CN106929604B - Primer group and probe sequence for detecting abalone herpes virus - Google Patents

Abstract

The invention discloses a primer group and a probe sequence for detecting abalone herpes viruses, wherein the primer group comprises the following components: FP CTTTCTTACCGCTTTCAATCTGATCCGTGG, RP: GAACAGGGGTAATTGTATAGCAACTGCGTA; the probe sequence is as follows: GCGTACAGTAAAACGAAAACCATGGCACA (dT-FAM) GC (THF) CA (dT-BHQ 1) TGAAAACATCCAAGC (C3 spacer). The invention discloses application of the primer group and the probe sequence in preparation of a reagent for RPA detection of abalone herpesviruses. The fluorescence quantitative RPA detection method developed on the basis of the primer group and the probe sequence has the advantages of high sensitivity, strong specificity, rapid reaction, low requirements on instruments and equipment and the like, and is very suitable for the detection of aquatic animal pathogens.

Description

Primer group and probe sequence for detecting abalone herpes virus

Technical Field

The invention relates to a primer and a probe, in particular to a primer group and a probe sequence for detecting abalone herpesviruses.

Background

Abalone herpes virus (Abalon herpes-like virus, AbHV) is used as a main pathogen of low-temperature virus diseases of abalones, causes a malignant epidemic disease of the haliotis diversicolor aquatica cultured in main culture areas of the haliotis diversicolor aquatica in southern China from spring 1999, and causes devastating attack on the haliotis diversicolor aquatica culture industry in China. The disease is strong in infectivity, can infect Haliotis diversicolor of various specifications, but rarely causes Haliotis diversicolor and other diseases, and has species specificity; the disease is violent and usually takes 3 days from the appearance of symptoms to death in the whole pool. At present, no effective treatment method exists for the virus disease, and early and accurate detection of the virus is particularly important for preventing and controlling the disease, so that establishment of a simple, convenient, rapid, sensitive and accurate virus detection method has important significance for preventing and controlling the virus disease. Currently, pathogen detection techniques typified by Polymerase Chain Reaction (PCR) are commonly used. However, the process needs precise instruments and special test sites, is long in time consumption and low in timeliness, and cannot meet the requirement of on-site diagnosis of aquaculture. Recombinase Polymerase Amplification (RPA) is a nucleic acid rapid detection technology which can be carried out at room temperature in recent years, does not need temperature control equipment, can be quickly completed within 15 minutes, has the same sensitivity and specificity as PCR, and is very suitable for the on-site rapid detection of aquatic pathogens. The primer group and the probe used for detecting the RPA are core components of the primer group and the probe, and the core components determine the detection effect of the RPA. However, the design difficulty of the RPA primer and the probe is higher, professional design software similar to the PCR primer is not available, and the sensitivity and specificity of detection completely depend on the experience of a primer designer and a large amount of test verification. Sometimes, 1 set of available detection sequences is difficult to screen from dozens of sets of candidate primer probe combinations, so the design of the primer is the key to the success or failure of the RPA detection method.

Disclosure of Invention

One of the purposes of the invention is to provide a primer group and a probe sequence for detecting abalone herpes viruses.

The primer set and probe sequence of the present invention were designed based on the gene sequence of ORF 38 (GenBank accession No. JX453331.1) of the virus.

The invention provides a primer group and a probe sequence for detecting abalone herpes viruses, wherein the primer group comprises:

FP : CTTTCTTACCGCTTTCAATCTGATCCGTGG

RP : GAACAGGGGTAATTGTATAGCAACTGCGTA

the probe sequence is as follows:

GCGTACAGTAAAACGAAAACCATGGCACA（dT-FAM）GC（THF）CA（dT-BHQ1）TGAAAACATCCAAGC（C3spacer）。

the invention also aims to provide application of the primer group and the probe sequence in preparing a reagent for detecting the abalone herpes virus by the RPA.

The invention has the beneficial effects that:

the invention provides a set of fluorescence quantitative RPA (qRPA) detection primers and probe sets for abalone herpesviruses, and the fluorescence quantitative RPA detection method developed on the basis of the primers and the probe sets has the advantages of high sensitivity, strong specificity, rapid reaction, low requirements on instruments and equipment and the like, and is very suitable for the detection of aquatic animal pathogens. The detection sensitivity of an AbHV-qRPA detection system is similar to that of qPCR, but the detection time is only 20 +/-0.50 minutes, and the time is greatly shortened compared with that of qPCR; the reaction temperature is constant at 37 ℃, a temperature raising and reducing system is not needed, and the method is suitable for field operation.

Drawings

FIG. 1 is an electrophoretogram of the amplification product in example one.

FIG. 2 is a graph of the amplification curve of the AbHV-qRPA detection system;

the different curves represent 10⁷-10 different concentrations of plasmid copy number, each amplification curve being an average of three repeated measurements.

FIG. 3 is a standard curve for the AbHV-qRPA assay system;

the cycle number corresponding to the standard substance with different concentrations reaching the fluorescence threshold value in the AbHV-qRPA detection system is reflected.

FIG. 4 is a scatter plot of the results of the AbHV-qRPA and AbHV-qPCR assays;

the correlation between the detection results of the AbHV-qRPA and the AbHV-qPCR is reflected.

Detailed Description

The present invention will be described in further detail with reference to the following specific examples and drawings, but the scope of the present invention is not limited to the following examples.

Example 1 design and specific detection of primer set and Probe

The primer group and the probe are designed according to the ORF 38 (GenBank access No. JX453331.1) gene sequence of the virus, wherein the target gene sequence is as follows:

TGAACAGGGGTAATTGTATAGCAACTGCGTACAGTAAAACGAAAACCATGGCACATGCCATTGAAAACATCCAAGCAAACACCCAAGGCAAGTTTGTTGTTCCTTTATGCAAACAGATTCTCAAAACGACTAAAGAAACCACGGATCAGATTGAAAGCGGTAAGAAAGA。

FP : CTTTCTTACCGCTTTCAATCTGATCCGTGG

RP : GAACAGGGGTAATTGTATAGCAACTGCGTA

the probe sequence is as follows:

GCGTACAGTAAAACGAAAACCATGGCACA（dT-FAM）GC（THF）CA（dT-BHQ1）TGAAAACATCCAAGC（C3spacer）。

and (3) specific detection: establishment of positive control, ddH containing AbHV₂And detecting by taking the genomic DNA as a template, wherein the negative control of O, the genomic DNA control of shrimp virus (WSSV), the genomic DNA control of trachinotus ovatus, the genomic DNA control of Babylonia, the genomic DNA control of oyster, the genomic DNA control of water and the genomic DNA control of aeromonas hydrophila are adopted.

Extracting herpes abalone virus genome DNA, shrimp virus (WSSV) genome DNA, trachinotus ovatus genome DNA, Bafeng snail genome DNA and oyster genome DNA by using a marine animal tissue extraction kit (Dongsheng, Guangdong, China), and specifically operating according to the instructions on the instruction.

The extraction of the water body DNA and the genome DNA of the aeromonas hydrophila uses a bacterial DNA extraction kit (magenta, Suzhou, China), and the specific operation is carried out according to the instruction on the instruction.

Reaction system:

rehydration buffer (twist KIT (TABAS 03 KIT)): 14.8ul

RPA FP（10 μM）: 1.2 μL

RPA RP（10 μM）:1.2 μL

dd H₂O :4.6 μL

DNA（50~500ng）:2 μL

MgAC（280 nM）:1.2 μL

Reaction conditions are as follows: incubate at 37 ℃ for 30 minutes.

After the reaction, the reaction was judged by agarose gel electrophoresis (1.5% agarose), and the results showed that neither the genomic DNA nor the negative control had an amplified signal, while the positive control had a significant amplified signal (FIG. 1). Therefore, the primer group and the probe established by the invention have strong specificity.

Example 2 sensitivity verification

The standard curve template was synthesized by Shanghai Weiji fundopy. The template is formed by connecting a target gene segment and a PMD18-Tvector vector. The vector sequence has been published: http:// wenku. baidu.com/view/385564 bdff 121dd36aa32d8271. html.

Detecting by adopting an absolute quantitative method: diluting the constructed plasmid standard substance by using TE Buffer in a 10-fold gradient manner to construct different concentration gradients 10⁷、10⁶、10⁵、10⁴、10³、10²And 10 Standard Curve by ddH₂O was used as a negative control, and each concentration was repeated three times. The RPA amplification reaction was performed using a real-time fluorescent quantitative PCR instrument (Eppendorf).

Reaction system:

regeneration buffer (twist KIT, TAEXO02 KIT) 14.7. mu.L

RPA FP（10 μM）: 1.1 μL

RPA RP（10 μM）:1.1 μL

Probe（10 μM）:0.3 μL

dd H₂O :4.6 μL

DNA（50~500 ng）:2 μL

MgAC（280 nM）:1.2 μL

Reaction conditions are as follows: incubate at 37 ℃ for 30 minutes.

And establishing an amplification curve and amplification efficiency of each concentration according to the amplification result of each concentration, counting the result, and establishing a standard curve, wherein the result is shown in figures 2 and 3. As can be seen from fig. 2, the detection limit of AbHV by this detection method is 100 copies.

Example 3 feasibility verification

In order to further determine the reliability of the qRPA detection system, 50 Haliotis diversicolor is randomly extracted, and qRPA and qPCR detection is respectively carried out on the AbHV content in the body of the Haliotis diversicolor. The results show (see FIG. 4) that the results of the two diagnostic methods exhibit a better correlation (R)²>0.8）

The abalone muscle tissue DNA is extracted by using a marine animal tissue extraction kit, and the specific operation is carried out according to the instruction of a specification.

The qRPA detection method, primer set and probe were as in example 2.

The qPCR detection method adopts reported TaqMan^®PCR technology (Corbeil S, Williams L Met al,. Development and validation of a TaqMan PCR assay for the Australian bamboo leaves-like virus section. diseases of aqueous organics, 2010) using primers and probe sequences respectively:

F：AACCCACACCCAATTTTTGA

R：CCCAAGGCAAGTTTGTTGTT

Probe：6 FAM-CCGCTTTCAATCTGATCCGTGG-TAMRA。

the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. Any minor modifications, equivalent changes and modifications to the above embodiments in accordance with the essential technology of the present invention are within the scope of the technical solution of the present invention.

Sequence listing

<110> research institute for aquatic products in south China sea

<120> primer group and probe sequence for detecting abalone herpes virus

<160>7

<210>1

<211>30

<212>DNA

<213> primer FP

<400>1

ctttcttacc gctttcaatc tgatccgtgg 30

<210>2

<211>30

<212>DNA

<213> primer RP

<400>2

gaacaggggt aattgtatag caactgcgta 30

<210>3

<211>48

<212>DNA

<213> Probe sequence

<400>3

gcgtacagta aaacgaaaac catggcaca（dT-FAM）gc（THF）ca（dT-BHQ1）tgaaaacatccaagc（C3spacer） 48

<210>4

<211>169

<212>DNA

<213>ORF 38

<400>4

tgaacagggg taattgtata gcaactgcgt acagtaaaac gaaaaccatg gcacatgcca 60

ttgaaaacat ccaagcaaac acccaaggca agtttgttgt tcctttatgc aaacagattc 120

tcaaaacgac taaagaaacc acggatcaga ttgaaagcgg taagaaaga 169

<210>5

<211>20

<212>DNA

<213> primer F

<400>5

aacccacacc caatttttga 20

<210>6

<211>20

<212>DNA

<213> primer R

<400>6

cccaaggcaa gtttgttgtt 20

<210>7

<211>22

<212>DNA

<213> primer R

<400>7

6 FAM- ccgctttcaatctgatccgtgg -TAMRA 22

Claims (2)

1. The primer group and the probe sequence for detecting the abalone herpes virus are characterized in that the primer group comprises:

FP : CTTTCTTACCGCTTTCAATCTGATCCGTGG

RP : GAACAGGGGTAATTGTATAGCAACTGCGTA

the probe sequence is as follows:

GCGTACAGTAAAACGAAAACCATGGCACA（dT-FAM）GC（THF）CA（dT-BHQ1）TGAAAACATCCAAGC（C3spacer）。

2. the use of the primer set and the probe sequence as set forth in claim 1 in the preparation of a reagent for RPA detection of herpes baumannii virus.

Images