of modulate tumor tissue or cell
The therapeutic strategy of apoptosis therapy Drug combination, it is characterized in that the table that tumor tissues or intracellular heat shock protein 70 will be lowered
Reach to increase drug susceptibility of the tumour cell to cell death inducer TRAIL, the TRAIL inductions of increase cell death inducer
The ability of apoptosis of tumor cells, so as to significantly improving its antitumous effect.
Further, the invention provides HSP70 in a kind of modulate tumor tissue and cell and each Apoptosis correlation egg
Application of the method for white matter expression and activity in antineoplastic is prepared respectively.
Further, the invention provides HSP70 in a kind of modulate tumor tissue and cell and each Apoptosis correlation egg
White matter is expressed and the method for activity is being prepared and the application in the medicine of Apoptosis medicine use in conjunction respectively.
Further, express and live the invention provides HSP70 in a kind of regulating cell and cell death related protein matter
Property method preparing respectively promote apoptotic agent in application.
Further, express and live the invention provides HSP70 in a kind of regulating cell and cell death related protein matter
The method of property is being prepared and the application in the medicine of Apoptosis medicine use in conjunction respectively.
In order to achieve the above object, the technical scheme is that：Heat shock protein A subunit and HSP27 are built first
Interference plasmid psiHSP70 and psiHSP27, respectively using cell lines such as non-small cell carcinoma A549SW1573, H460 as research object,
The interference effect of above interference plasmid is demonstrated, then examines low expression and TRAIL after HSP70 or HSP27 is disturbed by RNA
Treat the effect of use in conjunction inducing apoptosis of tumour cell.On the basis of cellular level work, the present invention establishes respectively again
A549 subcutaneous solid tumors model and lung cancer model in situ, demonstrate low expression and TRAIL after HSP70 or HSP27 is disturbed by RNA
Combination carries out the effect of interior therapeutic.Test result indicates that：HSP70 and HSP27 interference plasmid can lower cell well
Interior HSP70 and HSP27 protein expression level, cellular level and TRAIL combinations all can effective induced tumor cell apoptosis,
And TRAIL, psiHSP70 cause HSP70 low expressions, psiHSP27 to cause the exclusive use of HSP27 low expressions can not effective induced tumor
Apoptosis.When being combined with TRAIL, psiHSP70 causes HSP70 low expressions and psiHSP27 to cause HSP27 low expression two methods bodies
The ability of outer inducing apoptosis of tumour cell is suitable.When subcutaneous solid tumors model and lung cancer model in situ are tested, HSP70 and
HSP27 interference plasmid and the result of TRAIL therapeutic alliances show：PsiHSP70 causes HSP70 low expressions to be remarkably improved tumour
To the sensitiveness of Apoptosis treatment method, tumor tissues and Apoptosis and necrosis are significantly improved, so as to significantly inhibit entity
Knurl grows, and psiHSP27 causes HSP27 low expressions to reach with TRAIL therapeutic alliances on animal model significantly improve in vivo
Sensitiveness of the tumour to Apoptosis treatment method, it is impossible to improve tumor tissues and Apoptosis and necrosis, it is impossible to significantly inhibit
Implanted solid tumor growth.
Expression, quantity or the activity for lowering tumor tissues or intracellular HSP70 significantly increase NF- κ B p65 subunits indexing
Into nucleus while accelerate I κ B degraded, so as to strengthen the activity of transcription factor NF-KB, significantly raise NF- κ B downstreams target
Gene -- death receptor DR4 and DR5 expression, for example, lower tumor tissues or intracellular HSP70 expression, quantity or
DR5 expression can then be raised 6 times by activity when DR5 expression can be raised 2 times, be combined with TRAIL.Lower tumour
Tissue or intracellular HSP70 expression, quantity or activity can also increase JNK and c-Jun phosphorylation, so as to promoting p53 albumen
Activation, the activation of p53 albumen will cause downstream target gene -- death receptor DR4 and DR5 expression rise, increase line grain
Cell loss signal pathway promotees apoptosis molecule Bax, Bid, t-Bid, caspase3, caspase8, caspase9 and cell color
Plain C expression while the expression for lowering anti-apoptotic proteins c-FLIP, Bcl-2, tumour cell is significantly improved to cell so as to reach
The sensitiveness of apoptosis, tumor tissues and Apoptosis and necrosis are improved, significantly inhibit the effect of implanted solid tumor growth.
Compared with existing antineoplaston strategy, innovation of the invention and it is particular in that：
（1）Invented first it is a kind of by modulate tumor tissue or intracellular HSP70 expression, quantity or activity increase its
To Apoptosis medicine or the method for the treatment of method sensitiveness.
（2）HSP70 expression, quantity or activity in a kind of modulate tumor tissue or cell has been invented first to wither with tumour cell
Die medicine use in conjunction, dramatically increase the therapeutic strategy of antitumor curative effect.
（3）Having invented a kind of expression, quantity or activity by lowering tumor tissues or intracellular HSP70 first can show
Write enhancing NF- κ B active, notable up-regulation NF- κ B downstream target genes -- death receptor DR4 and DR5 expression, increase JNK
Phosphorylation with c-Jun, the activation for promoting p53 albumen, increase mitochondrial apoptosis signal pathway promote apoptosis molecule Bax,
The protein expression such as Bid, t-Bid, caspase3, caspase8, caspase9 and cromoci, lower anti-apoptotic proteins
The protein expression method such as c-FLIP, Bcl-2, so as to reach significantly improve tumour cell to the sensitiveness of Apoptosis, improve
Tumor tissues and Apoptosis and necrosis, significantly inhibit the effect of implanted solid tumor growth.
（4）Regulation and control HSP70 expression, quantity or activity can significantly increase sensitiveness of the tumour to apoptosis-inducing, energy
Antitumor curative effect is enough dramatically increased, this feature can not obtain by lowering all heat shock proteins.It is prior
It is that Apoptosis is lured even if regulating and controlling a certain HSP expression, quantity or activity and can dramatically increase tumour cell in cellular level
The sensitiveness led, it also can not necessarily reach in animal model level and significantly improve tumor tissues or tumour cell to Apoptosis
The sensitiveness for the treatment of method, it can not necessarily dramatically increase antitumor curative effect.Most significant illustration is exactly：Although present invention discover that
Sensitiveness of the tumour cell to Apoptosis can be effectively increased in cellular level by regulating and controlling HSP27 expression, quantity or activity, its
Effect is even suitable with the effect of regulation and control HSP70 expression, quantity or activity, but HSP27 regulation and control treatment of solid tumors in vivo
The upper therapeutic effect without the obvious increase antitumor curative effect of generation.By contrast, HSP70 expression, quantity or activity is regulated and controled
No matter in cellular level or tumor tissues or cell by cell apoptosis therapy medicine or side can be increased in animal model body
The sensitiveness of method, it can effectively suppress tumour growth with Apoptosis medicine or method combination, there is well antitumor to control
Therapeutic effect.
（5）The method that regulation and control HSP70 expression, quantity or activity can significantly increase cell by cell apoptosis induction sensitiveness
The treatment of various rush Apoptosis is can apply to, promotees apoptotic agent for preparing.
In summary, a kind of modulate tumor tissue or intracellular HSP70 expression, quantity or activity of passing through of the present invention increases
Add it to Apoptosis medicine or the method for the sensitiveness for the treatment of method, by this method and apoptosis of tumor cells medicine
Or treatment method use in conjunction can dramatically increase antitumor curative effect.Using the strategy, tumor tissues or cell are efficiently solved
To the problem of Apoptosis treatment resistance, the purpose of effective treatment tumour is reached.
4th, illustrate
Fig. 1 .RNA perturbation techniques lower intracellular HSP70 expression.
Intracellular HSP70 mRNA level in-site after the detection RNA interference of 1A.RT-PCR methods：1、psiLUC;2、psiHSP70.
Quantitative analysis horizontal intracellular HSP70mRNA after 1B.RNA interference（* P ＜ 0.05）：1、psiLUC;2、
psiHSP70。
The expression of 1C. intracellular HSP70 albumen after HSP70 antibody Western blot detection RNA interference：1、
psiLUC;2、psiHSP70。
The quantitative analysis of intracellular HSP70 protein expression levels after 1D.RNA interference（* P ＜ 0.05）：1、psiLUC;2、
psiHSP70。
The intracellular HSP70 expression of Fig. 2, which is lowered, enhances the A549 cells sensitiveness apoptosis-induced to TRAIL, it is suppressed that
The clonality of A549 cells.
2A. flow cytomery A549 cells are individually handled through psiLUC, psiHSP70 and TRAIL or Combined Treatment
The apoptosis rate of cell afterwards（* P ＜ 0.05)：1、PBS;2、psiLUC;3、psiHSP70;4、PBS+TRAIL;5、psiLUC+
TRAIL;6、psiHSP70+TRAIL。
2B.Tunel apoptosis detection kit detect A549 cells through psiLUC, psiHSP70 and TRAIL individually processing or
The apoptosis situation of cell after person's Combined Treatment.1、A549;2、A549+psiLUC；3、A549+psiHSP70（* P ＜ 0.05）.
TRAIL after the psiLUC or psiHSP70 of 2C.A549 cell transfecting various doses（40ng/ml）The cell of induction withers
Die rate.1、psiLUC;2、psiHSP70.
After 2D.A549 cell transfectings 0.5 μ gpsiLUC or psiHSP70, the Apoptosis of the TRAIL inductions of various dose
Rate（* P ＜ 0.05）.
Clone's shape of 2E.A549 cells cell after the independent processing of psiLUC, psiHSP70 and TRAIL or Combined Treatment
Determined into ability.1、A549;2、A549+psiLUC；3、A549+psiHSP70（* P ＜ 0.05）.
Fig. 3 .RNA perturbation techniques lower intracellular HSP27 expression.
Intracellular HSP27 mRNA level in-site after the detection RNA interference of 3A.RT-PCR methods：1、psiLUC;2、psiHSP27.
Quantitative analysis horizontal intracellular HSP27mRNA after 3B.RNA interference（* P ＜ 0.05）：1、psiLUC;2、
psiHSP7027。
The expression of 3C. intracellular HSP27 albumen after HSP27 antibody Western blot detection RNA interference：1、
psiLUC;2、psiHSP27。
The quantitative analysis of intracellular HSP27 protein expression levels after 3D.RNA interference（* P ＜ 0.05）：1、psiLUC;2、
psiHSP27。
The intracellular HSP70 expression of Fig. 4, which is lowered, enhances the A549 cells sensitiveness apoptosis-induced to TRAIL, it is suppressed that
The clonality of A549 cells.
4A. flow cytomery A549 cells are individually handled through psiLUC, psiHSP70 and TRAIL or Combined Treatment
The apoptosis rate of cell afterwards（* P ＜ 0.05)：1、PBS;2、psiLUC;3、psiHSP27;4、PBS+TRAIL;5、psiLUC+
TRAIL;6、psiHSP27+TRAIL。
4B.Tunel apoptosis detection kit detect A549 cells through psiLUC, psiHSP27 and TRAIL individually processing or
The apoptosis situation of cell after person's Combined Treatment.1、A549;2、A549+psiLUC；3、A549+psiHSP27（* P ＜ 0.05）.
TRAIL after the psiLUC or psiHSP27 of 4C.A549 cell transfecting various doses（40ng/ml）The cell of induction withers
Die rate.1、psiLUC;2、psiHSP27.
After 4D.A549 cell transfectings 0.5 μ g psiLUC or psiHSP27, the Apoptosis of the TRAIL inductions of various dose
Rate（* P ＜ 0.05）.
Clone's shape of 4E.A549 cells cell after the independent processing of psiLUC, psiHSP27 and TRAIL or Combined Treatment
Determined into ability.1、A549;2、A549+psiLUC；3、A549+psiHSP27（* P ＜ 0.05）.
The regulation and control and influence of Fig. 5 .HSP70, HSP27 low expressions on associated downstream signaling molecule.
5A.Western blot detection A549 cells are individually handled through psiLUC, psiHSP70, psiHSP27 and TRAIL
Or intracellular Bcl-2 family proteins after Combined Treatment（Bcl-2、Bax、Bad、Bid）Expression:1、psiHSP70+TRAIL;
2、psiHSP27+TRAIL;3、psiLUC+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
5B.Western blot technology for detection A549 cells are independent through psiLUC, psiHSP70, psiHSP27 and TRAIL
NF- κ B p65 in I κ B α and NF- κ B p65 protein expression level and nucleus in cytoplasm after processing or Combined Treatment
Protein expression level.Using GAPDH as internal standard in cytoplasm, internal standard is used as using Lamin B in nucleus：1、psiHSP70+
TRAIL;2、psiHSP27+TRAIL;3、psiLUC+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
5C.Western blot technology for detection A549 cells are independent through psiLUC, psiHSP70, psiHSP27 and TRAIL
Intracellular c-FLIP-L protein expression level after processing or Combined Treatment.1、psiHSP70+TRAIL;2、psiHSP27+
TRAIL;3、psiLUC+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
5D.Western blot technology for detection A549 cells are independent through psiLUC, psiHSP70, psiHSP27 and TRAIL
Intracellular p53 and phosphorylation p53 protein expression level after processing or Combined Treatment：1、psiHSP70+TRAIL;2、
psiHSP27+TRAIL;3、psiLUC+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
5E.Western blot technology for detection A549 cells are independent through psiLUC, psiHSP70, psiHSP27 and TRAIL
Intracellular c-JUN, phospho-c-JUN, JNK, phospho-JNK protein expression level after processing or Combined Treatment.1、
psiHSP70+TRAIL;2、psiHSP27+TRAIL;3、psiLUC+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
Fig. 6 .A549 cells are thin after the independent processing of psiLUC, psiHSP70, psiHSP27 and TRAIL or Combined Treatment
Intracellular DR4, DR5mRNA and protein level change
6A.RT-PCR technology for detection A549 cells through psiLUC, psiHSP70, psiHSP27 and TRAIL individually processing or
Intracellular DR4 and DR5 mRNA transcriptional level after person's Combined Treatment.1、psiHSP70+TRAIL;2、psiHSP27+TRAIL;
3、psiLUC+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
6B. Fig. 6 A quantitative analysis（*P<0.05）.1、psiHSP70+TRAIL;2、psiHSP27+TRAIL;3、psiLUC
+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
6C.Western blot technology for detection A549 cells are independent through psiLUC, psiHSP70, psiHSP27 and TRAIL
Intracellular DR4 and DR5 protein expression level after processing or Combined Treatment.1、psiHSP70+TRAIL;2、psiHSP27+
TRAIL;3、psiLUC+TRAIL;4、TRAIL;5、psiHSP27;6、psiHSP70。
Dystopy animal model for tumour analysis RNA interference causes antitumor associated with HSP70 low expressions and TRAIL control in Fig. 7 bodies
Therapeutic effect.
7A. tumor growth curves（*P<0.05）.1st, PBS control；2nd, psiLUC is compareed；3、TRAIL；4、psiHSP70；5、
psiLUC+TRAIL；6、psiHSP70+TRAIL.
DR4, DR5 mRNA level in-site in 7B. tumor tissues.1st, PBS control；2nd, psiLUC is compareed；3、TRAIL；4、
psiHSP70；5、psiLUC+TRAIL；6、psiHSP70+TRAIL.
Dystopy animal model for tumour analysis RNA interference causes antitumor associated with HSP27 low expressions and TRAIL control in Fig. 8 bodies
Therapeutic effect.
8A. tumor growth curves（*P<0.05）:1st, PBS control；2nd, psiLUC is compareed；3、TRAIL；4、psiHSP27；5、
psiLUC+TRAIL；6、psiHSP27+TRAIL.
DR4, DR5 mRNA level in-site in 8B. tumor tissues:1st, PBS control；2nd, psiLUC is compareed；3、TRAIL；4、
psiHSP27；5、psiLUC+TRAIL；6、psiHSP27+TRAIL.
Three kinds of non-small cell lung cancer cell NSCLC of Fig. 9 flow cytomeries（A549, SW1573 and H460）Through
The apoptosis rate of cell after the independent processing of psiLUC, psiHSP70 and TRAIL or Combined Treatment（* P ＜ 0.05）.1、PBS;2、
psiLUC;3、psiHSP70;4、PBS+TRAIL;5、psiLUC+TRAIL;6、psiHSP70+TRAIL。
The analysis RNA interference of Figure 10 internal in-situs lung cancer animal models is caused associated with HSP70 and HSP27 low expressions and TRAIL
Antineoplaston effect.
10A. luciferase activities detect lung cancer growth curve.1st, PBS control；2、TRAIL；3、psiHSP27；4、
psiHSP70；5、psiHSP27+TRAIL；6、psiHSP70+TRAIL.
10B. internal in-situ lung cancer animal models Survivals.1st, PBS control；2、TRAIL；3、psiHSP27；4、
psiHSP70；5、psiHSP27+TRAIL；6、psiHSP70+TRAIL.
5th, embodiment：
Embodiment one
The expression of HSP70 in tumour cell or tissue, use in conjunction antineoplastic TRAIL are lowered with RNA perturbation techniques
Inducing apoptosis of tumour cell, treatment mouse A549 solid tumor models are embodiment：
1st, the structure of HSP70 interference plasmids：
Suitable target sequence is selected out of HSP70 sequences using the software siRNA target finder of Genscript companies
Row, are then constructed with the software siRNA Construct Builder of Genscript companies and may be coupled to carrier again
The pRNAT-U6.1/Neo DNA fragmentation for being used to disturb.The DNA fragmentation includes positive-sense strand（Sense strand, with target sequence
It is identical）, hairpin structure, antisense strand（Antisense strand, it is complementary with positive-sense strand）, can make tanscription termination positioned at 3' ends
Poly T signals；In addition, for the ease of being connected with carrier pRNAT-U6.1/Neo, BamH I are with the addition of respectively at both ends（G↓
GATCC）、Hind III（A↓AGCTT）Restriction enzyme site.Done by what Gensicript company softwares were designed for HSP70RNA
The fragment disturbed is as follows：5'-GGATCCCGGACGAGTTTGAGCACAAGTTGATATCCGCTTGTGCTCAAACT CGTC
CTTTTTTCCAAAAGCTT-3'.Two complementary single strands of designed interference sequence are by Shen Neng lottery industries bio tech ltd
Synthesis.Two fragment sequence is respectively：
5'-GATCCCGGACGAGTTTGAGCACAAGTTGATATCCGCTTGTGCTCAAA
CTCGTCCTTTTTTCCAAA-3'；
5'-AGCTTTTGGAAAAAAGGACGAGTTTGAGCACAAGCGGATATCAACT
TGTGCTCAAACTCGTCCGG-3'。
This experiment is from carriers of the pRNA-U6.1/Neo as expression HSP70 RNA interferings.Two silvers that company is synthesized
Disconnected annealing obtains double-stranded DNA, vector plasmid pRNAT-U6.1/neo BamHI and HindIII digestion with restriction enzyme, annealing
Plasmid after rear dsDNA and digestion is connected with T4DNA ligases so as to obtain HSP70 interference plasmid psiHSP70.Will be even
Thing of practicing midwifery conversion Top10 competence bacterium amplification, with Ampcillin plate screenings and the bacterium colony of recombinant plasmid is converted.Use PCR
The positive colony that identifies simultaneously gives the sequencing of Shanghai betting office.Sequencing result is showing HSP70 RNA interference plasmids structure just
Really.Specific steps are as follows with condition：
Two complementary single strands of synthesis anneal to obtain dsDNA.Annealing steps are specific as follows：1 μ l positive-sense strand fragments（1μg/μ
l）, 1 μ l antisense strand fragments（1μg/μl）, 1 20 × SSC of μ l, 17 μ l ddW, 95 DEG C are placed in after mixing 10 minutes, then 25 DEG C 1
Hour, last diluted mixture to final concentration of 40ng/ μ l（1.25 dilute again）, -20 DEG C of storages are standby.
The digestion condition of plasmid vector is as follows：Distilled water（ddW）49 μ l, Buffer K 6,1 μ of μ l, pRNAT-U6.1/Neo
l（1μg/μl）, BamH I2 μ l, Hind III2 μ l, 60 μ l digestions 37 DEG C of system digestions 3 hours.Then the centrifugal agar of 3S posts
Sugared DNA rapidly purifies kit recovery purpose carrier segments in a small amount.
The condition of contact of DNA segment and plasmid vector is as follows：The carrier of 2 μ l digestion, 6 μ l annealed products, 3 μ lT4DNA connect
Enzyme buffer liquid is connect, 1 μ l BSA, 2 μ l T4DNA ligases, 25 DEG C are reacted 3 hours after 16 μ l ddW are mixed, and -20 DEG C of storages are standby.
2nd, the interference effect of HSP70 interference plasmids and its with TRAIL combination cellular level induce A549 Apoptosis energy
The detection of power：
(1) HSP70 interference plasmids interference effect is analyzed：A549 cell culture is in the DMEM containing 10% NBCS（Contain
100U/ml penicillin and 100 μ g/ml streptomysins）In, and 37 DEG C are placed, grown in 5%CO2 incubator.24 is small before transfection
When, the cell in exponential phase is taken, with every hole 1 × 10 after pancreatin digestion5Individual cell is inoculated in 24 orifice plates, adds 1ml per hole
Complete culture solution, culture plate is moved into incubator, cultivated 24 hours.When cell confluency degree reaches 70%, nutrient solution is removed, is used
The volume for having stood 10-15 minutes prepared is 100 μ l transfection composite（100 μ l PBS, 2 μ g plasmids, 3 μ
GGenEscort Reagent transfection reagents）, the nutrient solution of 200 μ l serum-frees and antibiotic-free is added, is amounted to after mixing
300 μ l transfection liquid, is then respectively adding in hole, per the μ l transfection liquids of hole 300.By solution in 24 orifice plates after 37 DEG C of cultures 4 hours
Suction out, 1ml complete culture solutions are added per hole, continue culture 48 hours, harvesting carries out blot points of RT-PCT and western
Analysis.
RT-PCR:Transfection collects cell after 48 hours, and PBS washed once.Add 1ml Trizol（106Individual cell）, use
Rifle is blown and beaten to cell and is completely dissolved.Room temperature is placed 5 minutes.200 μ l chloroform/mlTrizol is added, vibration places 2-3 after 15 seconds
Minute, 12000g is centrifuged 15 minutes, 2-8 DEG C.Upper strata is drawn, is transferred in clean eppendorf pipes, adds 500 μ l isopropanols,
Place 10 minutes, 12000g is centrifuged 10 minutes, 2-8 DEG C.It can be seen that RNA precipitate.Supernatant discarding, it is heavy to add the washing of 1ml75% ethanol
Form sediment, 7500g is centrifuged 5 minutes, dries RNA precipitate in atmosphere, adds the DDW dissolvings of 30 μ l DEPC processing.Reversed using 25 μ l
Record system, the μ l of template ribonucleic acid 5 of extraction and 9.5 μ l oligo (dT) are mixed, 70 DEG C are denatured 5 minutes, are immediately transferred into and put on ice
Put 5 minutes.Then add 5 2.5 μ l, RNase Inhibitor of μ l, dNTP of AMV buffer 1 μ l, AMV Reverse
The μ l of Transcriptase 2,42 DEG C of water-baths 1 hour after mixing.Take the cDNA of equivalent to do template and do PCR amplifications, using 20 μ
L PCR reaction systems：μ l, dNTP2 μ l, Mg2+1 μ l, DDW11.5 the μ l of 10 × Taq buffer 2, the μ l of sense primer 1, downstream is drawn
1 μ l, cDNA template of thing 1,0.5 μ l of μ l, Taqpolymerase.PCR conditions：94 DEG C of thermal denaturations 4 minutes, 94 DEG C are denatured 40 seconds, and 55
DEG C annealing 40 seconds, 72 DEG C extend 40 seconds, period be 25, it is last 72 DEG C extend 7 minutes.PCR primer carries out 2% agarose and coagulated
Gel electrophoresis, EB colour developings.Specific primer used is：
HSP70 positive-sense strands：5'-GTGCCGGCCTACTTCAACGACTC-3′；
HSP70 antisense strands：5'-GCTGGCCTGGGTGCTGGACGACA-3′；
GAPDH positive-sense strands：5'-AACGACCCCTTCATTGAC-3′；
GAPDH antisense strands：5'-TCCACGACATACTCAGCAC-3′.
Western blot：Transfection collects cell after 48 hours, after with the PBS of precooling, cell precipitation washed once, adds
Enter cell pyrolysis liquid mixing, after placing 30 minutes on ice, 12000rpm is centrifuged 15 minutes, draws supernatant, is carried out by examining dye method
Protein quantification, is eventually adding 4 × loading buffer boiling water baths 10 minutes, and sample just prepares completion, can be with -20 DEG C of preservations.
12%SDS-PAGE glue is prepared according to the formula in molecular cloning, by the sample protein cubage of measure, is kept as far as possible
Each sample applied sample amount is consistent, and applied sample amount is 50 μ g.It is separated by electrophoresis using constant pressure, then using semidry method by PAGE glue
Albumen is transferred on pvdf membrane, and constant current 1mA/cm2 electricity turns 3 hours.Transfer is dyed after terminating with Ponceau S to film, until
There is red protein band, mark Marker position.Then 5% skimmed milk power is prepared（PBST is prepared）Film is wrapped
Quilt, can be with 4 DEG C of closings overnight or 25 DEG C of room temperatures 1 hour.After coating terminates, milk is washed away with PBST, illustrated according to antibody
Primary antibody is diluted with PBST（primary antibody）To best effort concentration, by film primary antibody coating incubation at room temperature 1 hour or 4 DEG C
Overnight.Then film is placed on shaking table, washed 5 times with PBST, each 5-10 minutes.It is in next step coating secondary antibody, by HRP（It is peppery
Root peroxidase）The secondary antibody 1 of mark:2000PBST dilutes, and after being incubated 1 hour jointly with film, same PBST washs 5 times, often
Secondary 5-10 minutes.Finally, prepare luminous substrate solution according to the description of product to be added dropwise on pvdf membrane, room temperature places 1-2 minutes, uses
Filter paper blots unnecessary luminescent solution, and piece pressing clip is put into after film is coated with preservative film and moves into dark place, takes X-ray to be placed on film and exposes
After 1-5 minutes, develop photographic film, the expression of results of albumen is judged according to exposure band.
(2) HSP70 interference induces the detection of A549 Apoptosis abilities with TRAIL combinations in cellular level：
A, flow cytomery Apoptosis：HSP70 interference plasmids are passed through into GenEscort Reagent transfection reagents
It is transfected into A549 cells, TRAIL inducing cell apoptosis is added after 24 hours, the cell after 18 hours after harvest processing, is resuspended
In 100 μ l sample buffer, vibrate while 70% ethanol 1ml of precooling is added dropwise, 4 DEG C of fixations are overnight.Then
3000rpm is centrifuged 5 minutes, sucks supernatant, adds 1mlPI dyeing liquors, room temperature avoid light place more than 30 minutes, small 24 after mixing
When interior detection.Using cellquest software collections data and analyzed.
B, TUNEL kit detection cell apoptosis:HSP70 interference plasmids are transfected by GenEscort Reagent and tried
Agent is transfected into A549 cells, and TRAIL inducing cell apoptosis is added after 24 hours, the cell after 18 hours after harvest processing, and 4%
Paraformaldehyde is fixed, TUNEL kits（Merck KGaA company）Detect Apoptosis.Compare HSP70 interference plasmids whether to transfect
Influence to the apoptosis-induced effects of TRAIL, if good every parallel control.
(3) HSP70 interference is combined the impact analysis to A549 Cell clonalities with TRAIL：Colony formation
Detect the front and rear drug susceptibility to TRAIL of A549 cell transfecting HSP70 interference plasmids.The transfection of about 300 exponential phases
Cell（Transfectional cell is not set to compare）In the plate for assigning to 60mm（If 3 parallel laboratory tests）, treat that cell is complete after 48 hours
TRAIL processing cells are added after adherent, after 48 hours, cell changes complete medium culture 14 days, changes within every 5 days and once cultivates
Base.Culture in 14 days carries out Giemsa dyeing after terminating, and counts the number of cell clones in each plate（Colonies more than 30 cells
It can be regarded as a clone）.Compare the clonality of A549 cells that whether HSP70 interference plasmids transfect after TRAIL processing,
Calculate and lower increase multiple of the cell to TRAIL Susceptibility after HSP70 is expressed.
Susceptibility increase multiple calculation formula is as follows：
A1=(the plastidogenetic clone number-TRAIL after psiHSP70 transfections and cell after psiHSP70 Combined Treatments
Clone's number of formation)/psiHSP70 transfection after plastidogenetic clone's number
A2=(plastidogenetic clone's number-TRAIL of untransfected individually the number of cell clones after processing)/untransfected it is thin
Clone's number that born of the same parents are formed
Susceptibility increases multiple=A1/A2
3rd, HSP70 interference plasmids and TRAIL combinations are analyzed to A549 cell receptors apoptosis pathway and mitochondrial apoptosis path
The influence of upper key protein：
HSP70 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids are added, crack 30 on ice
Minute, be then centrifuged for and quantitative, after sample-loading buffer is added, make sample, with caspase-8, caspase-3, caspase-9,
PARP, Bcl-2, Bax, Bid, Bad, cytochrome c specific antibody carry out each albumen of western blot technical Analysis
Expression situation of change
4th, the expression of HSP70 interference plasmids and A549 cells TRAIL receptor protein DR4 and DR5 after TRAIL combinations is analyzed
Change
HSP70 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, a part of cell extraction RNA, reverse transcription, RT-
DR4 and DR5 mRNA level in-site in round pcr analysis cell；Another part cell adds RIPA cell pyrolysis liquids, cracks on ice
30 minutes, it is then centrifuged for and quantitative, after sample-loading buffer is added, makees sample, carried out with DR4 and DR5 specific antibody
Western blot technical Analysis DR4 and DR5 protein level
5th, the influence of HSP70 interference plasmids and NF- κ B signal paths intracellular to A549 after TRAIL combinations is analyzed：
HSP70 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, with nucleus reagent preparation box（Try in the future in Shanghai
Agent Co., Ltd）Cytoplasm and Nuclear extract are prepared, after being then respectively adding sample-loading buffer, makees sample, with NF- κ B p65, I
κ B α, GAPDH and Lamin B specific antibody carry out each albumen of western blot technical Analysis in cytoplasm and nucleus
Interior expression situation of change.
6th, the shadow of HSP70 interference plasmids and c-FLIP-L protein expression levels intracellular to A549 after TRAIL combinations is analyzed
Ring：
HSP70 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids is added, cracks 30 on ice
Minute, it is then centrifuged for and quantitative, after sample-loading buffer is added, makees sample, western is carried out with c-FLIP-L specific antibody
The expression situation of change of blot technical Analysis albumen.
7th, p53 intracellular to A549 and phosphorylation p53 protein expression water after analysis HSP70 interference plasmids and TRAIL are combined
Flat influence：
HSP70 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids is added, cracks 30 on ice
Minute, it is then centrifuged for and quantitative, after sample-loading buffer is added, sample is made, with p53 and phosphorylation p53（81 threonine sites）
Specific antibody carry out western blot technical Analysis albumen expression situation of change.
8th, the influence of HSP70 interference plasmids and JNK signal paths intracellular to A549 after TRAIL combinations is analyzed：
HSP70 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids is added, cracks 30 on ice
Minute, be then centrifuged for and quantitative, after sample-loading buffer is added, make sample, with c-JUN, phospho-c-JUN, JNK,
Phospho-JNK specific antibody carries out the expression situation of change of western blot technical Analysis albumen.
9th, the gene therapy of use in conjunction HSP70 interference plasmids and the antitumor efficiency analysis of TRAIL drug therapies：
(1) foundation of nude mice A549 solid tumors subcutaneous model：
A549 cells are suspended into concentration as 5 × 10 with PBS6Individual/ml, then dorsal sc warp is subcutaneous on the right side of every nude mice
Inject 100 μ L（5×105Cell）, pay attention to observing the growing state of tumour, about at one week or so, in situ tumor size grows
To about 125mm3When, mouse is divided into six groups according to the difference for the treatment of method, every group 8, starts to treat.Six groups of therapeutic modality
Respectively：1）Blank control group（Any treatment is not done）；2）SiRNA pRNT-U6.1 empty plasmids compare（psiLUC）Injection is controlled
Treat；3）TRAIL drug therapies；4）HSP70 interference plasmids（psiHSP70）Injection treatment；5）SiRNA pRNT-U6.1 zero load matter
Grain（psiLUC）Control+TRAIL therapeutic alliances；6）HSP70 interference plasmids（psiHSP70）+ TRAIL therapeutic alliances.Interference plasmid
Gene therapy mode：Every treatment in 5 days once, treat 3 times altogether.Specific method is that the interference plasmid that will be mixed tries with transfection
Agent composition is injected directly into tumor tissues, and treatment first is 20 μ l of injection（5 μ l HSP70 interference plasmids（1μg/μl）, 5l
GenEscort Reagent transfection reagents（1μg/μl）, 10 μ l PBS）Mixture, rear two treatments are 40 μ l of injection（10μl
HSP70 interference plasmids（1μg/μl）, 10 μ l GenEscort Reagent transfection reagents（1μg/μl）, 20 μ l PBS）Mixture.
Start TRAIL intraperitoneal injection treatments after interference plasmid gene therapy first, inject once daily, per injection 100 μ g, Yi Gongzhi
Treat 14 days.
(2) interference plasmid transfection efficiency is identified in solid tumor：
Treat that tumor size grows to about 125mm3, start in knurl internal injection psiLUC（Unloaded interference plasmid）Tried with transfection
The mixture of agent, after injection the 0th, 1,2,3,4,5 day, tumor tissue section is taken, transfection is directly observed under fluorescence microscope
Efficiency
(3) tumor growth curve is analyzed：
From GP TH is started, tumor size is measured within every two days, and gross tumor volume is calculated by following equation：0.5236×L1
×(L2)2, wherein L1 is tumour major axis, and L2 is tumour short axle.Start after treating the 17th day, put to death mouse.And pass through recurrence side
Journey calculates tumor growth curve.
(4) DR4 and DR5 expression is analyzed in tumor tissues：
Tumor tissues are taken within the 15th day after oncotherapy, Trizol is added, RNA is extracted after homogenate, it is special with DR4 and DR5
The primer of the opposite sex carries out RT-PCR experiments, analyzes the mRNA level in-site of DR4 and DR5 in tumor tissues.
DR4 specific primers are：5'-CCGCGGCCACACCCAGCAAAGT-3' and 5'-
GCAGCAGGACCCCGACGACGACA-3'；
DR5 specific primers are：5'-GTGGGGACCCTGAGCGTGTG-3' and 5'-
CTCCAAGGCATCCAGCAGGGTGTG-3'
Embodiment two：
The expression of HSP27 in tumour cell or tissue, use in conjunction antineoplastic TRAIL are lowered with RNA perturbation techniques
Inducing apoptosis of tumour cell, treatment mouse A549 solid tumor models are embodiment：
1st, the structure of HSP27 interference plasmids：
The design of HSP27 interference plasmids is with construction method with described in embodiment one.Designed by Gensicript company softwares
The fragment for being used for HSP27 RNA interference gone out is as follows：5'-
GGATCCCGTCTCATCGGATTTTGCAGTTGATATCCGCTGCAAAATCCGATGAGACT TTTTTCCAAAAGC-3', by Shen
Can two bar segment sequences of lottery industry bio tech ltd synthesis be：5'-
GATCCCGTCTCATCGGATTTTGCAGTTGATATCCGCTGCAAAATCCGATGAGACTT TTTTCCAAA-3' and 5'-
AGCTTTTGGAAAAAAGTCTCATCGGATTTTGCAGCGGATATCAACTGCAAAATCCGATGAGACGG-3'。
2nd, the interference effect of HSP27 interference plasmids and its with TRAIL combination cellular level induce A549 Apoptosis energy
The detection of power：
(1) HSP27 interference plasmids interference effect is analyzed：Cell transfecting and processing method are entered respectively with described in embodiment one
Row RT-PCT and western blot analyze its interference effect.Specific primer is used in RT-PCR：
HSP27 positive-sense strands:5'-CGCGCTCAGCCGGCAACTCAG-3'；
HSP27 antisense strands:5'-CGGCAGCAGGGGTGGGCATCC-3'；
GAPDH positive-sense strands:5'-AACGACCCCTTCATTGAC-3'；
GAPDH antisense strands:5'-TCCACGACATACTCAGCAC-3'；
(2) HSP27 interference induces the detection of A549 Apoptosis abilities with TRAIL combinations in cellular level：
A, flow cytomery Apoptosis：Method is the same as described in embodiment one.
B, TUNEL kit detection cell apoptosis:Method is the same as described in embodiment one.
(3) HSP27 interference is combined the impact analysis to A549 Cell clonalities with TRAIL：Colony formation
Detect the front and rear drug susceptibility to TRAIL of A549 cell transfecting HSP27 interference plasmids.Method is the same as described in embodiment one.
3rd, HSP27 interference plasmids and TRAIL combinations are analyzed to A549 cell receptors apoptosis pathway and mitochondrial apoptosis path
The influence of upper key protein：
HSP27 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids is added, cracks 30 on ice
Minute, be then centrifuged for and quantitative, after sample-loading buffer is added, make sample, with caspase-8, caspase-3, caspase-9,
PARP, Bcl-2, Bax, Bid, Bad, cytochromec specific antibody carry out each albumen of western blot technical Analysis
Expression situation of change.
4th, the expression of HSP27 interference plasmids and A549 cells TRAIL receptor protein DR4 and DR5 after TRAIL combinations is analyzed
Change：
HSP27 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, a part of cell extraction RNA, reverse transcription, RT-
DR4 and DR5 mRNA level in-site in round pcr analysis cell；Another part cell adds RIPA cell pyrolysis liquids, cracks on ice
30 minutes, it is then centrifuged for and quantitative, after sample-loading buffer is added, makees sample, carried out with DR4 and DR5 specific antibody
Western blot technical Analysis DR4 and DR5 protein level.
5th, the influence of HSP27 interference plasmids and NF- κ B signal paths intracellular to A549 after TRAIL combinations is analyzed：
HSP27 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, with nucleus reagent preparation box（Try in the future in Shanghai
Agent Co., Ltd）Cytoplasm and Nuclear extract are prepared, after being then respectively adding sample-loading buffer, makees sample, with NF- κ B p65, I
κ B α, GAPDH and Lamin B specific antibody carry out each albumen of westernblot technical Analysis in cytoplasm and nucleus
Expression situation of change.
6th, the shadow of HSP27 interference plasmids and c-FLIP-L protein expression levels intracellular to A549 after TRAIL combinations is analyzed
Ring：
HSP27 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids is added, cracks 30 on ice
Minute, it is then centrifuged for and quantitative, after sample-loading buffer is added, makees sample, western is carried out with c-FLIP-L specific antibody
The expression situation of change of blot technical Analysis albumen.
7th, p53 intracellular to A549 and phosphorylation p53 protein expression water after analysis HSP27 interference plasmids and TRAIL are combined
Flat influence：
HSP27 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids is added, cracks 30 on ice
Minute, it is then centrifuged for and quantitative, after sample-loading buffer is added, sample is made, with p53 and phosphorylation p53（81 threonine sites）
Specific antibody carry out western blot technical Analysis albumen expression situation of change.
8th, the influence of HSP27 interference plasmids and JNK signal paths intracellular to A549 after TRAIL combinations is analyzed：
HSP27 interference plasmids are transfected into A549 cells by GenEscort Reagent transfection reagents, after 24 hours
TRAIL inducing cell apoptosis is added, the cell after 18 hours after harvest processing, RIPA cell pyrolysis liquids is added, cracks 30 on ice
Minute, be then centrifuged for and quantitative, after sample-loading buffer is added, make sample, with c-JUN, phospho-c-JUN, JNK,
Phospho-JNK specific antibody carries out the expression situation of change of western blot technical Analysis albumen.
9th, the gene therapy of use in conjunction HSP27 interference plasmids and the antitumor efficiency analysis of TRAIL drug therapies：
(1) foundation of nude mice A549 solid tumors subcutaneous model：
A549 cells are suspended into concentration as 5 × 10 with PBS6Individual/ml, then dorsal sc warp is subcutaneous on the right side of every nude mice
Inject 100 μ L（5×105cell）, pay attention to observing the growing state of tumour, about at one week or so, in situ tumor size grows
To about 125mm3When, mouse is divided into six groups according to the difference for the treatment of method, every group 8, starts to treat.Six groups of therapeutic modality
Respectively：1）Control group（Any treatment is not done）；2）SiRNA pRNT-U6.1 empty plasmids compare（psiLUC）Injection treatment；
3）TRAIL drug therapies；4）HSP27 interference plasmids（psiHSP27）Injection treatment；5）SiRNA pRNT-U6.1 empty plasmids
（psiLUC）+ TRAIL therapeutic alliances；6）HSP27 interference plasmids（psiHSP27）+ TRAIL therapeutic alliances.Interference plasmid gene is controlled
Treatment mode：Every treatment in 5 days once, treat 3 times altogether.Specific method is that the interference plasmid that will be mixed mixes with transfection reagent
Thing is injected directly into tumor tissues, and treatment first is 20 μ l of injection（5 μ l interference plasmids（1μg/μl）, 5 μ l GenEscort
Reagent transfection reagents（1μg/μl）, 10 μ l PBS）Mixture, rear two treatments are 40 μ l of injection（10 μ l interference plasmids（1μ
g/μl）, 10 μ l GenEscort Reagent transfection reagents（1μg/μl）, 20 μ l PBS）Mixture.Interference plasmid gene first
Start TRAIL intraperitoneal injection treatments after treatment, inject once daily, per injection 100G, treat 14 days altogether.
(2) interference plasmid transfection efficiency is identified in solid tumor：Method is the same as described in embodiment one.
(3) tumor growth curve is analyzed：Method is the same as described in embodiment one.
(4) DR4 and DR5 expression is analyzed in tumor tissues:：
Tumor tissues are taken within the 15th day after oncotherapy, Trizol is added, RNA is extracted after homogenate, it is special with DR4 and DR5
The primer of the opposite sex carries out RT-PCR experiments, analyzes the mRNA level in-site of DR4 and DR5 in tumor tissues.
Embodiment three：
HSP70 disturbs induces a variety of non-small cell lung cancer cell NSCLC with TRAIL combinations in cellular level（A549,
SW1573 and H460）The detection of apoptosis capacity（Flow cytomery Apoptosis）：
It is thin that HSP70 interference plasmids by GenEscort Reagent transfection reagents are transfected into A549, SW1573 and H460
In born of the same parents, TRAIL inducing cell apoptosis is added after 24 hours, the cell after 18 hours after harvest processing, is resuspended in 100 μ l's
In sample buffer, vibrate while 70% ethanol 1ml of precooling is added dropwise, 4 DEG C of fixations are overnight.Then 3000rpm centrifugations 5
Minute, supernatant is sucked, 1ml PI dyeing liquors is added, room temperature avoid light place more than 30 minutes after mixing, was detected in 24 hours.Make
With cellquest software collections data and analyzed.
Example IV：
Use in conjunction HSP70, HSP27 low expression is treated anti-with TRAIL drug therapies on lung cancer situ tumor model
Tumour efficiency analysis：
1st, the foundation of nude mice A549 solid tumors model in situ：
Nude mice, 6-7 week old, female.By the A549-luc-c8 cells with luciferase with PBS be suspended into concentration for 7 ×
107Individual/ml, after determination of trypan blue staining activity, by 30 μ l cell suspensions and 30 μ l matrigels（Matrigel）Mix, fast
With insulin injection syringe by suspension after totally 60 μ l slowly puncture inserting needle about 8mm along the intercostal of nude mice left scapular line the 6th before solidification
To pulmonary injection, every experiment nude inoculation cell number about 2 × 106It is individual.After inoculation, using the Caliper petty actions of Cold SpringHarbor company
Thing living imaging instrument observes the growing state of lung tumors cell, after being inoculated with two weeks, according to the different by mouse point for the treatment of method
Into six groups, every group 8, start to treat.Six groups of therapeutic modality is respectively：1）Control group（Any treatment is not done）；2）TRAL medicines
Thing is treated；3）HSP27 interference plasmids（psiHSP27）Injection treatment；4）HSP70 interference plasmids（psiHSP70）Injection treatment；5）
HSP27 interference plasmids（psiHSP27）+ TRAIL therapeutic alliances；6）HSP70 interference plasmids（psiHSP70）+ TRAIL, which combines, to be controlled
Treat.Interference plasmid gene therapy mode：Every treatment in 5 days once, treat 3 times altogether.Specific method is the interference that will be mixed
Plasmid is injected directly into tumor tissues with transfection reagent mixtures, the μ l of per injection 20（5 μ l HSP70 or HSP27 disturb matter
Grain（1μg/μl）, 5 μ lGenEscort Reagent transfection reagents（1μg/μl）, 10 μ l PBS）Mixture.Interference plasmid first
Start TRAIL intraperitoneal injection treatments after gene therapy, injection daily once, the μ gg of per injection 100, is treated 21 days altogether.
2nd, tumor growth curve is analyzed：Since after tumor cell transplantation, observed with small animal living body imager weekly swollen
The growing state of knurl, measure the activity of luciferase（Number of photons per second）, and pass through regression equation calculation tumor growth curve.
3rd, tumor-bearing mice survival Analysis：It is daily to monitor mouse survival situation until swollen since after tumor cell transplantation
The 75th day after oncocyte transplanting.
Foregoing invention embodiment is fully shown：It can increase present invention finds expression, quantity and the activity for lowering HSP70 swollen
Oncocyte is to the sensitiveness of Apoptosis and strengthens the antineoplaston effect of antineoplastic.Lowered using RNA perturbation techniques
HSP70 mRNA and protein level expression in A549 tumour cells（Fig. 1）, in low dosage（40ng/μl）TRAIL is induced
Afterwards, flow cytometer and the detection of TUNEL apoptosis are found that the expression for lowering HSP70 in A549 tumour cells enhances tumour cell
To TRAIL sensitiveness, the apoptosis rate of cell is added（Fig. 2）.Also, under 40ng/ μ l TRAIL inductions, apoptosis rate
PsiHSP70 interference plasmids amount with transfection is in dose-dependence（Fig. 2）.Similarly, a certain amount of psiHSP70 is being transfected
（0.5μg）Afterwards, apoptosis rate and TRAIL dosage are in dose-dependence（Fig. 2）.Colony formation shows psiHSP70
The clonality of A549 cells is significantly suppress with TRAIL Combined Treatments（Fig. 2）, HSP70 expression, which is lowered, makes A549 thin
Born of the same parents add 52.5 times to TRAIL Susceptibility（Fig. 2）.
It has also been found that tumour cell can be increased to the quick of Apoptosis by lowering HSP27 expression, quantity and activity
Perception.The expression of HSP27 mRNA and protein level in A549 tumour cells have been lowered using RNA perturbation techniques（Fig. 3）, low
Dosage（40ng/μl）After TRAIL inductions, flow cytometer and the detection of TUNEL apoptosis are found that A549 tumour cells are lowered in discovery
Interior HSP27 expression enhances sensitiveness of the tumour cell to TRAIL, adds the apoptosis rate of cell（Fig. 4）.Also,
Under 40ng/ μ l TRAIL inductions, apoptosis rate and the psiHSP27 interference plasmids amount of transfection are in dose-dependence（Fig. 4）,
Similarly, a certain amount of psiHSP27 is being transfected（0.5μg）Afterwards, apoptosis rate and TRAIL dosage are in dose-dependence
（Fig. 4）.Colony formation shows that psiHSP27 significantly suppress the clonality of A549 cells with TRAIL Combined Treatments
（Fig. 4）, HSP27 expression, which is lowered, makes A549 cells add 47.5 times to TRAIL Susceptibility（Fig. 4）.Therefore
HSP27 expression, quantity and activity are lowered in cellular level can produce the increase tumour cell similar to HSP70 and cell is withered
Die the effect of sensitiveness.Therefore, expression, quantity and the activity for lowering HSP70 and HSP27 are possible as a kind of increase tumour
The method of tissue or cell by cell apoptosis susceptibility.
The present invention is had found by Western blot technical Analysis：Compared with HSP27, lower in A549 tumour cells
After HSP70 expression, quantity and activity, the caspase family proteins with TRAIL induced activations（caspase-8、caspase-
9、caspase-3）Cascade reaction and PARP shearing, add Bcl-2 families pro apoptotic protein Bax, Bad, t-Bid table
Reach, lowered anti-apoptotic proteins Bcl-2 expression（Fig. 5）, and promote cromoci and be discharged into cytoplasm from mitochondria, most
Cause Apoptosis eventually.
Compared with HSP27, RNA perturbation techniques have activated NF- κ B after lowering intracellular HSP70 expression, quantity and activity
Signal path, so as to add sensitiveness of the tumour cell to Apoptosis.Expression, quantity and activity down-regulation for HSP70
Cell, I κ B α and NF- κ B p65 protein expression level declines in cytoplasm, NF- κ B p65 protein expression in nucleus
Level increase（Fig. 5）, so as to prove NF- κ B p65 there occurs the indexing from cytoplasm to nucleus, so as to be sent out in nucleus
The regulating and controlling effect of raw transcription factor.
Compared with HSP27, RNA perturbation techniques significantly reduce carefully after lowering intracellular HSP70 expression, quantity and activity
Intracellular anti-apoptotic proteins matter c-FLIP-L expression（Fig. 5）, so as to increase sensitiveness of the tumour cell to Apoptosis.
Compared with HSP27, RNA perturbation techniques significantly increase carefully after lowering intracellular HSP70 expression, quantity and activity
Intracellular transcription factor p53 expression and phosphorylation level（The phosphorylation in 81 threonine sites）, cause the activation of p53 protein
（Fig. 5）.P53 can activate apoptotic signal proteins matter DR4/5 expression, Bax expression, suppress anti-apoptotic proteins Bcl-2 albumen
The expression of matter, so as to increase sensitiveness of the tumour cell to Apoptosis.
Compared with HSP27, RNA perturbation techniques significantly increase carefully after lowering intracellular HSP70 expression, quantity and activity
Intracellular transcription factor c-JUN expression and its phosphorylation, JNK phosphorylation, cause c-JUN and JNK activation（Fig. 5）.c-JUN
Activation with JNK can activate p53 protein and Bid, t-Bid etc. expression, while suppress anti-apoptotic proteins c-FLIP-L's
Expression, so as to increase sensitiveness of the tumour cell to Apoptosis.
Further, found by Western blot technical Analysis：Under TRAIL inductions, compared with HSP27, under
After expression, quantity and the activity of adjusting intracellular HSP70, intracellular TRAIL receptor protein DR4 and DR5mRNA expression
Increase（Fig. 6）, protein expression level increase（Fig. 6）.Found by Western blot technical Analysis：Lower A549 tumour cells
After interior HSP27 expression, quantity and activity with TRAIL induced activations caspase family proteins（caspase-8、
caspase9、caspase-3）Cascade reaction and PARP shearing（Fig. 6）, add Bcl-2 families pro apoptotic protein Bax,
Bad, t-Bid expression, anti-apoptotic proteins Bcl-2 expression is lowered（Fig. 6）, and promote cromoci and released from mitochondria
Cytoplasm is put into, ultimately results in Apoptosis.Further, found by Western blot technical Analysis：Induced in TRAIL
Under, after expression, quantity and the activity of lowering intracellular HSP27, intracellular TRAIL receptor protein DR4 and DR5mRNA expression
Level is not significantly increased（Fig. 6）, protein expression level is also without obvious increase（Fig. 6）.
Further, expression, quantity and the active treatment method of lowering intracellular HSP70 and TRAIL are combined, it is real in A549
Its tumor killing effect is evaluated on body tumor model.The transfection efficiency of internal interference plasmid is primarily looked at, psiLUC plasmids are by turning
After transfection reagent is expelled in solid tumor body, find that interference plasmid can suppress lasting number in knurl body in fluorescence microscopy Microscopic observation
My god, transfection efficiency is higher, ensure that the feasibility of vivo gene therapy.Next investigated psiHSP70 interference plasmids with
Tumor killing effect associated with TRAIL, at the 24th day, psiHSP70 interference plasmids combined tumour inhibiting rate with TRAIL for 64%（Fig. 7）, display
Obvious antitumous effect（The P compared with control group<0.05）.And psiHSP70 interference plasmid monotherapy group, TRAIL single groups
Treatment group's tumor killing effect is not notable compared with control group（Fig. 7）, therefore, psiHSP70 interference plasmids are shown very with TRAIL
Good synergistic treatment effect, significantly suppress the growth of tumour.RT-PCR technology is shown in the 15th day after oncotherapy,
PsiHSP70 interference plasmids cause the acceptor DR4 and DR5 of TRAIL in tumor tissues expression to increase with TRAIL therapeutic alliances
Add（Fig. 7）, so as to increase drug susceptibility of the tumor tissues to TRAIL, the apoptosis of tumour cell is promoted, has reached tumour
The purpose for the treatment of.
Further, then intracellular HSP27 expression, quantity and active treatment method are lowered and TRAIL is combined, it is real in A549
Its tumor killing effect is evaluated on body tumor model.At the 24th day, psiHSP27 interference plasmids combined tumour inhibiting rate with TRAIL for 25%（Figure
8）, therapeutic effect is not notable compared with control group, and the tumour inhibiting rate of TRAIL and psiHSP27 monotherapy is respectively 21% He
41%（Fig. 8）, therapeutic effect is not also notable compared with control group, illustrates that psiHSP27 interference plasmids are not shown with TRAIL combinations
Obvious synergistic treatment effect, could not effectively suppress the growth of tumour.RT-PCR technology is shown in the 15th day after oncotherapy,
PsiHSP27 interference plasmids compared with control group, do not have obvious with the expression of DR4 and DR5 in TRAIL therapeutic alliance groups
Increase（Fig. 8）, therefore downward HSP27 can not increase drug susceptibility of the tumour cell to TRAIL, tumor tissues pair in vivo
TRAIL drug resistances, it is impossible to effectively suppress tumour growth.
Further, the present invention is in kinds of tumor cells（Compared on A549, SW1573 and H460 and lower intracellular HSP70
The influence to the sensitiveness of the TRAIL Apoptosis induced of expression, quantity and Activity on Tumor cell, as a result show, lower
Intracellular HSP70 expression, quantity and activity can greatly enhance tumour cell to apoptosis-inducing in various kinds of cell
Sensitiveness, tumour cell originally insensitive to Apoptosis is set to be changed into extremely sensitive to Apoptosis（Fig. 9）.
Further, the present invention compares and demonstrated the intracellular HSP70 of use in conjunction downward on lung cancer situ tumor model
Or HSP27 expression, quantity and the antitumous effect of activity and TRAIL drug therapies.As a result show：Only lower intracellular
HSP70 expression, quantity and activity combines treat with TRAIL could produce significant antitumous effect, significantly increase
Sensitiveness of the tumour cell to the TRAIL Apoptosis induced；To lower intracellular HSP27 expression, quantity and activity with
TRAIL, which combines to be treated, does not have this effect then.Therefore, this illustrates that this oncotherapy effect significantly increased is not
Common to HSP proteinoid, but specific to HSP70；Moreover, this effect is not only can from the experiment of cellular level
To obtain, infer or derivative, because HSP27 and HSP70 shows identical in cellular level increases tumour cell to cell
The sensitiveness of apoptosis induction.Therefore, expression, quantity or the activity for not lowering all heat shock proteins can act as oncotherapy
Target spot.
Further, the present invention is proved by lowering tumor tissues or intracellular HSP70 in cellular level and animal level
Expression, quantity or activity can significantly increase NF- κ B active, notable up-regulation NF- κ B downstream target genes -- death receptor DR4
Expression, increase JNK and c-Jun phosphorylation, the activation for promoting p53 albumen, increase mitochondrial apoptosis letter with DR5
Number approach promotees the protein expressions such as apoptosis molecule Bax, lowers the side of the protein expressions such as anti-apoptotic proteins c-FLIP, Bcl-2
Method, tumour cell is significantly improved to the sensitiveness of Apoptosis, raising tumor tissues and Apoptosis and necrosis so as to reach, is shown
Write the effect for suppressing implanted solid tumor growth.HSP70 this characteristic is not common to HSP proteinoid, for example, HSP27 even in
Cellular level is also without this property.
We are tested also directed to from tumour cells such as liver cancer, prostate cancer, colon cancer, stomach cancers simultaneously,
Obtain similar experimental result.
Particular embodiments described above, the purpose of the present invention, technical scheme and beneficial effect are carried out further in detail
Describe in detail it is bright, should be understood that the foregoing is only the present invention specific embodiment, be not intended to limit the invention, it is all
Within the spirit and principles in the present invention, any modification, equivalent substitution and improvements done etc., it should be included in the guarantor of the present invention
Within the scope of shield.
Claims (11)
1. a kind of regulation HSP70 expression and the inhibitor compound of activity, it is characterized in that by RNA interference effects, suppress HSP70
Expression and activity and adjust the sensitiveness of cell by cell apoptosis, described RNA interference sequences are：5'-
GGATCCCGGACGAGTTTGAGCACAAGTTGATATCCGCTTGTGCTCAAACTCGTC CTTTTTTCCAAAAGCTT-3'。
2. the inhibitor compound of a kind of regulation HSP70 expression and activity described in claim 1 is in regulative transcription factor NF- κ B
And the application in activity.
3. described in claim 1 a kind of regulation HSP70 expression and activity inhibitor compound regulation and control death receptor DR4 and
Application in DR5 expression and activity.
4. the inhibitor compound of a kind of regulation HSP70 expression and activity described in claim 1 is regulation and control JNK's and c-Jun
Application in phosphorylation and activity.
5. the inhibitor compound of a kind of regulation HSP70 expression and activity described in claim 1 is in regulation and control p53 albumen and activity
In application.
6. described in claim 1 a kind of regulation HSP70 expression and activity inhibitor compound regulate and control at the same time Bax, Bid,
T-Bid, capsase 3, capsase 8, capsase 9 expression and activity in application.
7. described in claim 1 a kind of regulation HSP70 expression and activity inhibitor compound regulate and control at the same time c-FLIP and
Application in Bcl-2 expression and activity.
8. the inhibitor compound of a kind of regulation HSP70 expression and activity described in claim 1 is preparing regulation cell to thin
Application in the medicine of born of the same parents' apoptosis susceptibility.
9. described in claim 1 a kind of regulation HSP70 expression and activity inhibitor compound with Apoptosis curative
Internet of Things closes the application in pharmacy.
10. described in claim 1 a kind of regulation HSP70 expression and activity inhibitor compound with apoptosis-inducing egg
Application in white TRAIL joint pharmacy.
11. described in claim 1 a kind of regulation HSP70 expression and activity inhibitor compound with apoptosis-inducing egg
White TRAIL combines the application prepared in antineoplastic.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210293661.9A CN102816792B (en) | 2012-08-17 | 2012-08-17 | A kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210293661.9A CN102816792B (en) | 2012-08-17 | 2012-08-17 | A kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102816792A CN102816792A (en) | 2012-12-12 |
| CN102816792B true CN102816792B (en) | 2018-02-02 |
Family
ID=47301237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210293661.9A Active CN102816792B (en) | 2012-08-17 | 2012-08-17 | A kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102816792B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114848848A (en) * | 2022-04-13 | 2022-08-05 | 重庆文理学院 | Gene medicine for reversing drug resistance of non-small cell lung cancer |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110470842B (en) * | 2019-08-30 | 2022-11-18 | 中山大学肿瘤防治中心（中山大学附属肿瘤医院、中山大学肿瘤研究所） | Biomarker for evaluating recurrence and prognosis of nasopharyngeal carcinoma and application thereof |
| CN111087454B (en) * | 2020-02-26 | 2021-07-27 | 福建农林大学 | Heat shock transcription factor 1 dominant negative effect mutant and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1282485C (en) * | 2005-04-04 | 2006-11-01 | 南京大陆产业投资集团有限公司 | Dendron shaped cell tumour vaccine for loading withered heat shock tumour cell, its preparation method and application |
| CN101663305A (en) * | 2007-02-06 | 2010-03-03 | 辉瑞大药厂 | 2-amin0-5, 7-dihydr0-6H- pyrrolo [3, 4-D] pyrimidine derivatives as HSP-90 inhibitors for treating cancer |
-
2012
- 2012-08-17 CN CN201210293661.9A patent/CN102816792B/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114848848A (en) * | 2022-04-13 | 2022-08-05 | 重庆文理学院 | Gene medicine for reversing drug resistance of non-small cell lung cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102816792A (en) | 2012-12-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xia et al. | Catecholamines contribute to the neovascularization of lung cancer via tumor-associated macrophages | |
| Cao et al. | Observation of incipient tumor angiogenesis that is independent of hypoxia and hypoxia inducible factor-1 activation | |
| CN109804070A (en) | Peptide nucleic acid compound with improved cell permeability and include its pharmaceutical composition | |
| CN102816792B (en) | A kind of regulating heat shock protein 70 is expressed, the method and its application of quantity and activity | |
| Kawaguchi et al. | Tumor targeting Salmonella typhimurium A1-R in combination with gemcitabine (GEM) regresses partially GEM-resistant pancreatic cancer patient-derived orthotopic xenograft (PDOX) nude mouse models | |
| CN105617398A (en) | MicroRNA-342-3p and microRNA-210 and applications of inhibitors of microRNA-342-3p and microRNA-210 | |
| CN108384810A (en) | A kind of cationic gene carriers and preparation method thereof of high transfection efficiency low cytotoxicity | |
| CN109055561A (en) | LncRNA-AP003774.1 is diagnosing and/or treating the application in breast cancers | |
| CN105734075A (en) | Carrier for interfering with expression of gene ABCB5 and application of carrier in tumor stem cell treatment | |
| CN108220422B (en) | Application of histone demethylase in screening of drugs for treating fatty liver and related diseases thereof | |
| CN104031148A (en) | Monoclonal antibody aiming at human PrPc and application thereof | |
| CN105457041B (en) | Application of miR-26a in non-small cell lung cancer | |
| CN117487915A (en) | Application of H2AFV in diagnosis, prognosis, prevention or treatment of liver cancer | |
| Wu et al. | A novel cell-permeable RDP-p53 fusion protein for specific inhibition on the growth of cancerous neural cells | |
| CN103374572A (en) | Sequence of aptamer of hepatoma cell and application thereof | |
| CN107502610A (en) | One kind targeting STAT3 signal paths miRNA and its preparation method and application | |
| CN101130092A (en) | Application of recombinant adenovirus in producing antineoplastic medicine | |
| CN104083368A (en) | Application of G-1 in preparation of G protein coupled receptor 30-based triple negative breast cancer targeting drugs | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| CN101787367A (en) | siRNA for restraining MAEL gene expression of human being and application thereof in preparing anti-tumor medicine | |
| CN105288660B (en) | Applications of the MiRNA-22 in preparing MMP14 and Snail expression inhibiting agent | |
| Gu et al. | Mechanism of long-chain non-coding RNA hypoxia-inducible factor 1α-antisense RNA 1 regulating chemotherapy resistance of retinoblastoma by inhibiting hypoxia-inducible factor-α expression | |
| CN107184983A (en) | A kind of diagnosis and treatment target of adenocarcinoma of lung | |
| CN104368001B (en) | Suppress CALM1 and cooperate with the application in suppressing tumour with EGFR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |