CN104789700B - DHAV parting detection methods based on quantitative fluorescent PCR melting curve method - Google Patents
DHAV parting detection methods based on quantitative fluorescent PCR melting curve method Download PDFInfo
- Publication number
- CN104789700B CN104789700B CN201510158357.7A CN201510158357A CN104789700B CN 104789700 B CN104789700 B CN 104789700B CN 201510158357 A CN201510158357 A CN 201510158357A CN 104789700 B CN104789700 B CN 104789700B
- Authority
- CN
- China
- Prior art keywords
- dhav
- melting curve
- duck hepatitis
- virus
- type duck
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of DHAV parting detection methods based on quantitative fluorescent PCR melting curve method：The extraction of viral RNA and cDNA synthesis；The preparation of positive criteria template；The foundation of A type duck hepatitis virus genotyping detection method based on quantitative fluorescent PCR melting curve method；Method validation：Specific test, sensitivity tests, replica test.Only needed in the present invention plus pair of primers, single tube detect A, C genotype, method is simple and easy, takes few；Whole amplification and detection process are stopped pipe operation, avoid the pollution of pcr amplification product, reduce false positive results；Amplified fragments are short, the higher annealing temperature of use, ensure that the specificity of amplification.The present invention establishes a kind of method of quick detection parting duck hepatitis A virus, and the correct diagnosis and preventing and treating to the disease provide a great convenience, and economic benefit is brought for agricultural production.
Description
Technical field
The present invention relates to a kind of DHAV (A type duck hepatitis virus) parting detection based on quantitative fluorescent PCR melting curve method
Method.
Background technology
A type duck hepatitis virus (Duck hepatitis A virus, DHAV) is a kind of to cause Duck Hepatitis Virus
Main pathogen.Mainly acute necrotizing hepatitis occurs as pathological characters using the duckling of 1~21 age in days in it, the rapid and death rate of falling ill
Infectiousness high and with height, has been in worldwide distribution at present.DHAV can be divided into DHAV-A according to genetic evolution distance,
DHAV-B, DHAV-C totally three kinds of genotype, the advantage strain in wherein China is mainly DHAV-A and DHAV-C.Due to for
DHAV specific antibodies are difficult to pass to duckling by laying duckses, therefore current rely primarily on injects attenuated vaccine or special to duckling
The Yolk antibody of property prevents and treats the sick generation.Lack to intersect but many experiments confirm, between the DHAV of different genotype and protect
Shield ability, i.e., the infection for preventing and treating DHAV-C is not worked using the attenuated vaccine for DHAV-A or Yolk antibody, otherwise also
So.By the clinical symptoms shown after the virus infection duckling of two kinds of genotype and pathological change are closely similar, only with eye
Seeing pathological change can not distinguish；And current DHAV-A and DHAV-C common popular phenomenon is on the rise, the correct diagnosis to the disease
Great difficulty is brought with preventing and treating.Therefore there is an urgent need to establish a kind of feasible method, energy quick detection illness duckling is infected
DHAV which kind of genotype belonged to, the Yolk antibody and attenuated vaccine of clinical proper use of homotype are instructed with this.
At present, it is that it is main quick to detect DHAV genetic fragment using inverse transcription polymerase chain reaction (RT-PCR)
Detection method, but this method can not quantify to virus.Also have been reported that while detect and distinguish using two pairs of primers
DHAV-A and DHAV-C, but the simplicity of the sensitivity and operation of this method has all been short of, and need to carry out nucleic acid electrophoresis
It could complete so as to add the time-consuming of detection.Fluorescence quantitative RT-RCR technology is because with specificity, accuracy, totally-enclosed reaction
The advantages that, have become the important means of quick detection pathogenic microorganism.RRT-PCR has been reported applied to DHAV detection
Road.The RRT-PCR technologies that Miao etc. establishes Taq man sonde methods detect DHAV-A in duck embryos and chick embryo allantoic liquid respectively.
Hydrolysis probes and primer are designed according to DHAV-A 3D genes conserved region sequence, can detect the DHAV-A's of about 10 copies
Geneome RNA.Huang etc. establishes the RRT-PCR technologies of SYBR Green methods to detect the DHAV-C in clinical tissue.Root
Pair of primers is designed according to DHAV-C 2C genes conserved region sequence, can detect the DHAV-C of about 3000 copies genome
RNA.A kind of but current not yet report about carrying out antidiastole different genotype DHAV using RRT-PCR.Due to SYBR
Green fluorescent dyes with all DNA double chains because can be combined, and to template without selectivity, and its is cheap therefore more applicable
In the detection of a variety of purpose products.Solubility curve analytic approach is PCR primer after SYBR Green methods are expanded from certain temperature
Degree starts to be raised slowly to 95 DEG C, amplified production double-stranded DNA with temperature raise gradually denaturation unwind produce it is single-stranded.In dehybridization procedure
The fluorescent dye SYBR Green being embedded into double-strand can be released, the change of fluorescence signal in instrument automatic detection reaction tube
Change, finally draw out the solubility curve that amplified production fluorescence signal varies with temperature, and obtain the solubility curve of corresponding PCR primer
Peak figure.Therefore different size, the PCR primer of different genes composition, its solubility curve peak type figure are different.
