CN106947777A - Applications of the nitrogen transporter gene OsNPF7.4 in paddy rice seed selection - Google Patents
Applications of the nitrogen transporter gene OsNPF7.4 in paddy rice seed selection Download PDFInfo
- Publication number
- CN106947777A CN106947777A CN201710330664.8A CN201710330664A CN106947777A CN 106947777 A CN106947777 A CN 106947777A CN 201710330664 A CN201710330664 A CN 201710330664A CN 106947777 A CN106947777 A CN 106947777A
- Authority
- CN
- China
- Prior art keywords
- gene
- plant
- ala
- val
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention discloses nitrogen transporter geneOsNPF7.4Application in paddy rice seed selection, belongs to plant genetic engineering field.OsNPF7.4The amino acid sequence of DNA encoding the protein is as shown in SEQ ID NO.1, and cDNA sequence is as shown in SEQ ID NO.2.The present invention is by building paddy riceOsNPF7.4Gene interference plant,OsNPF7.4Gene overexpresses plant, finds by reductionOsNPF7.4Gene expression, can make normal rice tillering number, spike number and grouting grain number increase, thereforeOsNPF7.4Gene can be used in paddy rice seed selection improving rice yield.OsNPF7.4Gene has important application value in terms of nitrogen transport influence plant growth and growth course is illustrated.
Description
Technical field
The invention belongs to plant genetic engineering field, and in particular to nitrogen transporter geneOsNPF7.4Answering in paddy rice seed selection
With.
Background technology
Plant obtains nitrogen by absorbing the ammonia in soil, nitrate anion, amino acid, soluble peptide etc.；The absorption of nitrogen and
Transhipment relies primarily on ammonium root transport protein（AMT）, nitrate anion transport protein（NRT）, amino acid transport proteins（AAT）, peptide transport
Albumen（PTR）Completed Deng transport protein（Williams L, Miller A. Transporters responsible for
the uptake and partitioning of nitrogenous solutes. Annual Review of Plant
Physiology and Plant Molecular Biology, 2001, 52: 659-688.）.Ammonium is absorbed by plant AMT
Pass through glutamine synthelase again afterwards（GS）And glutamate synthase（GOGAT）Glutamine and glutamic acid are synthesized, the latter enters one again
Step forms other amino acid（Sonoda Y, Ikeda A, Saiki S, et al. Feedback regulation of
the ammonium transporter gene family AMT1 by glutamine in rice. Plant Cell
Physiology, 2003, 44: 1396-1402.）.Plant can pass through high affine movement system（HATS）NRT2 and low parent
And movement system（LATS）NRT1 absorb environment in nitrate, by nitrate reductase（NR）And nitrite reductase（NiR）
Reduction forms ammonium, further forms amino acid（Paungfoo-Lonhienne C, Lonhienne T G, Rentsch D,
et al. Plants can use protein as a nitrogen source without assistance from
other organisms. Proceedings of the National Academy of Sciences, 2008, 105:
4524-4529.）.
Nitrogen transport NPF families include NRT1 and PTR subfamilies, and different members are in plant different parts transporting nitric acid root, widow
Peptide or amino acid etc., serve different on vine growth and development（Rentsch D, Schmidt S, Tegeder M.
Transporters for uptake and allocation of organic nitrogen compounds in
plants. Febs Letters, 2007, 581: 2281-2289.）.OsNPF2.2 has mediated unloading for xylem nitrate anion
Carry, influence paddy growth and seed Grain Filling（Li Y, Ouyang J, Wang Y Y, et al. Disruption of
the rice nitrate transporter OsNPF2.2 hinders root-to-shoot nitrate transport
and vascular development. Scientific reports, 2015, 5: 9635.）.OsNPF7.2To nitric acid
Root has low affine transport, can influence plant strain growth（Hu R, Qiu D, Chen Y, et al. Knock-down of a
tonoplast localized low-affinity nitrate transporter OsNPF7.2 affects rice
growth under high nitrate supply. Frontiers in plant science, 2016, 7.）.
Although known nitrogen nutrition can promote growth and development of plants, nitrogen nutrition have impact on the what kind of growth of plant
There is presently no the understanding of system for development.There is more than 80 member in other paddy rice NPF families, and nitrogen nutrition is by NPF gene families
Any member is responded, and what position to have mediated nitrogen nutrition transport at, so as to have impact on, plant is what kind of to grow,
It is current also almost unknown.So, nitrogen efficient transportation gene may be had by excavating in NPF families, particularly can control paddy rice
The nitrogen transport key gene of plant type, is beneficial to the cultivation of rice high yield kind.The present invention after studying for a long period of time by having found, NPF
FamilyOsNPF7.4Gene pairs rice tillering has important negative regulation effect, after the gene is by interference and gene knockout, can train
The paddy rice of no transgenosis mark is brought out, the improvement of plant plant type is directly applied to, so that increasing production of rice.
The content of the invention
It is an object of the invention to solve problems of the prior art, there is provided nitrogen transporter geneOsNPF7.4In paddy rice
Application in seed selection.
The purpose of the present invention is achieved through the following technical solutions：
The present invention is with the nitrogen transporter gene of paddy riceOsNPF7.4For object, cloned in spending 11 from paddy riceOsNPF7.4CDNA
Sequence.Built by RNAi technologyOsNPF7.4Gene interference expression vector, using AgrobacteriumEHA105The genetic transformation of mediation
Method, interference expression vector is imported and spent in normal japonica rice variety in 11, is obtainedOsNPF7.4The interference that gene expression amount declines
Plant, disturbs the tiller number, number of productive ear and grouting grain number of plant to be significantly improved compared with spending 11 in control wild type.While structure
BuildOsNPF7.4Gene overexpression vector, spends in 11 during overexpression vector is imported, obtainsOsNPF7.4Gene overexpression is planted
Strain, its tiller number, number of productive ear and grouting grain number are significantly reduced compared with spending 11 in.These results indicate that passing through reductionOsNPF7.4Gene expression, can make normal rice tillering number, every plant of number of productive ear increase, and every plant of grouting grain number increases, from
And improve rice yield.
Based on present invention discover thatOsNPF7.4The function of gene, it can be used in paddy rice seed selection.Described paddy rice seed selection
To improve rice tillering number, number of productive ear and grouting grain number, so as to improve rice yield.It can specifically be reduced by RNAi technologyOsNPF7.4The expression of gene is knocked out with the gene editing such as CRISPR technologyOsNPF7.4Gene, make rice tillering number, effectively
Spike number and grouting grain number increase, reach the purpose for improving rice yield.DescribedOsNPF7.4The OsNPF7.4 eggs of gene code
White amino acid sequence is as shown in SEQ ID NO.1；DescribedOsNPF7.4The cDNA sequence of gene is preferably such as SEQ ID NO.2
It is shown.
It is construed as, on the premise of OsNPF7.4 protein actives are not influenceed（I.e. not in the activated centre of albumen）, this
Art personnel can carry out various substitutions, additions and/or deletions one or several to the amino acid sequence shown in SEQ ID NO.1
Individual amino acid obtains the amino acid sequence with equal function.Therefore, OsNPF7.4 albumen also includes ammonia shown in SEQ ID NO.1
Base acid sequence is substituted, replaces and/or increased the protein having with isoreactivity that one or several amino acid are obtained.In addition,
It should be understood that the preferences of the degeneracy and different plant species codon in view of codon, those skilled in the art can basis
Need to use the codon of suitable particular species expression.
Advantages of the present invention and effect：
（1）What the present invention was clonedOsNPF7.4Gene interference table strengthens Tillering Ability in Rice after reaching, explanationOsNPF7.4Gene
Have a significant effect, therefore, reduced by technique for gene engineering to improving rice tillering numberOsNPF7.4The expression of gene can be carried
High plant products.It is not only does this facilitate and cultivate high-yield rice under the conditions of nitrogen by normally applies, can also be by combining gene editing
Technology and molecular breeding carry out the breed improvement of plant.
（2）OsNPF7.4The successful clone of gene, further demonstrate important work of the NPF families in nitrogen absorption process
With the biological function of family is transported to illustrating nitrogen important meaning, in addition to further appreciating that plant nitrogen metabolism approach, carries
High nitrogen absorption efficiency has great impetus.
（3）Although being cloned into some genes for improving plant products at present, to the molecular mechanism of plant yield-increasing still
It is unclear.And what the present invention was clonedOsNPF7.4Gene can improve the tiller number, number of productive ear and grouting grain number of paddy rice, to true
Determining the key factor of plant yield-increasing has great impetus.
Brief description of the drawings
Fig. 1 be spend 11 in control,OsNPF7.4Gene overexpress 2 strains of plant andOsNPF7.4Gene disturbs plant 2
The whole strain phenotypic map of individual strain.
Fig. 2 be spend 11 in control,OsNPF7.4Gene overexpress 2 strains of plant andOsNPF7.4Gene disturbs plant 2
The statistics block diagram of individual strain tiller number, data carry out variable analysis using SPSS softwares（ANOVA）, use Duncan ' s to exist
Significance difference analysis, different group asterisks are carried out in 0.05 level（*）Represent that there is significant difference compared with the control.
Fig. 3 be spend 11 in control,OsNPF7.4Gene overexpress 2 strains of plant andOsNPF7.4Gene disturbs plant 2
The statistics block diagram of individual strain number of productive ear, data carry out variable analysis using SPSS softwares（ANOVA）, use Duncan ' s to exist
Significance difference analysis, different group asterisks are carried out in 0.05 level（*）Represent that there is significant difference compared with the control.
Fig. 4 be spend 11 in control,OsNPF7.4Gene overexpress 2 strains of plant andOsNPF7.4Gene disturbs plant 2
Every plant of seed grouting grain number phenotypic map of individual strain.
Fig. 5 be spend 11 in control,OsNPF7.4Gene overexpress 2 strains of plant andOsNPF7.4Gene disturbs plant 2
Every plant of seed grouting grain number statistical chart of individual strain, data carry out variable analysis using SPSS softwares（ANOVA）, use
Duncan ' s carry out significance difference analysis, different group asterisks in 0.05 level（*）Represent that there is difference compared with the control
Significantly.
Fig. 6 be spend 11 in control,OsNPF7.4Gene overexpress 2 strains of plant andOsNPF7.4Gene disturbs plant 2
The statistics block diagram of individual strain expression quantity, data carry out variable analysis using SPSS softwares（ANOVA）, use Duncan ' s to exist
Significance difference analysis, different group asterisks are carried out in 0.05 level（*）Represent that there is significant difference compared with the control.
Embodiment
With reference to embodiment, the present invention will be further described in detail, but embodiments of the present invention not limited to this.
If not specializing, the conventional meanses that the technological means used by following embodiments is well known to those skilled in the art；Used
Experimental method is conventional method, and can be according to the recombinant technique described（Referring to molecular cloning, laboratory manual, second edition,
CSH Press, Cold SpringHarbor, New York）Complete；Material, reagent used etc., are commercially obtained.
Embodiment 1OsNPF7.4Gene disturbs the structure of plant
Extract in paddy rice and spend 11 RNA, and its reverse transcription is utilized into primer pair into cDNA：
F1：5'-GGTACCACGCCATGGAGAGAGGCCAGCA-3'（KpnI）,
R1：5'-GGATCCAGGTGACCAGCACCATGCCCA-3'（BamH I）；
F2：5'-ACTAGTACGCCATGGAGAGAGGCCAGCA-3'（SpeI）,
R2：5'-GAGCTCAGGTGACCAGCACCATGCCCA-3'（Sac I）；
Respective PCR is amplifiedOsNPF7.4The cDNA fragments of gene, by being connected into after corresponding digestion with restriction enzyme
PTCK303 carriers, are constructedOsNPF7.4The interference expression vector of geneOsNPF7.4-pTCK303.Using Agrobacterium EHA105
The genetic transforming method of mediation, interference expression vector is imported and spent in normal japonica rice variety in 11.
Obtained all transgenic plants are transplanted in the basket with soil, periodically watered, applies fertilizer, treats that seedling grows tall about
During 10cm, plant in big Tanaka, after seedling is grown up, extract genomic DNA and detect that detection is drawn to transfer-gen plant by PCR
Thing to for：
F3：5'-GATGTTGGCGACCTCGTATT-3',
R3：5'-TCGTTATGTTTATCGGCACTTT-3'.
If amplifying 517bp fragment, it is positive plant to illustrate transfer-gen plant.Positive plant individual plant sowing is simultaneously planted
Plant, until T2 generations identify the transfer-gen plant of homozygosis, that is, obtainOsNPF7.4Gene disturbs plant.OsNPF7.4Gene is disturbed
The tiller number of plant, number of productive ear are far more than spending 11 plant in control, significant difference, as shown in Figure 1, 2, 3；And interference plant
Every plant of grouting grain number is dramatically increased than control, as shown in Figure 4 and Figure 5.
TakeOsNPF7.4Gene disturbs plant leaf, extracts blade RNA and by its reverse transcription into cDNA, passes through real-time fluorescence
Quantitative PCR detectionOsNPF7.4As a result gene shows in the expression quantity of interference plant（Fig. 6）Disturb in plantOsNPF7.4Gene
Expression quantity than control in spend 11 reductions.Real-time fluorescence quantitative PCR the primer pair：
F4：ACGCCATGGAGAGAGGCCAGCA,
R4：ACCAGGTTCGTGGCAATGCCGT.
Embodiment 2OsNPF7.4Gene overexpresses the structure of plant
Extract in paddy rice and spend 11 RNA, and its reverse transcription is utilized into primer pair into cDNA：
F5：5'-GGTACCATGGACGCCGGCGACGCCATGGAG-3'（kpnI）,
R5：5'-TCTAGATGACACGACCGTCTTCACCTTGTA-3'（XbaI）；
Expanded by PCROsNPF7.4After the cDNA of gene, pass throughkpnI andXbaI is connected into pCAMBIA-1306 carriers
（PCAMBIA-1306 carriers are purchased from Cambia companies）, constructOsNPF7.4The overexpression vector of geneOsNPF7.4-
p1306.Using AgrobacteriumEHA105The genetic transforming method of mediation, overexpression vector is imported in normal rice varieties and spends 11
In.
Obtained all transgenic plants are transplanted in the basket with soil, periodically watered, applies fertilizer, treats that seedling grows tall about
During 10cm, plant in big Tanaka, after seedling is grown up, extract genomic DNA and detect that detection is drawn to transfer-gen plant by PCR
Thing to for：
F3：5'-GATGTTGGCGACCTCGTATT-3',
R3：5'-TCGTTATGTTTATCGGCACTTT-3'；
If amplifying 517bp fragment, it is positive plant to illustrate transfer-gen plant.Positive plant individual plant sowing is simultaneously planted, directly
The transfer-gen plant of homozygosis is identified to T2 generations, that is, is obtainedOsNPF7.4Gene overexpresses plant.OsNPF7.4Gene is overexpressed
The tiller number of plant, number of productive ear are far fewer than spending 11 plant in control, significant difference, as shown in Figure 1, 2, 3；And overexpression plant
Every plant grouting grain number substantially reduced than control, as shown in Figure 4 and Figure 5.
TakeOsNPF7.4Gene overexpresses plant leaf, extracts RNA and by its reverse transcription into cDNA, fixed by real-time fluorescence
Measure PCR detectionsOsNPF7.4Gene operates be the same as Example 1, as a result shown in the expression quantity of overexpression plant（Fig. 6）Overexpression is planted
In strainOsNPF7.4The expression quantity of gene, which is significantly larger than in control, spends 11.
The above results show,OsNPF7.4Gene by the reduction of expression quantity, can improve the tiller number of paddy rice, effective fringe
Number and grouting grain number, finally improve rice yield.
Above-described embodiment is preferably embodiment, but embodiments of the present invention are not by above-described embodiment of the invention
Limitation, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Wuhan Bioengineering Institute
<120>Applications of the nitrogen transporter gene OsNPF7.4 in paddy rice seed selection
<130> 1
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 575
<212> PRT
<213> Oryza sativa
<400> 1
Met Asp Ala Gly Asp Ala Met Glu Arg Gly Gln Gln Arg Leu Pro Glu
1 5 10 15
Ser Trp Asn Pro Lys Leu Gln Asp Asp Val Ser Leu Thr Val Pro Leu
20 25 30
Ile Gln Asp Lys Lys Ser Gly Ser Lys Ala Pro Ala Val Val Leu Gly
35 40 45
Phe Glu Cys Leu Glu Ser Thr Ala Phe Asn Gly Ile Ala Thr Asn Leu
50 55 60
Val Val Tyr Leu Glu Thr Val Leu His Gly Ser Ser Leu Ala Ser Ala
65 70 75 80
Ser Asn Val Thr Thr Trp Phe Gly Thr Ser Tyr Leu Thr Pro Val Phe
85 90 95
Gly Ala Ile Ile Ala Asp Thr Phe Phe Gly Asn Tyr Asn Thr Ile Leu
100 105 110
Val Ser Leu Val Phe Tyr Leu Leu Gly Met Val Leu Val Thr Phe Ser
115 120 125
Ala Phe Leu Pro Thr Thr Ala Leu Cys Ala Val Ala Gly Ser Thr Ser
130 135 140
Cys Gln Gln Pro Val Phe Gly Ala Gln Thr Ile Ala Phe Val Gly Leu
145 150 155 160
Tyr Leu Val Ala Phe Gly Ser Gly Gly Val Arg Ala Ala Leu Leu Pro
165 170 175
Phe Gly Ala Glu Gln Phe Asp Asp Asp Asn Ala Val Asp Arg Glu Arg
180 185 190
Lys Met Ser Phe Phe Ser Trp Phe Tyr Met Cys Val Asp Phe Gly Met
195 200 205
Ile Val Ser Gly Leu Phe Ile Val Trp Ile Gln Gln Asn Val Ser Trp
210 215 220
Gly Leu Gly Phe Gly Ile Ala Thr Val Cys Val Ala Ile Ala Phe Gly
225 230 235 240
Gly Phe Val Leu Ala Thr Pro Met Tyr Lys Arg Ser Met Pro Thr Gly
245 250 255
Thr Pro Leu Lys Ser Leu Ala Gln Val Val Val Ala Ala Cys Arg Lys
260 265 270
Val Ser Leu Arg Val Pro Ala Asp Ala Ala Leu Leu Tyr Glu Val His
275 280 285
Asp Lys Ile Asp Gln Pro Lys Ile Thr His Thr Asp Glu Phe Ser Phe
290 295 300
Leu Asp Lys Ala Ala Val Ile Val Gln Ser Asp Leu Glu Glu Asp Ser
305 310 315 320
Asn Asp Ala Ser Ala Ala Ala Ala Gly Ser Trp Arg Leu Cys Thr Val
325 330 335
Thr Gln Val Glu Glu Leu Lys Ile Leu Met Arg Leu Leu Pro Ile Trp
340 345 350
Ala Thr Ser Ile Val Leu Ser Ala Ala Tyr Ala Gln Leu Asn Thr Thr
355 360 365
Phe Val Gln Gln Gly Ala Ala Met Asn Met Arg Ile Met Ser Phe Thr
370 375 380
Ile Pro Ala Ala Ser Met Val Ser Phe Glu Val Phe Cys Val Leu Ala
385 390 395 400
Trp Val Leu Val Tyr Gly Ser Val Ile Val Pro Leu Leu Arg Ser Phe
405 410 415
Ser Pro Ala Asn Gly Glu Pro Ser Gln Leu Arg Arg Met Gly Ala Gly
420 425 430
Arg Leu Leu Ile Ala Val Ala Met Ala Ile Ala Ala Leu Val Glu Met
435 440 445
Val Arg Leu Asp Ala Ala Ala Arg Gly Glu Ser Leu Ser Ile Ala Trp
450 455 460
Gln Met Pro Gln Tyr Phe Met Leu Ala Gly Gly Glu Val Phe Cys Tyr
465 470 475 480
Ile Ala Gln Leu Glu Phe Phe Tyr Ser Glu Ala Pro Glu Ser Met Lys
485 490 495
Ser Ile Cys Thr Ser Leu Ala Leu Leu Thr Val Ala Leu Gly Ser Tyr
500 505 510
Met Ser Ser Phe Ile Tyr Ala Val Val Asn Ala Phe Thr Ala Val Asp
515 520 525
Gly Arg Pro Gly Trp Ile Ser Asp Asn Leu Asn Glu Gly His Leu Asp
530 535 540
Tyr Phe Phe Trp Val Met Ser Ala Leu Cys Thr Leu Asn Phe Val Val
545 550 555 560
Tyr Ser Ala Phe Ala Arg Asn Tyr Lys Val Lys Thr Val Val Ser
565 570 575
<210> 2
<211> 1728
<212> DNA
<213> Oryza sativa
<400> 2
atggacgccg gcgacgccat ggagagaggc cagcagcggc tgccagagag ctggaacccg 60
aaactccagg acgacgtcag cctgacggtg ccactcatcc aggacaagaa gagcgggagc 120
aaagcgccgg cggtggtgct aggattcgag tgcttggaga gcacagcgtt caacggcatt 180
gccacgaacc tggtggtgta cctggagacc gtcctgcacg gcagcagcct cgcgagcgcg 240
tccaatgtca cgacgtggtt cggcacgagc tacctcacgc cggtgttcgg cgccatcatc 300
gccgacacgt tcttcggcaa ctacaacacc atcctcgtct ccctcgtgtt ctacctcctg 360
ggcatggtgc tggtcacctt ctcggcgttc ctgccgacca ccgcgctgtg cgccgtggcg 420
ggctcgacgt cgtgccagca gcctgtgttt ggcgcgcaga ccatcgcctt cgtggggctc 480
tacctcgtgg cgttcggcag cggcggcgtg cgcgcggcgc tgctgccgtt cggcgcggag 540
cagttcgacg acgacaacgc ggtggaccgg gagcggaaga tgtccttctt cagctggttc 600
tacatgtgcg tcgacttcgg gatgatcgtg tcgggcctat tcatcgtgtg gatccagcag 660
aacgtgagct ggggactcgg cttcggcatc gccacggttt gcgtcgcgat cgcgttcggc 720
ggcttcgtgc tcgccacgcc catgtacaag cgcagcatgc ccaccggcac gccgctcaag 780
agcctcgccc aggtggtggt cgccgcgtgc cggaaggtca gcctccgtgt ccccgccgac 840
gccgccctcc tctacgaggt ccatgacaag atcgatcagc ccaagatcac gcacaccgac 900
gagttcagct ttcttgacaa ggcggcggtg atcgtgcagt ccgacctgga agaggactcg 960
aacgacgcct cggcggcggc cgcgggctcg tggaggctat gcacggtgac gcaggtggag 1020
gagctcaaga tcctgatgcg gctgctgccg atatgggcga cgagcatcgt gctgtcggcg 1080
gcgtacgcgc agctgaacac cacgttcgtg cagcagggcg ccgcgatgaa catgcggatc 1140
atgtcgttca ccatccccgc cgcgtcgatg gtgtccttcg aggtgttctg cgtcctggca 1200
tgggtgctcg tctacggctc ggtgatcgtg ccgctcctca ggagcttctc cccggccaac 1260
ggcgagccgt cgcagctgcg gcgcatgggc gccggccgtc tgctcatcgc ggtcgccatg 1320
gccatcgccg cgctggtgga gatggtgcgc ctcgacgcgg cggcgcgcgg cgagtccctg 1380
agcatcgcgt ggcagatgcc gcagtacttc atgctggccg gcggtgaggt gttctgctac 1440
atcgcgcagc tggagttctt ctacagcgag gcgccggagt ccatgaagag catctgcacg 1500
tcgctggcgc tgctcaccgt ggcgctggga agctacatga gctccttcat ctacgccgtc 1560
gtgaacgcgt tcaccgccgt ggacggccgg cccgggtgga tttcggacaa cctcaacgag 1620
ggacacctgg actacttctt ctgggtcatg tcggcgctgt gcacgctcaa cttcgtcgtg 1680
tacagcgcgt tcgcgcggaa ctacaaggtg aagacggtcg tgtcatga 1728
Claims (4)
1. OsNPF7.4Application of the gene in paddy rice seed selection, it is characterised in that：Described paddy rice seed selection is raising rice tillering
Number, spike number and grouting grain number.
2. application according to claim 1, it is characterised in that：Pass through reductionOsNPF7.4The expression of gene or knockoutOsNPF7.4Gene makes rice tillering number, spike number and grouting grain number increase.
3. application according to claim 1 or 2, it is characterised in that：DescribedOsNPF7.4The OsNPF7.4 of gene code
The amino acid sequence of albumen is as shown in SEQ ID NO.1；Or OsNPF7.4 albumen passes through for amino acid sequence shown in SEQ ID NO.1
Replace, replace and/or increase the protein having with isoreactivity that one or several amino acid are obtained.
4. application according to claim 3, it is characterised in that：DescribedOsNPF7.4The cDNA sequence of gene such as SEQ ID
Shown in NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710330664.8A CN106947777B (en) | 2017-05-11 | 2017-05-11 | Application of nitrogen transport gene OsNPF7.4 in rice breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710330664.8A CN106947777B (en) | 2017-05-11 | 2017-05-11 | Application of nitrogen transport gene OsNPF7.4 in rice breeding |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106947777A true CN106947777A (en) | 2017-07-14 |
| CN106947777B CN106947777B (en) | 2020-05-29 |
Family
ID=59479591
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710330664.8A Active CN106947777B (en) | 2017-05-11 | 2017-05-11 | Application of nitrogen transport gene OsNPF7.4 in rice breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106947777B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107936103A (en) * | 2017-11-27 | 2018-04-20 | 武汉生物工程学院 | Application of the OsNPF7.11b genes in rice yield is improved |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101027397A (en) * | 2004-04-23 | 2007-08-29 | 西尔斯公司 | Nucleotide sequences and polypeptides encoded thereby useful for modifying nitrogen use efficiency characteristics in plants |
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
| CN104277101A (en) * | 2014-09-24 | 2015-01-14 | 中国科学院遗传与发育生物学研究所 | Application of rice nitrate transporter NRT1.1B in enhancing nitrogen utilization efficiency of plants |
| CN106222180A (en) * | 2016-07-28 | 2016-12-14 | 武汉生物工程学院 | Improve rice yield and the gene OsNPF7.3 of grain of rice protein content and purposes |
| CN106434666A (en) * | 2016-10-20 | 2017-02-22 | 武汉生物工程学院 | Application of promoter achieving specific expression in rice tiller bud base and panicle |
| CN106518993A (en) * | 2016-10-25 | 2017-03-22 | 武汉生物工程学院 | Application of amino acid transporter gene OsAAP3 in rice seed selection |
-
2017
- 2017-05-11 CN CN201710330664.8A patent/CN106947777B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101027397A (en) * | 2004-04-23 | 2007-08-29 | 西尔斯公司 | Nucleotide sequences and polypeptides encoded thereby useful for modifying nitrogen use efficiency characteristics in plants |
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
| CN104277101A (en) * | 2014-09-24 | 2015-01-14 | 中国科学院遗传与发育生物学研究所 | Application of rice nitrate transporter NRT1.1B in enhancing nitrogen utilization efficiency of plants |
| CN106222180A (en) * | 2016-07-28 | 2016-12-14 | 武汉生物工程学院 | Improve rice yield and the gene OsNPF7.3 of grain of rice protein content and purposes |
| CN106434666A (en) * | 2016-10-20 | 2017-02-22 | 武汉生物工程学院 | Application of promoter achieving specific expression in rice tiller bud base and panicle |
| CN106518993A (en) * | 2016-10-25 | 2017-03-22 | 武汉生物工程学院 | Application of amino acid transporter gene OsAAP3 in rice seed selection |
Non-Patent Citations (5)
| Title |
|---|
| DORIS RENTSCH ET AL: "Transporters for uptake and allocation of organic nitrogen compounds in plants", 《FEBS LETTERS》 * |
| L ZHANG ET AL: "Altered Xylem-Phloem Transfer of Amino Acids Affects Metabolism and Leads to Increased Seed Yield and Oil Content in Arabidopsis", 《PLANT CELL》 * |
| XIAORONG FAN ET AL: "Over-expression of OsPTR6 in rice increased plant growth at differentnitrogen supplies but decreased nitrogen use efficiency at high ammonium supply", 《PLANT SCIENCE》 * |
| 无: "ACCESSION NO.XM_015778560，PREDICTED: Oryza sativa Japonica Group protein NRT1/ PTR FAMILY 8.3 （LOC4336852），mRNA", 《GENBANK》 * |
| 蔡昭艳 等: "植物寡肽运输与硝酸根运输基因家族的研究进展", 《热带亚热带植物学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107936103A (en) * | 2017-11-27 | 2018-04-20 | 武汉生物工程学院 | Application of the OsNPF7.11b genes in rice yield is improved |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106947777B (en) | 2020-05-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107099549A (en) | Application of the OsNPF5.16 genes in paddy rice single plant yield is improved | |
| CN106518993B (en) | Application of the amino acid transport gene OsAAP3 in rice breeding | |
| CN106929522B (en) | Amino acid transport gene OsAAP1 promotes the application of paddy growth under low nitrogen | |
| CN106337055B (en) | Application of the nitrate anion transporter gene OsNRT1.8 in rice breeding | |
| CN106434693B (en) | Application of the amino acid transport gene OsAAP4 in rice breeding | |
| CN106967730A (en) | Application of the OsNPF6.3 genes in rice tillering number is improved | |
| CN106434666B (en) | A kind of application in rice tillering bastem portion and the specifically expressed promoter of fringe | |
| CN108034672A (en) | Applications of the nitrate anion transporter gene OsNRT1.9b in rice selection and breeding | |
| CN106591354B (en) | Application of the amino acid transport gene OsAAP5 in rice breeding | |
| CN109852618A (en) | A kind of section melon WRKY class transcription factor gene CqWRKY1 and its application | |
| CN106868022B (en) | Nitrogen transport gene OsNPF2.4b for promoting increase of effective spike number of rice and application thereof | |
| CN108070601A (en) | Application of the OsNPF8.6b genes in rice yield is improved | |
| CN107056909A (en) | Application of the OsNPF5.11 genes in rice yield is improved | |
| CN107936103A (en) | Application of the OsNPF7.11b genes in rice yield is improved | |
| CN106947777A (en) | Applications of the nitrogen transporter gene OsNPF7.4 in paddy rice seed selection | |
| CN108034661A (en) | Application of the OsNPF8.8b genes in rice yield and nutritional quality is improved | |
| CN105802931A (en) | CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN108864264B (en) | Corn OXS2a gene, and encoding protein and application thereof | |
| CN112662681B (en) | Application of OsNRAMP1 in improving disease resistance of rice | |
| CN106967745B (en) | Application of nitrogen nutrition transport gene OsNPF7.1 in improving tillering and spike number of rice | |
| CN107012153B (en) | Application of nitrogen nutrition transport gene OsNPF8.1 in improving tillering number of rice | |
| CN108118062B (en) | Application of nitrate transport gene OsNRT1.9a in rice breeding | |
| CN106755068B (en) | Application of the amino acid transport gene OsANT1 in rice breeding | |
| CN107937433B (en) | Application of OsNPF8.13 gene in promotion of rice growth under high nitrogen | |
| CN107653253A (en) | One kind regulation and control Tobacco Flowering period NtMADS2 genes and its cloning process and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |