CN106947778A - The children purpura nephritis recombinant vector and its construction method of targeted inhibition integrin β_1 expression - Google Patents
The children purpura nephritis recombinant vector and its construction method of targeted inhibition integrin β_1 expression Download PDFInfo
- Publication number
- CN106947778A CN106947778A CN201710127986.2A CN201710127986A CN106947778A CN 106947778 A CN106947778 A CN 106947778A CN 201710127986 A CN201710127986 A CN 201710127986A CN 106947778 A CN106947778 A CN 106947778A
- Authority
- CN
- China
- Prior art keywords
- integrin
- purpura nephritis
- recombinant vector
- expression
- children purpura
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses a kind of children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression, including the basic sequences of RNAi Ready pSIREN RetroQ ZsGreen1 carriers, resistance gene sequences, multiple cloning sites sequence, the oligonucleotide chain of promoter sequence and the targeted integration element genes of β 1；The multiple cloning sites include BamH I restriction enzyme sites and EcoR I restriction enzyme sites, the oligonucleotide chain is made up of BamH I restriction enzyme sites+target sequence positive-sense strand+loop-stem structure+target sequence antisense strand+EcoR I restriction enzyme sites, in the oligonucleotide chain forward direction insertion multiple cloning sites.The invention belongs to gene engineering technology field, the children purpura nephritis recombinant vector that the present invention is provided can targeted inhibition integrin β_1 expression, have the advantages that specific good, high efficiency stable expression, transfection efficiency are high.
Description
Technical field
The invention belongs to the children purpura nephritis weight of gene engineering technology field, more particularly to the expression of targeted inhibition integrin β_1
Group carrier and its construction method.
Background technology
Asthma is the common disease of respiratory system, frequently-occurring disease, and it is disabled, fatal rate is in rising trend always, it has also become serious
Community health's problem.The pathogenesis of asthma is not yet fully apparent from, but airway inflammation and Airway Remodeling are that current asthma is generally acknowledged
Two principal characters.Airway Remodeling can cause air flue irreversibility spasm, and this is that part asthmatic patient is difficult to use asthmatic medicament
Control the main cause of symptom.
Existing numerous studies confirm that airway smooth muscle cells (airway smooth muscle cell, ASMC) are only
Cause the main effects cell of airway constriction, be the important immunity regulatory cell of a class in Pathogenesy of Asthma, no matter whether there is gas
Road inflammation is present, and its abnormality proliferation, apoptosis, migration are responsible for air flue wall thickening, and can added by discharging various active medium
Weight airway inflammation.Therefore, ASMC is in Central Position in TIMP on airway remodeling of bronchial asthma, if effectively suppressing ASMC abnormality proliferations, withering
Die and rheuminess etc., material impact will be produced to mitigating TIMP on airway remodeling of bronchial asthma.
Integrin (Integrin) is bonded as a kind of heterodimer by two different subunits of α, β via non-covalent
Connect and form.18 kinds of different alpha subunits (150-210kD) and 9 kinds of β subunits (90-110kD) are had now found that, they are by difference
Combination constitutes more than 20 and plants Integrin.In Integrin there is significant difference in the function of different subunits：(1) alpha subunit：Amino
End is with the domain for combining bivalent cation, the combination between regulation Integrin and part, at the nearly film of its cytoplasmic region
Conserved sequence (KXGFFKR) and Integrin Active Regulations it is closely related；(2) β subunits：The main mediated cell of the subunits of β 1
Adhesion and Role in Plant Signal Transduction between ECM；Beta 2 subunit unit is primarily present in mutual between a variety of leukocyte surfaces, mediated cell
Effect；The subunits of β 3 are primarily present in platelet surface, and mediate platelet aggregation, participation form thrombus；β 4 is tied with the subunits of α 6
Close, participation forms hemidesmosome.
Though the important member of RNAi technology --- siRNA can efficiently, specifically suppress expression of target gene, its is degradable,
Action time is short, it is difficult to the gene silencing effect played stably；And children purpura nephritis (smallhairpin RNA, shRNA) has
One important loop-stem structure, compared with the siRNA that the intracellular same period expresses, often suppresses effect with higher target gene
Rate.Children purpura nephritis genophore is divided into non-virus carrier and the major class of viral vectors two, wherein, non-virus carrier non-immunogenicity,
But its transfection efficiency is often relatively low；And though viral vectors has higher transfection efficiency, its biological safety and immunogenicity are asked
Topic is often difficult to solve.Because the locus of the target gene, expression system and assembling of transfection is different, the gene table after transfection
Larger difference also occurs up to level and positive colony screening rate, so build a shRNA table rationally, efficiently, stable
It is that cell transfecting is successfully crucial up to carrier.The shRNA filtered out for specific target gene is expected to play the efficient gene of targeting
Inhibitory action, does not cause with preferable transfection efficiency and nonspecific reaction.
Have been reported that the subunits of β 1 for thinking Integrin can mediated cell and the phase interaction between cell, cell and ECM etc.
With, and material impact, but prior art and incompetent targeting are played to the pathophysiological process of a variety of diseases including asthma
Efficiently suppress the children purpura nephritis recombinant expression carrier of integrin β_1.Therefore it provides a kind of target efficiently suppresses the small of integrin β_1
Hairpin RNA recombinant expression carrier, is expected to produce material impact to the gene therapy for intervening TIMP on airway remodeling of bronchial asthma and asthma.
The content of the invention
To solve problems of the prior art, the present invention provides a kind of bobby pin of targeted inhibition integrin β_1 expression
RNA recombinant vectors, by screening RNAi-Ready pSIREN-RetroQ-ZsGreen1 based on carrier (median size is taken
Band eukaryotic promoter and green fluorescence gene, target gene transcription is carried out in fixed position, and security is good), screening is integrated
Plain the 425th nucleotides in β 1mRNA code areas builds oligonucleotide chain (SEQ ID NO as the target site of interference starting：1 He
SEQ ID NO：2), so build obtained children purpura nephritis recombinant vector can targeted inhibition integrin β_1 expression, with special
The advantages of good, high efficiency stable expression of property, high transfection efficiency.
The purpose of the present invention will be further illustrated by following detailed description.
The present invention provides a kind of children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression, including RNAi-Ready
The basic sequences of pSIREN-RetroQ-ZsGreen1 carriers, resistance gene sequences, multiple cloning sites sequence, promoter sequence and
The oligonucleotide chain of the targeted integration element genes of β 1；The multiple cloning sites include BamH I restriction enzyme sites and EcoR I digestions position
Point, the oligonucleotide chain is by BamH I restriction enzyme sites+target sequence positive-sense strand+loop-stem structure+target sequence antisense strand+EcoR I enzymes
Enzyme site is constituted, in the oligonucleotide chain forward direction insertion multiple cloning sites.
Preferably, the positive-sense strand of the oligonucleotide chain is：GATCCGGCAGGGCCAAATTGTGGGTTTCAAG
AGAACCCACAATTGGCCCTGCACGCGTG, i.e. SEQ ID NO：1；The antisense strand of the oligonucleotide chain is：
AATTCACGCGTGCAGGGCCAAATTGTGGGTTCTCTTGAAACCCACAATTTGGCCCT GCCG, i.e. SEQ ID NO：2.
Preferably, the resistance gene sequences include ampicillin resistance gene.
Preferably, the RNAi-Ready pSIREN-RetroQ-ZsGreen1 carriers are purchased from Clontech companies of the U.S..
Correspondingly, the present invention also provides the construction method of the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression,
Comprise the following steps：
The design of S1 oligonucleotide chains：According to integrin β_1 mRNA gene orders, after confirming specificity through sequence analysis,
Integrin β_1 mRNA target sequences are chosen using children purpura nephritis design software, the few core of the targeted integration element genes of β 1 is designed and synthesized
Thuja acid chain；
The structure of S2 children purpura nephritis recombinant vectors：RNAi-Ready pSIREN-RetroQ-ZsGreen1 carriers are carried out
BamHI and EcoRI digestions, by the RNAi- after the oligonucleotide chain forward direction insertion digestion of the targeted integration element genes of β 1 of synthesis
In Ready pSIREN-RetroQ-ZsGreen1 vector multiple cloning sites, by connection product transformed competence colibacillus cell, after staying overnight
Picking positive colony, expands in nutrient solution, extracts plasmid, obtains the children purpura nephritis restructuring of targeted inhibition integrin β_1 expression
Carrier.
Preferably, the positive-sense strand of the oligonucleotide chain is：GATCCGGCAGGGCCAAATTGTGGGTTTCAAGAGAACC
CACAATTGGCCCTGCACGCGTG, i.e. SEQ ID NO：1；The antisense strand of the oligonucleotide chain is：
AATTCACGCGTGCAGGGCCAAATTGTGGGTTCTCTTGAAACCCACAATTTGGCCCT GCCG, i.e. SEQ ID NO：2.
Preferably, the competent cell is DH-5 а competent cells.
Compared with prior art, beneficial effects of the present invention include：A kind of the small of targeted inhibition integrin β_1 expression is provided
Hairpin RNA recombinant vector, using carrier based on RNAi-Ready pSIREN-RetroQ-ZsGreen1, uses SEQ ID
NO：1 and SEQ ID NO：2 as targeted inhibition integrin β_1 gene expression oligonucleotide chain, with specific good, security
Well, the advantages of high efficiency stable expression, high transfection efficiency, it is expected to play in the gene therapy of TIMP on airway remodeling of bronchial asthma and asthma is intervened
Important function.In addition, the construction method that the present invention is provided is simple, efficient, reproducible.
Brief description of the drawings
The structure schematic diagram of Fig. 1 children purpura nephritis recombinant vectors of the present invention.
The part sequencer map of Fig. 2 children purpura nephritis recombinant vectors of the present invention.
Fig. 3 intervenes the transfection efficiency in vitro detection figure for the treatment of group.
Fig. 4 RT-PCR methods detect the mRNA expression of results figures of different group ASMC integrin β_1s；Wherein A is blank control
Group, B is empty vector control group, and C is negative control group, and D is intervention treatment group.
Fig. 5 Western-blot methods detect the protein expression result figure of different group ASMC integrin β_1s；Wherein A is blank
Control group, B is empty vector control group, and C is negative control group, and D is intervention treatment group.
Embodiment
The present invention is described in further details with reference to the accompanying drawings and examples.
In the present invention, involved carrier, reagent and kit is conventional commercial product, or can pass through the normal of this area
Advise technological means to obtain, such as RNAi-Ready pSIREN-RetroQ-ZsGreen1 carriers are purchased from Clontech companies of the U.S..
The design and synthesis of the oligonucleotide chain of embodiment one
According to integrin β_1 mRNA gene orders (NM_16412), after confirming specificity through BLAST sequence analysis, exclude
ShRNA non-specificity suppresses the possibility of other genetic fragments, and integrin β_1 mRNA target sequences are chosen using children purpura nephritis design software
Row, screening the integrin β_1 mRNA nucleotides of code area the 425th as interference starting target site, by BamH I restriction enzyme sites+
Target sequence positive-sense strand+loop-stem structure+target sequence antisense strand+EcoR I restriction enzyme sites composition oligonucleotide chain (SEQ ID NO：1 He
SEQ ID NO：2).
Meanwhile, set up negative control (missense RNA chains), empty vector control (plasmid vector) and blank control (PBS).It is negative
The positive-sense strand of control：GATCCCGACTACCGTTGTATAGGTGTTCAAGAGACACCTATACAACG GTAGTTTTTTTG, i.e.,
SEQ ID NO：3；The antisense strand of negative control：CAAAAAAACTACCGTTGTATAGGTGTCTCTTGAACACCTATACAACGG
TAGTCGGGATC, i.e. SEQ ID NO：4.The sequence such as oligonucleotide chain and negative control is by Shanghai Shun Tian biotech companies
Synthesis.
The structure of the children purpura nephritis recombinant vector of embodiment two
Make its linear the progress BamHI and EcoRI digestions of RNAi-Ready pSIREN-RetroQ-ZsGreen1 carriers
Change, the oligonucleotide chain for the targeted integration element genes of β 1 that embodiment one is synthesized prepares annealing double-stranded DNA, after forward direction insertion digestion
RNAi-Ready pSIREN-RetroQ-ZsGreen1 vector multiple cloning sites in, by connection product convert DH-5 а competence
Cell, afterwards bacterium solution be uniformly coated on containing on ampicillin (100 μ g/ml) agar plate, be inverted picking sun after overnight incubation
Property clone, bacterium solution is expanded in the LB nutrient solutions containing ampicillin (100 μ g/ml), takes part bacterium solution to be sequenced, part survey
Sequence figure is as shown in Fig. 2 sequencing result display insertion is correct.Plasmid is extracted from amplification bacterium solution, targeted inhibition integrin β_1 is obtained
The children purpura nephritis recombinant vector of expression.
Ibid, all recombinant vectors are by Shanghai Shun Tian Sheng for the construction method of negative control (missense RNA chains) recombinant vector
Thing technology company carries out digestion, PCR identifications and sequencing analysis, so that it is determined that the correctness of Insert Fragment.
The ASMC in-vitro transfections of embodiment three
ASMC in exponential phase is digested, centrifuge, removes supernatant, with the DMEM nutrient solution weights containing 10% hyclone
It is outstanding, with every hole 1 × 105Individual cell is inoculated in 6 well culture plates, treats that nutrient solution, up to 80%, is replaced by no blood by cell fusion degree
Clear DMEM nutrient solutions, 37 DEG C, 5%CO224h is cultivated in incubator, is then carried out by the operating instructions of Lipofectine 2000
Cell transfecting, is divided into following 5 groups and handles respectively：1. blank control group：Only add PBS；2. empty vector control group：Transfection is empty
Plasmid vector；3. negative control group：Transfect missense RNA chain recombinant vectors；4. treatment group is intervened：Transfection children purpura nephritis of the present invention
Recombinant vector.
The detailed process of cell transfecting is as follows：Prepare cell transfecting A liquid and B liquid：A liquid is that 15 μ L recombinant vectors add 250 μ
L DMEM nutrient solutions, B liquid is that 10 μ L Lipofectine add 250 μ L DMEM nutrient solutions；A, B liquid are mixed, incubation at room temperature
20min, is added in each hole of culture plate, is mixed, is placed in 37 DEG C, 5%CO26h is cultivated in incubator, transfection liquid is sucked, is replaced by and contains
The DMEM nutrient solutions of 10% hyclone, continue to be placed in incubator and cultivate 48h.
Transfection 48h cell is collected respectively, is inoculated in and is equipped with advance in 12 orifice plates of sterile cover slips, is added per hole
1mL4% paraformaldehydes fix 20min, suck and rinsed three times with PBS after paraformaldehyde, 2min, PBS are dyed with 5 μ g/mLDAPI
Rinse three times, phosphoglycerol buffer solution mounting, in fluorescence microscopy Microscopic observation.The transfection efficiency for intervening treatment group is about 75%,
As shown in Figure 3.
Example IV RT-PCR methods detect targeted inhibition effect
ASMC cells to be measured are collected, RNA extractings is carried out, is inverted RNA using Quant cDNA the first chain synthetic agent box
Record as cDNA templates, entering performing PCR using 2 × Power Taq PCR MasterMix kits expands, agarose gel electrophoresis mirror
Determine PCR results, as a result as shown in Figure 4.
The PCR sense primers of integrin β_1 are TGGGGGACAAAAAGGGGGAAGG, i.e. SEQ ID NO：Draw in 5, PCR downstreams
Thing is TTCCGCCTCTGGATGACTA, i.e. SEQ ID NO：6；β-actin PCR sense primers are
CTGGCACCACACCTTCTACAATG, i.e. SEQ ID NO：7, PCR anti-sense primers are AATGTCACGCACGATTTCCCGC, i.e.,
SEQ ID NO：8.The reaction system of PCR amplifications is as follows：
As can be seen from Figure 4, it is external to intervene after 48h, compared with negative control group, empty vector control group and blank control group, do
The integrin β_1 mRNA expressions of pretreated group are significantly reduced, and illustrate that the children purpura nephritis recombinant vector that the present invention is provided can show
Write the mRNA expression for suppressing integrin β_1.
The Western-blot methods of embodiment five detect targeted inhibition effect
ASMC cells to be measured are collected, total protein is extracted, exposure of developing after SDS-PAGE electrophoresis, transferring film, immuning hybridization is carried out,
As a result it is as shown in Figure 5.
As can be seen from Figure 5, it is external to intervene after 48h, compared with negative control group, empty vector control group and blank control group, do
The integrin β_1 protein expression level of pretreated group is significantly reduced, and illustrates that the children purpura nephritis recombinant vector that the present invention is provided can show
Write the protein expression for suppressing integrin β_1.
In summary, the children purpura nephritis recombinant vector energy stable transfection that the present invention is provided, and transfection efficiency is high, can be notable
Suppress mRNA expression and the protein expression of integrin β_1.
Above content is to combine specific preferred embodiment further description made for the present invention, it is impossible to assert
The specific implementation of the present invention is confined to these explanations.For general technical staff of the technical field of the invention,
On the premise of not departing from present inventive concept, some simple deduction or replace can also be made, should all be considered as belonging to the present invention's
Protection domain.
SEQUENCE LISTING
<110>Shenzhen people's hospital
<120>The children purpura nephritis recombinant vector and its construction method of targeted inhibition integrin β_1 expression
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 59
<212> DNA
<213>Artificial sequence
<400> 1
gatccggcag ggccaaattg tgggtttcaa gagaacccac aattggccct gcacgcgtg 59
<210> 2
<211> 60
<212> DNA
<213>Artificial sequence
<400> 2
aattcacgcg tgcagggcca attgtgggt tctcttgaaa cccacaattt ggccctgccg 59
<210> 3
<211> 59
<212> DNA
<213>Artificial sequence
<400> 3
gatcccgact accgttgtat aggtgttcaa gagacaccta tacaacggta gtttttttg 59
<210> 4
<211> 59
<212> DNA
<213>Artificial sequence
<400> 4
caaaaaaact accgttgtat aggtgtctct tgaacaccta tacaacggta gtcgggatc 59
<210> 5
<211> 22
<212> DNA
<213>Artificial sequence
<400> 5
tgggggacaa aaagggggaa gg 22
<210> 6
<211> 19
<212> DNA
<213>Artificial sequence
<400> 6
ttccgcctct ggatgacta 19
<210> 7
<211> 23
<212> DNA
<213>Artificial sequence
<400> 7
ctggcaccac accttctaca atg 23
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence
<400> 8
aatgtcacgc acgatttccc gc 22
Claims (7)
1. the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression, it is characterised in that：Including RNAi-Ready
The basic sequences of pSIREN-RetroQ-ZsGreen1 carriers, resistance gene sequences, multiple cloning sites sequence, promoter sequence and
The oligonucleotide chain of the targeted integration element genes of β 1；The multiple cloning sites include BamH I restriction enzyme sites and EcoR I digestions position
Point, the oligonucleotide chain is by BamH I restriction enzyme sites+target sequence positive-sense strand+loop-stem structure+target sequence antisense strand+EcoR I enzymes
Enzyme site is constituted, in the oligonucleotide chain forward direction insertion multiple cloning sites.
2. the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression according to claim 1, it is characterised in that：
The positive-sense strand of the oligonucleotide chain is：GATCCGGCAGGGCCAAATTGTGGGTTTCAAGAGAACCCACAATTGGCCCTGC
ACGCGTG, i.e. SEQ ID NO：1；The antisense strand of the oligonucleotide chain is：AATTCACGCGTGCAGGGCCAAATTGTGGGT
TCTCTTGAAACCCACAATTTGGCCCTGCCG, i.e. SEQ ID NO：2.
3. the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression according to claim 1, it is characterised in that：
The resistance gene sequences include ampicillin resistance gene.
4. the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression according to claim 1, it is characterised in that：
The RNAi-Ready pSIREN-RetroQ-ZsGreen1 carriers are purchased from Clontech companies of the U.S..
5. the construction method of the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression according to claim 1, its
It is characterised by：Comprise the following steps：
The design of S1 oligonucleotide chains：According to integrin β_1 mRNA gene orders, after confirming specificity through sequence analysis, application
Children purpura nephritis design software chooses integrin β_1 mRNA target sequences, designs and synthesizes the oligonucleotides of the targeted integration element genes of β 1
Chain；
The structure of S2 children purpura nephritis recombinant vectors：RNAi-Ready pSIREN-RetroQ-ZsGreen1 carriers are carried out
BamHI and EcoRI digestions, by the RNAi- after the oligonucleotide chain forward direction insertion digestion of the targeted integration element genes of β 1 of synthesis
In Ready pSIREN-RetroQ-ZsGreen1 vector multiple cloning sites, by connection product transformed competence colibacillus cell, after staying overnight
Picking positive colony, expands in nutrient solution, extracts plasmid, obtains the children purpura nephritis restructuring of targeted inhibition integrin β_1 expression
Carrier.
6. the construction method of the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression according to claim 5, its
It is characterised by：The positive-sense strand of the oligonucleotide chain is：GATCCGGCAGGGCCAAATTGTGGGTTTCAAGAGAACCCACAAT
TGGCCCTGCACGCGTG, i.e. SEQ ID NO：1；The antisense strand of the oligonucleotide chain is：AATTCACGCGTGCAGGGCCAA
ATTGTGGGTTCTCTTGAAACCCACAATTTGGCCCTGCCG, i.e. SEQ ID NO：2.
7. the construction method of the children purpura nephritis recombinant vector of targeted inhibition integrin β_1 expression according to claim 5, its
It is characterised by：The competent cell is DH-5 а competent cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710127986.2A CN106947778A (en) | 2017-03-06 | 2017-03-06 | The children purpura nephritis recombinant vector and its construction method of targeted inhibition integrin β_1 expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710127986.2A CN106947778A (en) | 2017-03-06 | 2017-03-06 | The children purpura nephritis recombinant vector and its construction method of targeted inhibition integrin β_1 expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106947778A true CN106947778A (en) | 2017-07-14 |
Family
ID=59467820
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710127986.2A Pending CN106947778A (en) | 2017-03-06 | 2017-03-06 | The children purpura nephritis recombinant vector and its construction method of targeted inhibition integrin β_1 expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106947778A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070564A (en) * | 2017-12-07 | 2018-05-25 | 深圳市人民医院 | A kind of method for proving consideration convey dye siRNA security |
| CN110511957A (en) * | 2019-08-28 | 2019-11-29 | 福建农林大学 | The RNAi carrier and its application of silencing diamondback moth integrin β_1 subunit gene Px β |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948858A (en) * | 2010-08-17 | 2011-01-19 | 深圳市疾病预防控制中心 | RNA (Ribose Nucleic Acid) interference recombination vector of SET (Patient SE Translocation) genes and establishment method and application thereof |
| CN102703507A (en) * | 2012-05-18 | 2012-10-03 | 深圳市疾病预防控制中心 | shRNA lentiviral expression vector for specifically inhibiting hepatic cell CYP2E1 gene expression, constructing method and application thereof |
| EP2996721A2 (en) * | 2013-05-13 | 2016-03-23 | Tufts University | Methods and compositions for prognosis, diagnosis and treatment of adam8-expressing cancer |
-
2017
- 2017-03-06 CN CN201710127986.2A patent/CN106947778A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948858A (en) * | 2010-08-17 | 2011-01-19 | 深圳市疾病预防控制中心 | RNA (Ribose Nucleic Acid) interference recombination vector of SET (Patient SE Translocation) genes and establishment method and application thereof |
| CN102703507A (en) * | 2012-05-18 | 2012-10-03 | 深圳市疾病预防控制中心 | shRNA lentiviral expression vector for specifically inhibiting hepatic cell CYP2E1 gene expression, constructing method and application thereof |
| EP2996721A2 (en) * | 2013-05-13 | 2016-03-23 | Tufts University | Methods and compositions for prognosis, diagnosis and treatment of adam8-expressing cancer |
Non-Patent Citations (1)
| Title |
|---|
| 史菲: "整合素-β1在哮喘气道重塑中的作用及shRNA靶向干预研究", 《中国博士学位论文全文数据库》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070564A (en) * | 2017-12-07 | 2018-05-25 | 深圳市人民医院 | A kind of method for proving consideration convey dye siRNA security |
| CN110511957A (en) * | 2019-08-28 | 2019-11-29 | 福建农林大学 | The RNAi carrier and its application of silencing diamondback moth integrin β_1 subunit gene Px β |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103301475B (en) | Method that pharmaceutical composition and expression vector and regulator gene are expressed and the application of nucleic acid molecules | |
| WO2021209010A1 (en) | Method and drug for treating hurler syndrome | |
| CN107893076A (en) | CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA | |
| CN109234274A (en) | The TGF-β oligonucleotides of modification | |
| CN107893078B (en) | SiRNA (small interfering ribonucleic acid) of targeted synaptotagmin-11, expression vector and virus particle and pharmaceutical application thereof | |
| WO2008084319A2 (en) | Novel nucleic acid | |
| CN113528582B (en) | Method and medicine for targeted editing of RNA based on LEAPER technology | |
| CN106480037A (en) | A kind of long non-coding RNA and the application in diagnosis preeclampsia and target drug treatment is prepared | |
| CN106947778A (en) | The children purpura nephritis recombinant vector and its construction method of targeted inhibition integrin β_1 expression | |
| CN104694576B (en) | A kind of method of IFNAR1 genes in 1 cell lines of silence DF | |
| CN106591308A (en) | Human pulmonary carcinoma erlotinib drug tolerance improving shRNA | |
| CN103834691A (en) | Construction method of target RNA-interfered recombinant lentivirus vector for IL-33 gene | |
| CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
| Pei et al. | Construction and detection of a novel type of recombinant human rAAV2/2-ND4 | |
| CN110129318A (en) | Long-chain non-coding RNA PRALR and its expression plasmid and purposes | |
| CN105200059B (en) | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector | |
| CN101880677A (en) | siRNA sequence against 2009 new influenza A virus polymerase gene and nucleoprotein gene and application thereof | |
| CN110129319B (en) | siRNA of PRALR and application thereof | |
| Flynn et al. | Synthetic dosage-compensating miRNA circuits for quantitative gene therapy | |
| CN102061310A (en) | Construction and application of human FHL1C eukaryotic expression vector | |
| CN113462723B (en) | Retroviral vectors expressing CAR and shRNA and uses thereof | |
| CN107334777A (en) | New application of interference BTF3 in inhibiting proliferation of melanoma cells | |
| CN106811485A (en) | BANCR gene overexpressions slow virus carrier, BANCR slow virus and construction method and application | |
| CN102337266B (en) | siRNAs and recombinant vector for inhibiting expression of Nogo A, MAG and OMgp genes, and application of siRNAs and recombinant vector | |
| CN104762325B (en) | A kind of method of IFNAR2 genes in 1 cell lines of silence DF |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170714 |