DHAV of the invention by more a large amount of different genotypes, in the obvious 5 ' UTR region of its G+C content difference, if
DHAV-A and DHAV-C can be expanded simultaneously by counting out pair of primers；And by comparing the solubility curve of amplified production come easy, fast
Differentiate the virogene type in detection sample fastly.
The content of the invention
For in the prior art the defects of, it is an object of the invention to provide one kind to be based on quantitative fluorescent PCR melting curve method
DHAV (A type duck hepatitis virus) parting detection method.Detection method only adds a pair in a PCR reaction system and drawn
Thing, single tube detection A, C genotype, method is simple and easy, takes few；Whole amplification and detection process are stopped pipe operation, are avoided
The pollution of pcr amplification product, reduces false positive results；This detection method amplified fragments are short, the higher annealing temperature of use, protect
The specificity of amplification is demonstrate,proved.Can simply and quickly it be reflected by Tm values after melting curve step after quantitative real time PCR Instrument amplification
Other DHAV genotype.The present invention establishes a kind of method of quick detection parting duck hepatitis A virus, to the disease correct diagnosis and
Preventing and treating is provided a great convenience, and economic benefit is brought for agricultural production.
The present invention is achieved by the following technical solutions：
In a first aspect, the present invention provides a kind of A type duck hepatitis virus parting based on quantitative fluorescent PCR melting curve method
Detection primer, the primer are as follows：
DHAV-F:5'GTTGTGAAACGGATTACCGGTAGT 3',
DHAV-R:5'ACTCGACCAGCCGCGACCCTAT 3'。
Second aspect, the present invention provide a kind of A type duck hepatitis virus parting based on quantitative fluorescent PCR melting curve method
Detection positive plasmid, the plasmid include pMD-19T-DHAV-A and pMD-19T-DHAV-C.
The third aspect, the present invention provide a kind of A type duck hepatitis virus parting based on quantitative fluorescent PCR melting curve method
Positive plasmid standard items are used in detection；
The concentration of plasmid described in the positive plasmid standard items is 1 × 1011copies/μL；Can be with dilute during use
It is interpreted as concentration gradient.
Fourth aspect, the present invention provide a kind of A type duck hepatitis virus parting based on quantitative fluorescent PCR melting curve method
Detection method, the detection method include：
Step 1: the extraction of viral RNA and cDNA synthesis：A type duck hepatitis virus total serum IgE is extracted from attacking in malicious duck tissue,
Reverse transcription obtains cDNA；
Step 2: the preparation of positive criteria template：Using the cDNA as template, using the DHAV-F and DHAV-R to draw
Thing, performing PCR amplification is entered to the target gene of A type duck hepatitis virus；The positive restructuring matter is built with the pcr amplification product
Grain；
Step 3: the foundation of the A type duck hepatitis virus genotyping detection method based on quantitative fluorescent PCR melting curve method：With
The positive recombinant plasmid is template, optimizes the PCR reaction conditions, draws standard curve, melting curve；
Step 4: method validation：The real-time fluorescence quantitative PCR detection method that step 3 is established is verified as follows：
Specific test：Using fluorescent quantitative PCR detection method described in step 3, according to the standard curve and melt bent
Line, specific detection is carried out to A type duck hepatitis virus and non-A type duck hepatitis fowl source virus；
Sensitivity tests：The positive plasmid standard items are diluted, while set up regular-PCR control group, are expanded respectively,
Obtain minimum template detection copy number；
Replica test：The positive plasmid standard items are done respectively in criticizing and repeated between criticizing, while set negative control, led to
The calculating to the TM values of A type duck hepatitis virus and the analysis correlation variation coefficient of melting curve is crossed, verifies the A type duck hepatitis
The repeatability of Viral typing detection method.
Preferably, in step 1, the duck includes Beijing duck, and the tissue includes liver.
Preferably, in step 3, the PCR reaction conditions include primer concentration, annealing temperature.
Preferably, the primer concentration scope is 0.04~1.04umol/L；The annealing temperature is 54~62 DEG C.
Preferably, the primer concentration is 0.24umol/L；The annealing temperature is 55 DEG C.
Preferably, in the specific test of step 4, the A type duck hepatitis virus includes DHAV-A, DHAV-C；It is described
Non- A type duck hepatitis fowl source virus includes duck reovirus, NDV, avian influenza virus, infectious bronchitis
Poison, goose parvovirus, duck plague, duck egg drop syndrome virus, duck tembusu virus etc..
Preferably, in the sensitivity tests of step 4, the dilution is included according to 10 times of gradient dilutions；This operation is implemented
It is 100 copies/μ L to go out the minimum template detection copy number that fluorescent quantitative PCR detection method detects.
Preferably, in the replica test of the step 4, repeat to refer specifically to do in 3 batches in described batch and between criticizing to repeat
And repeated between 3 batches, positive recombinant plasmid concentration is respectively adopted：1×107copies/μL、1×105copies/μL、1×
104copies/μL。
Preferably, the positive plasmid concentration is 1 × 107copies/μL、1×105copies/μL。
In summary, the present invention has been successfully established based on quantitative fluorescent PCR melting curve method by using pair of primers
A type duck hepatitis virus parting detection method, the letter of Tm values can be passed through after melting curve step after quantitative real time PCR Instrument expands
Just DHAV genotype, is rapidly differentiated.
Compared with prior art, the present invention has following beneficial effect：
1st, it is only simple added with pair of primers, single tube detection A, C genotype, method in a PCR reaction system in the detection method
It is single easy, take less；
2nd, the detection method reduces testing cost, reduces the appearance of false negative result without using Taq Man probes；
3rd, entirely amplification and detection process are stopped pipe operation, are not required to uncap and draw amplified production progress electrophoresis, avoid
The pollution of pcr amplification product, reduces false positive results；
4th, the detection method amplified fragments are short, the higher annealing temperature of use, can also ensure the specificity of amplification；
5th, SYBR Green are a kind of asymmetric nitrile fluoresceins, can be non-specifically embedded in DNA double helical structure
Ditch in, the number of the size representation DNA duplex molecule of fluorescence intensity, therefore can tentatively judge from the power of fluorescence intensity
The number of DNA double chain molecule；
6th, when two DNA molecular renaturation combine, fluorescence is most strong, rises that fluorescence intensity reduces and to occur one more permanent with temperature
The fixed gradient, when temperature reaches Tm values, fluorescence intensity drastically declines；Melting curve figure is can obtain by software analysis, its crest
The Tm values of the temperature representative double chain DNA molecule at place；DHAV genotype can simply and quickly be differentiated by Tm values；
7th, the size of Tm values is depending on G/C contents in the length and its sequence of amplification of DNA fragments, therefore amplified production is different
Corresponding Tm values are also different, can differentiate DHAV genotype by Tm values after the analysis of melting curve method, reduce and exclude non-spy
The interference of different amplified production and primer dimer, ensure that the specificity of the detection method.
Brief description of the drawings
The detailed description made by reading with reference to the following drawings to non-limiting example, further feature of the invention,
Objects and advantages will become more apparent upon：
Fig. 1 is the structure of recombinant plasmid；
Wherein, A:pMD-19T-DHAV-A C:pMD-19T-DHAV-C；
Fig. 2 is detection DHAV-A amplification curve, canonical plotting；
Wherein, A is DHAV-A amplification curve diagram；
1~7：pMD-19T-DHAV-C 1×109、1×108、1×107、1×106、1×105、1×104、1×
103Copies/ μ L series standard template；
B is DHAV-A canonical plotting；
Fig. 3 is detection DHAV-C amplification curve, canonical plotting；
Wherein, A is DHAV-C amplification curve diagram,
1~7：pMD-19T-DHAV-C 1×109、1×108、1×107、1×106、1×105、1×104、1×
103Copies/ μ L series standard template；
B is DHAV-C canonical plotting；
Fig. 4 is DHAV-A, DHAV-C melting curve figures；
Wherein A:DHAV-A, C:DHAV-C；
Fig. 5 is the specific amplification curve of fluorescence quantitative RT-RCR；
Wherein 1：DHAV-A 2：DHAV-C 3-9:DRV、NDV、AIV、IBV、GPV、DEV、DTMUV；
Fig. 6 is that regular-PCR expands electrophoretogram；
Wherein A:Plasmid pMD-19T-DHAV-A, C:Plasmid pMD-19T-DHAV-C
1~8：1×109、1×108、1×107、1×106、1×105、1×104、1×103、1×102Copies/ μ L's
Series standard template；
Fig. 7 is duck virus hepatitis Tissue distribution figure；
Wherein A is DHAV-A Tissue distribution figures；B is DHAV-C Tissue distribution figures.
Embodiment
With reference to specific embodiment, the present invention is described in detail.Following examples will be helpful to the technology of this area
Personnel further understand the present invention, but the invention is not limited in any way.It should be pointed out that the ordinary skill to this area
For personnel, without departing from the inventive concept of the premise, various modifications and improvements can be made.These belong to the present invention
Protection domain.
1.1 strain
DHAV-A ZJV strains, DHAV-C LS strains (KP233203), DRV TH11 strains, NDV (NDV), H7 fowl stream
Influenza Virus (AIV), avian infectious bronchitis virus (IBV), goose parvovirus (GPV), duck plague virus (DEV), duck Tan Busu
Viral (DTMUV) provides by this laboratory.
1.2 reagents and instrument
Trizol is purchased from invitrogen companies；Taq enzyme, RNase inhibitor, dNTP, DNA Marker, pMD-19T are carried
Body, 2 × Fast SYBR Green I Mixture etc. are purchased from the precious biological Co., Ltd in Dalian；Fowl source reverse transcriptase (AMV),
T4DNA ligases are purchased from Promega companies；Glue reclaim kit, bacillus coli DH 5 alpha are purchased from Tiangeng company；Plasmid extraction reagent
Box is purchased from QIAGen companies；Taq enzyme, RNase inhibitor, dNTP, key instrument are Mastercycler ep realplex 4
Quantitative real time PCR Instrument (Eppendorf companies).
1.3 primer
Using MegAlign softwares in Lasergene in US National Bioinformatics Institute NCBI gene pools Genbank
84 plants of duck hepatitis A virus strains and this laboratory separation 2 pairs of strains the genomic sequence carry out homology
Analysis, designs and synthesizes a pair of specific primers, primer sequence is as follows in DHAV-A DHAV-C 5' non-coding regions：
DHAV-F:5'GTTGTGAAACGGATTACCGGTAGT 3',
DHAV-R:5'ACTCGACCAGCCGCGACCCTAT 3',
Expanding fragment length is 203bp.
The extraction of 1.4 viral RNAs and cDNA synthesis
Attacked according to Trizol methods specification extraction DHAV-A ZJV strains, DHAV-C LS strains in malicious Beijing Duck Liver tissue
Virus total RNA.Reaction solution, which to be prepared, according to table 1 below carries out reverse transcription, reaction condition is 37 DEG C of incubation 2h, and 75 DEG C are incubated 10min ,-
20 DEG C save backup, for subsequent experimental.
The RT reaction systems of table 1
| Reaction reagent | Cumulative volume | |
| Template ribonucleic acid solution | 10uL | |
| 5×M-MLV Buffer | 5.0uL | |
| dNTPs(10.0mmol/μL) | 2.0uL | |
| Primer R(10pmol/μL) | 95 DEG C of l0min, on ice 5min | 2.0uL |
| RNase Inhibitor | 1.0uL | |
| M-MLV Reverse Transcriptase | 1.0uL | |
| DEPC H2O | up to 25uL |
The preparation of 1.5 positive criteria templates
Using above-mentioned product cDNA as template, DHAV-F and DHAV-R are primer respectively to DHAV-A ZJV strains, DHAV-C LS
The target gene of strain enters performing PCR amplification.PCR reaction systems are as shown in table 2.
The PCR reaction systems of table 2
| Reaction reagent | Cumulative volume |
| CDNA solution | 2uL |
| 10×LA Taq Buffer | 5.0uL |
| TaKaRa LA Taq | 1.0uL |
| dNTPs(10.0mmol/μL) | 2.0uL |
| DHAV-F(10umol/μL) | 1.0uL |
| DHAV-R(10umol/μL) | 1.0uL |
| DEPC H20 | up to 50uL |
PCR amplification conditions are as follows：
After reaction terminates, 10 μ L PCR primers electrophoresis detection amplification on 1% Ago-Gel is taken.It is separately recovered pure
Change purpose fragment, be connected with pMD-19T carriers, converted to DH5 α E strains, extraction plasmid carry out digestion identification with
Sequencing, positive recombinant plasmid are named as pMD-19T-DHAV-A, pMD-19T-DHAV-C, concentration are determined, according to formula：Copy
Shellfish number (Copies/uL)=(plasmid concentration × 6.02 × 1023)/(DNA molecular quality), calculate copying for plasmid standard
Shellfish number.It is computed two kinds of recombinant plasmid dna molecular numbers being adjusted to 1 × 1010copies/μL.Respectively by two kinds of standard items plasmids
10 times of gradient dilutions are done, obtain 1 × 109、1×108、1×107、1×106、1×105、1×104、1×103、1×
102Copies/ μ L series standard template.
The foundation of 1.6 SYBR Green real-time fluorescence quantitative PCR detection methods
1.6.1 the foundation and optimization of SYBR Green quantitative fluorescent PCRs reaction system
Respectively using two kinds of plasmid standards as template, reaction system is 25 μ L, respectively to primer concentration and reaction condition
Optimize and draw melting curve.
2.4.3.1 the optimization of fluorescence quantitative RT-PCR primer concentration
Take respectively and be diluted to 1 × 107Copies/ μ L positive plasmid standard items pMD-19T-DHAV-A and pMD-19T-
DHAV-C is template.Respectively with 10umol/L μ L of primer volume 0.1,0.2 μ L, 0.4 μ L, 0.6 μ L, 0.8 μ L, 1.0 μ L, 1.2 μ
L, 1.4 μ L, 1.6 μ L, 1.8 μ L, 2.0 μ L enter performing PCR reaction (annealing temperature be 55 DEG C), and optimal during obtaining virus amplification draws
Thing concentration.
2.4.3.2 the optimization of fluorescence quantitative RT-RCR annealing temperature
Take respectively and be diluted to 1 × 107Copies/ μ L positive plasmid standard items pMD-19T-DHAV-A and pMD-19T-
DHAV-C is template, respectively with 54 DEG C, 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, 61 DEG C, 62 DEG C be annealing temperature to disease
Poison enters performing PCR amplification (primer concentration 0.24uM), to determine optimum annealing temperature.
1.6.2 the foundation of standard curve
The DNA molecular number 1 × 10 of pMD-19T-DHAV-A, pMD-19T-DHAV-C recombinant plasmid is taken respectively9copies/μL
~1 × 103Copies/ μ L totally 7 concentration, real-time fluorescence quantitative RT-PCR reaction is carried out as standard items.Using what is optimized
Condition carries out the real-time fluorescence quantitative PCRs of SYBR Green I, obtains respective Ct values, dense with starting template using Ct values as abscissa
The logarithm of degree is ordinate, makes standard curve.
1.7 specific test
DHAV-A, DHAV-C and DRV, NDV, AIV, IBV, GPV, DEV, DTMUV strain are carried out using the method for foundation
Specific test.
1.8 sensitivity tests
Two kinds of positive plasmid standard items pMD-19T-DHAV-A and pMD-19T-DHAV-C are done into 10 times of gradient dilutions, together
When set up regular-PCR control group.Expanded, detected with this to obtain the DNA of fluorescence quantitative RT-RCR reaction minimum template
Copy number.
1.9 replica test
Two kinds of positive plasmid standard items pMD-19T-DHAV-A and pMD-19T-DHAV-C are done respectively repeated in 3 batches and
Repeated between 3 batches, plasmid concentration is respectively adopted：1×107copies/μL、1×105copies/μL、1×104Copies/ μ L,
Negative control is set simultaneously, by the calculating of the TM values to virus and the analysis correlation variation coefficient of melt curve analysis, verifies DHAV-A
With the repeatability of DHAV-C fluorescent quantitative PCR detection methods.
The detection of 1.10 laboratory infection samples
Choose respectively the 3 age in days ducklings that after DHAV-A ZJV strains, DHAV-C LS strain experimental infections 36h is gathered the heart,
Totally 21 parts of liver, spleen, lung, kidney, brain, pancreas and jejunum internal organs, are detected with method for building up respectively.
2 results
The preparation of 2.1 positive criteria products
RT-PCR amplifications obtain DHAV-A, DHAV-C target gene fragment, are cloned into structure restructuring matter in pMD-19T carriers
Grain, performing PCR identification is entered to it, obtains 1 size about 203bp specific fragment, be consistent (Fig. 1) with expected purpose clip size,
Show that target gene fragment has been cloned into pMD-19T carriers.Positive recombinant plasmid pMD-19T-DHAV-A concentration is 239ng/ μ
L, pMD-19T-DHAV-C concentration are 223ng/ μ L, are computed pMD-19T-DHAV-A, pMD-19T-DHAV-C recombinant plasmid dna
Molecular number regulation is 1. × 1010copies/μL。
The determination of 2.2SYBR Green real-time fluorescence quantitative PCR reaction conditions
3.1.1.1 the determination of optimal primer concentration and annealing temperature
Show to work as the final concentration of 0.24uM of primer by result of the test, when annealing temperature is 55 DEG C, Ct values are minimum, fluorescence is strong
Degree is maximum, and negative control unstressed configuration signal produces (being shown in Table 3 and table 4).
The determination of 3 optimal primer concentration of table
The determination of the optimum annealing temperature of table 4
3.1.3 the drafting of DHAV-A, DHAV-C real-time fluorescence quantitative RT-PCR standard curve is detected
Using the condition (being shown in Table 4) optimized, real-time fluorescence quantitative RT-PCR reaction is carried out, obtains respective Ct values, point
Not with recombinant plasmid pMD-19T-DHAV-A and pMD-19T-DHAV-C 1.0 × 102~1.0 × 109Copies/ μ L copy numbers
Logarithm is X-axis, and cycle-index (Ct) is Y-axis, establishes standard curve.
The PCR reaction systems of table 5
| Reaction reagent | Cumulative volume |
| CDNA solution | 2uL |
| 2×SYBR Green | 12.5uL |
| DHAV-F(10umol/μL) | 0.6uL |
| DHAV-R(10umol/μL) | 0.6uL |
| 50×ROX Reference Dye | 0.5uL |
| DEPC H20 | up to 25uL |
As a result display is (see Fig. 2-A, 2-B and 3-A, 3-B)：Each dilution factor amplification curve of two kinds of recombinant plasmid standard items is put down
OK, Ct values difference uniformly reflects that the standard items Ct values of different dilution factors and copy number are in good linear relationship.
A coefficient correlations are R2=0.999, amplification efficiency is up to 100%, logarithm and the Ct value linear relationships of starting copy number
Y=-3.331X+42.12.
C coefficient correlations are R2=0.997, for amplification efficiency up to 98%, logarithm and the Ct values linear relationship of starting copy number are Y
=-3.382X+42.87.
The melting curve of 2.3 SYBR Green real-time fluorescence quantitative PCRs
Result is analyzed with StepOne Plus softwares, can obtain melting curve figure by software analysis, its crest
The Tm values (melting temperature) of the temperature representative double chain DNA molecule at place.Its genotype can determine whether according to the Tm values of amplified production.
As a result show, pMD-19T-DHAV-A and pMD-19T-DHAV-C recombinant plasmids occur it is narrow and sharp unimodal, it is and negative right
According to there is not fusing point peak.PMD-19T-DHAV-A melting temperatures are (85.8 ± 0.5) DEG C pMD-19T-DHAV-C melting temperatures
For (83.8 ± 0.5) DEG C (Fig. 4), show that SYBR Green real-time fluorescence quantitative PCRs reaction is specific amplification.
The specific test of 2.4 fluorescence quantitative RT-RCRs
PCR melting curves show that DHAV-A is consistent with the melting peakss concentration of DHAV-C viruses, and no miscellaneous peak and small peak occur,
Illustrate that amplified production is single, no non-specific amplification, and the detection knot of the strain such as DRV, NDV, AIV, IBV, GPV, DEV, DTMUV
Fruit is negative (fluorescence signal does not arrive the credible threshold value of detection) (Fig. 5), illustrates that this method has specificity well.
2.5 sensitivity tests results
Detect Ct value of the sample in 35 circulations of real-time fluorescence quantitative RT-PCR>0, then result judgement is the positive.With building
Vertical method is to pMD-19T-DHAV-A and pMD-19T-DHAV-C recombinant plasmids 1 × 109Copies/ μ L~1 × 102copies/
μ L are detected.As a result it is 1.0 × 10 to two kinds of recombinant plasmid limits of identification to show this method3Copies/ μ L are negative right
Expanded according to unstressed configuration (see Fig. 2 and Fig. 3).And the detectable limit of regular-PCR is 1.0 × 104Copies/ μ L (see Fig. 6).This experiment
The method of foundation has higher sensitivity, and sensitivity is 1.0 × 103Copies/ μ L, sensitivity are 10 times of regular-PCR.
2.6 repeated testing results
The coefficient of variation is respectively less than 1.5% in pMD-19T-DHAV-A groups, and between-group variation coefficient is respectively less than 1%, and repeatability is good
It is good；The coefficient of variation is respectively less than 1.5% in pMD-19T-DHAV-C groups, and between-group variation coefficient is respectively less than 1.5%, and repeatability is good,
(being shown in Table 6-A, 6-B).
Table 6-A quantitative fluorescent PCRs group is interior, replica test result between group
Table 6-B quantitative fluorescent PCRs group is interior, replica test result between group
2.7 sample detection results
Choose respectively the 3 age in days ducklings that after DHAV-A ZJV strains, DHAV-C LS strain experimental infections 36h is gathered the heart,
Liver, spleen, lung, kidney, brain, pancreas and jejunum internal organs totally 21 parts (see Fig. 7-A and 7-B), as a result show, A type A type duck hepatitis virus and C
Type A type duck hepatitis virus titre highest in liver, and A type A type duck hepatitis virus titre levels are integrally higher than c-type A type
Duck hepatitis virus.
The specific embodiment of the present invention is described above.It is to be appreciated that the invention is not limited in above-mentioned
Particular implementation, those skilled in the art can make various deformations or amendments within the scope of the claims, this not shadow
Ring the substantive content of the present invention.
Claims (8)
- A kind of 1. A type duck hepatitis virus parting detection primer based on quantitative fluorescent PCR melting curve method, it is characterised in that The primer is as follows：DHAV-F:5'GTTGTGAAACGGATTACCGGTAGT 3',DHAV-R:5'ACTCGACCAGCCGCGACCCTAT 3'。
- 2. a kind of A type duck hepatitis virus genotyping detection method based on quantitative fluorescent PCR melting curve method of non-diagnostic purpose, Characterized in that, the detection method includes：Step 1: the extraction of viral RNA and cDNA synthesis：A type duck hepatitis virus total serum IgE, reversion are extracted from attacking in malicious duck tissue Record to obtain cDNA；Step 2: the preparation of positive criteria template：Using the cDNA as template, with DHAV-F described in claim 1 and DHAV-R For primer, performing PCR amplification is entered to the target gene of A type duck hepatitis virus；A type duck hepatitis is built with the pcr amplification product Viral typing detection positive recombinant plasmid；The positive recombinant plasmid includes pMD-19T-DHAV-A and pMD-19T-DHAV- C；Step 3: the foundation of the A type duck hepatitis virus genotyping detection method based on quantitative fluorescent PCR melting curve method：With described Positive recombinant plasmid is template, optimizes the PCR reaction conditions, draws standard curve, melting curve, and foundation is based on fluorescent quantitation The A type duck hepatitis virus genotyping detection method of PCR melting curve methods；Step 4: method validation：The A type duck hepatitis virus point based on quantitative fluorescent PCR melting curve method that step 3 is established Type detection method is verified as follows：Specific test：Examined using the A type duck hepatitis virus parting based on quantitative fluorescent PCR melting curve method described in step 3 Survey method, according to the standard curve and melting curve, A type duck hepatitis virus and non-A type duck hepatitis fowl source virus are carried out Specific detection；Sensitivity tests：The positive recombinant plasmid standard items are diluted, while set up regular-PCR control group, are expanded respectively, Obtain minimum template detection copy number；Replica test：The positive restructuring plasmid standard is done respectively in criticizing and repeated between criticizing, while set negative control, By the calculating of the TM values to A type duck hepatitis virus and the analysis correlation variation coefficient of melting curve, the A type duck liver is verified The repeatability of scorching Viral typing detection method.
- 3. the disease of the A type duck hepatitis based on quantitative fluorescent PCR melting curve method of non-diagnostic purpose according to claim 2 Malicious genotyping detection method, it is characterised in that in step 1, the duck is selected from Beijing duck, and the tissue is selected from liver.
- 4. the disease of the A type duck hepatitis based on quantitative fluorescent PCR melting curve method of non-diagnostic purpose according to claim 2 Malicious genotyping detection method, it is characterised in that in step 3, the PCR reaction conditions include primer concentration, annealing temperature.
- 5. the disease of the A type duck hepatitis based on quantitative fluorescent PCR melting curve method of non-diagnostic purpose according to claim 4 Malicious genotyping detection method, it is characterised in that the primer concentration scope is 0.04~1.04umol/L；The annealing temperature is 54 ~62 DEG C.
- 6. the disease of the A type duck hepatitis based on quantitative fluorescent PCR melting curve method of non-diagnostic purpose according to claim 2 Malicious genotyping detection method, it is characterised in that in the specific test of step 4, the A type duck hepatitis virus be selected from DHAV-A, DHAV-C；The non-A type duck hepatitis fowl source virus infects selected from duck reovirus, NDV, avian influenza virus, chicken Property bronchitis virus, goose parvovirus, duck plague, duck egg drop syndrome virus or duck tembusu virus.
- 7. the disease of the A type duck hepatitis based on quantitative fluorescent PCR melting curve method of non-diagnostic purpose according to claim 2 Malicious genotyping detection method, it is characterised in that in the sensitivity tests of step 4, the dilution is according to 10 times of gradient dilutions.
- 8. the disease of the A type duck hepatitis based on quantitative fluorescent PCR melting curve method of non-diagnostic purpose according to claim 2 Malicious genotyping detection method, it is characterised in that in the replica test of the step 4, repeat to refer specifically to do in described batch and between criticizing Repeat to repeat between 3 batches in 3 batches, positive recombinant plasmid concentration is respectively adopted：1×107copies/μL、1× 105copies/μL、1×104copies/μL。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510158357.7A CN104789700B (en) | 2015-04-03 | 2015-04-03 | DHAV parting detection methods based on quantitative fluorescent PCR melting curve method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510158357.7A CN104789700B (en) | 2015-04-03 | 2015-04-03 | DHAV parting detection methods based on quantitative fluorescent PCR melting curve method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104789700A CN104789700A (en) | 2015-07-22 |
| CN104789700B true CN104789700B (en) | 2017-11-24 |
Family
ID=53554889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510158357.7A Expired - Fee Related CN104789700B (en) | 2015-04-03 | 2015-04-03 | DHAV parting detection methods based on quantitative fluorescent PCR melting curve method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104789700B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105256072A (en) * | 2015-11-17 | 2016-01-20 | 四川农业大学 | Type-1 duck hepatitis A virus TaqMan fluorescent quantitation RT-PCR detection reagent kit and method |
| CN105256074A (en) * | 2015-11-17 | 2016-01-20 | 四川农业大学 | Kit and method for detecting duck hepatitis A viruses through dual TaqMan fluorescent quantitation RT-PCR |
| CN105256073A (en) * | 2015-11-17 | 2016-01-20 | 四川农业大学 | Type-3 duck hepatitis A virus TaqMan fluorescent quantitation RT-PCR detection reagent kit and method |
| CN106755379B (en) * | 2016-12-13 | 2021-06-04 | 海南医学院 | Dimer mutation fluorescent primer quantitative PCR method for synchronously quantifying and genotyping 4 aspergillus |
| CN107858455B (en) * | 2017-12-11 | 2021-07-20 | 广东省实验动物监测所 | PCR-HRM primer and method for rapidly identifying NDV vaccine strain and virulent strain |
| CN108486280B (en) * | 2018-03-06 | 2021-09-17 | 福建省农业科学院畜牧兽医研究所 | PCR primer for detecting short beak dwarf syndrome goose parvovirus by aiming at 5' -UTR gene |
| CN109487015A (en) * | 2019-01-12 | 2019-03-19 | 福建省农业科学院畜牧兽医研究所 | The real-time fluorescence quantitative PCR detection primer and its kit of 2 type hepatitis A virus of duck |
| CN110484643A (en) * | 2019-08-29 | 2019-11-22 | 上海市农业科学院 | A kind of trichoderma Defect inspection primer and detection method |
| CN112680534B (en) * | 2021-01-21 | 2022-10-28 | 哈尔滨医科大学 | Mycobacterium tuberculosis sRNA fluorescent quantitative PCR standard substance for identifying false positive reaction and application thereof |
| CN113345522B (en) * | 2021-06-10 | 2023-11-24 | 上海美吉生物医药科技有限公司 | Automatic strain identification method, system, terminal and medium based on first-generation sequencing technology |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104046704A (en) * | 2014-07-04 | 2014-09-17 | 山东农业大学 | Dual fluorescence quantitative method for quickly identifying type 1 and type 3 duck hepatitis A viruses |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140537B (en) * | 2011-01-19 | 2013-04-03 | 福建医科大学附属第一医院 | Polymerase chain reaction detection method of hepatitis B virus genotyping |
| CN104232798B (en) * | 2014-09-28 | 2016-07-06 | 武汉中博生物股份有限公司 | The multiple fluorescence quantitative PCR method of DHAV detection and Gene A type and the discriminating of C type and test kit |
-
2015
- 2015-04-03 CN CN201510158357.7A patent/CN104789700B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104046704A (en) * | 2014-07-04 | 2014-09-17 | 山东农业大学 | Dual fluorescence quantitative method for quickly identifying type 1 and type 3 duck hepatitis A viruses |
Non-Patent Citations (4)
| Title |
|---|
| Development of a Real-Time Quantitative PCR for Detecting Duck Hepatitis A Virus Genotype C;Qiuxue Huang，et al;《Journal of Clinical Microbiology》;20121031;3318–3323页 * |
| High resolution melting curve analysis as a new tool for rapid identification of canine parvovirus type 2 strains;Gali Bingga，et al;《Molecular and Cellular Probes》;20141231;271-278页 * |
| Molecular detection and typing of duck hepatitis A virus directly from clinical specimens;Yu Fu,et al3;《Veterinary Microbiology》;20081231;247-257页 * |
| 高分辨率熔解曲线分析应用的研究进展;刘自增等;《中国畜牧兽医》;20131231;第40卷(第8期);105-111页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104789700A (en) | 2015-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104789700B (en) | DHAV parting detection methods based on quantitative fluorescent PCR melting curve method | |
| CN107299155B (en) | Primer and probe for real-time fluorescence quantitative PCR detection of goose astrovirus | |
| CN106435024B (en) | Fluorescent quantitative PCR primer, probe, kit and detection method for detecting avian influenza virus subtype | |
| CN104846125B (en) | A kind of fluorescence RT PCR primers, probe and kit and detection method for being used to detect MERS | |
| CN103045755B (en) | A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit | |
| CN109554507B (en) | Detection method of H5 and H7N9 subtype highly pathogenic avian influenza virus | |
| CN108950068B (en) | Kit for identifying and detecting QX-type strains of chicken infectious bronchitis viruses | |
| CN113462820A (en) | Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof | |
| CN105441586A (en) | A-type H5N6 subtype avian influenza virus dual-channel real-time fluorescence PCR (polymerase chain reaction) detection kit and detection method | |
| CN105907890B (en) | Primer, probe and method for quickly distinguishing HP-PRRS vaccine GDr180 strain and wild strain | |
| CN108315483A (en) | A kind of combination for distinguishing the primer and probe of duck tembusu virus street strain and vaccine strain | |
| CN104498629A (en) | Duplex real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit for H3N2 subtype avian influenza virus (AIV) | |
| CN105950785A (en) | Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes | |
| CN109722492B (en) | Method for detecting H5 and H7N9 subtype highly pathogenic avian influenza virus and H9 subtype avian influenza virus | |
| CN113174446A (en) | One-step double RT-PCR detection method for bovine viral diarrhea virus typing | |
| CN108060265A (en) | For detecting the primer sets of the oyster herpetovirus of infection blood clam and probe and its application | |
| CN105525038B (en) | Newcastle disease virus is strong, weak malicious one-step method real-time fluorescent RT-PCR detection kit | |
| CN108998575B (en) | Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus | |
| CN116162734B (en) | Specific primer, probe and kit for rapidly detecting African swine fever wild strain and gene deletion strain | |
| CN107287347B (en) | Real-time fluorescence reverse transcription PCR (polymerase chain reaction) detection primer, probe, detection kit and detection method for hepatitis E virus | |
| CN113046482B (en) | Pigeon adenovirus B-type loop-mediated isothermal amplification detection primer set and kit | |
| CN106350611B (en) | Reagent for detecting H5N8 avian influenza virus, detection method and application | |
| CN115323075A (en) | RT-RAA primer probe set and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe set and kit | |
| CN104278106B (en) | Duplex fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for duck tembusu virus and egg drop syndrome virus | |
| CN109628643B (en) | Rapid detection method for H5 subtype avian influenza virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171124 Termination date: 20190403 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |