CN106929511A - A kind of hLeg1 genes and its application and medicine - Google Patents

Abstract

The invention provides a kind of hLeg1 genes and its application and medicine, it is related to the function of gene and applied technical field.The present invention is with mLeg1 knock out mice as research object, using science of heredity, molecular biology, biochemistry, the means of cell biology have carried out very comprehensively research to the function of mLeg1 genes, result of study shows that mLeg1 albumen can regulate and control the signal of internal Akt by EGFR, and then regulating and controlling the Fatty synthesis in body, the result of study is recovered to provide new means and thinking by the expression of human intervention hLeg1 genes and hLeg1 albumen for the later stage come the constitution after treating human obesity and cancer patients undergoing chemotherapy.

Description

A kind of hLeg1 genes and its application and medicine

Technical field

The present invention relates to the function and applied technical field of gene, in particular to a kind of hLeg1 genes and its application And medicine.

Background technology

In the past few years, obesity case is increased rapidly in worldwide, has been at present to cause human death No. five threat.In developed country, obesity has just made first appearance early in the eighties in 20th century, and case persistently increases behind Plus, simply gathered way in past 8 years and slowed down；And in developing country, obese patient is every year at a terrific speed Increasing.Although obesity will not typically directly result in death, fat caused complication, especially angiocardiopathy are but Can be fatal.In 2010, obesity about result in the death of 3,400,000 people.Additionally, to the obesity patient of continental United States Research show, obesity be likely to reduce future the mankind average life span.According to statistics, in order to treat obesity, the U.S. is poor Seldom 117,000,000,000 dollars are spent every year.Meanwhile, it is also more and more to the concern of obesity in world wide.But, it is at present, right It is also fewer in also fewer and related to the obesity drug target of the achievement in research of the effectively medicine for the treatment of obesity.

The content of the invention

It is an object of the invention to provide a kind of hLeg1 genes, its coding hLeg1 albumen, the amino acid sequence of hLeg1 albumen Row are as shown in SEQ ID NO.1.

Further, the base sequence of hLeg1 genes is as shown in SEQ ID NO.3.

HLeg1 genes another object of the present invention is to provide are being prepared or screened for treating fertilizer as target gene Application in the medicine of fat disease or fat-reducing, the medicine is the medicine of the expression for suppressing hLeg1 genes.The medicine is by right The suppression of the expression of hLeg1 genes, reduces the content of hLeg1 albumen, and then realize the effect for the treatment of obesity or fat-reducing.

HLeg1 genes another object of the present invention is to provide are being prepared or screened for treating fat as target gene Fat lacks the application in the medicine of disease or getting fat, and the medicine is the medicine of the expression for strengthening hLeg1 genes.The medicine leads to Cross the enhancing of the expression to hLeg1 genes, increase the content of hLeg1 albumen, so realize treatment fat lack disease or The effect of getting fat.

HLeg1 genes another object of the present invention is to provide are being prepared or screened for treating sugar as target gene The application in the medicine of disease is urinated, the medicine is made to activate Akt signal paths by strengthening the expression of hLeg1 genes Medicine of the GLUT2 transports to surface of cell membrane.

The RNAi interference carriers of the hLeg1 genes another object of the present invention is to provide are being prepared for treating obesity Or the application in the medicine of fat-reducing, the expression of the RNAi interference carrier silence hLeg1 genes.RNAi interference carriers are by right The silence of the expression of hLeg1 genes, makes the content reduction of its hLeg1 albumen for encoding, and then realize treatment obesity or fat-reducing Effect.

Another object of the present invention is to provide a kind of medicine for treating obesity or fat-reducing, the medicine is with above-mentioned HLeg1 genes be target spot, suppress hLeg1 genes expression.

Further, the medicine is the RNAi interference carriers for silence hLeg1 gene expressions.

Another object of the present invention is to provide it is a kind of lack the medicine of disease or getting fat for treating fat, its with HLeg1 genes are target spot, strengthen the expression of hLeg1 genes.

Another object of the present invention is to provide the plasmid vector containing above-mentioned hLeg1 genes, bacterium or cell.

The hLeg1 genes of present invention offer and its beneficial effect of application and medicine are：

The hLeg1 albumen of the mankind of the Unknown Function that the present invention was not studied with prior art is (such as SEQ ID NO.1 institutes Show) and hLeg1 genes (as shown in SEQ ID NO.3) be research object, to study its function, with mLeg1 knock out mice It is animal pattern, using science of heredity, molecular biology, biochemistry, the means of cell biology are to mLeg1 albumen (SEQ ID NO.2) and its encoding gene mLeg1 genes (as shown in SEQ ID NO.4) function carried out very comprehensively research.Research Result shows：MLeg1 albumen can regulate and control the signal of internal Akt by EGFR receptor proteins, and then regulate and control the fat in body Synthesis, showing that the Fatty synthesis in mLeg1 genes and mLeg1 albumen and body are closely related (strengthens the expression water of mLeg1 genes The expression or the content of mLeg1 albumen of flat or mLeg1 albumen, promote Fatty synthesis to accumulate；Suppress the table of mLeg1 genes Up to the content of the expression or mLeg1 albumen of level or mLeg1 albumen, Fat Accumulation is reduced), further show that the mankind HLeg1 genes (as shown in SEQ ID NO.3) or hLeg1 albumen (as shown in SEQ ID NO.1) can be as target gene Or target point protein is used in the preparation medicine related to Fatty synthesis regulation and control, for example, obesity or the related medicine of getting fat are treated, Result of study of the invention lacks for the constitution recovery after the treatment of later stage obesity or prevention, cancer Chemotherapy in Patients, fat Medicament research and development in the fields such as disease treatment, getting fat, treating diabetes, disease of salivary gland detection has supplied a brand-new medicine target Point and new treatment means and thinking.

Brief description of the drawings

Technical scheme in order to illustrate more clearly the embodiments of the present invention, below will be attached to what is used needed for embodiment Figure is briefly described, it will be appreciated that the following drawings illustrate only certain embodiments of the present invention, thus be not construed as it is right The restriction of scope, for those of ordinary skill in the art, on the premise of not paying creative work, can also be according to this A little accompanying drawings obtain other related accompanying drawings.

The testing result figure of Fig. 1 embodiment of the present invention 1-5 is (in figure：A is using Northern markings analysis detection mLeg1 In the result figure of the expression of the different tissues of wild-type mice；B is to analyze mLeg1 in wild type using the Northern markings The testing result figure of expression in 3 bodies of gland of the salivary gland of mouse；C is to detect mLeg1 albumen using Western Blot The result figure of distribution situation in the different tissue of wild-type mice；D is wild-type mice and mLeg1 gene knockout type mouse The testing result figure of mLeg1 protein contents in saliva)；

Fig. 2 is the mLeg1 gene knockout strategy schematic diagrames of the embodiment of the present invention 4；

Fig. 3 is the detected through gel electrophoresis result figure of invention embodiment 4-5 (in figure：A is using regular-PCR side Method detects mLeg1^Δ/ΔThe Gel electrophoresis results figure that the 3rd extron is knocked in mouse；B is to detect mLeg1 using RT-PCR^Δ/ΔThe Gel electrophoresis results figure that the 3rd extron is knocked in mouse；C is to detect mLeg1 using Western blot methods Albumen is in mLeg1^Δ/ΔThe result figure of the expression of mouse salivary glands)；

Fig. 4 is the mLeg1 of the embodiment of the present invention 5^Δ/ΔThe sequencing result comparison diagram of the mLeg1 genes of mouse；

Fig. 5 is the mLeg1 of the embodiment of the present invention 6^Δ/ΔThe HE coloration results contrast of the salivary gland of mouse and wild-type mice Figure；

Fig. 6 exempts from for the embodiment of the present invention 6 carries out albumen using ptyalin and cell junction protein pan-Cadherin Epidemic disease fluorescence labeling observes mLeg1^Δ/ΔThe comparative result figure of the salivary gland of mouse and wild-type mice；

Fig. 7 is the mLeg1 of the embodiment of the present invention 6^Δ/ΔThe A Xin of the mucus of the salivary gland secretion of mouse and wild-type mice Indigo plant dyeing testing result comparison diagram；

Fig. 8 is the testing result figure of embodiment of the present invention 7-8 (in figure：A is mLeg1^Δ/ΔMouse and the blood of wild-type mice The testing result figure of index；B is mLeg1^Δ/ΔThe testing result figure of the glucose sugar tolerance situation of mouse and wild-type mice；C is mLeg1^Δ/ΔThe testing result figure of triacylglycerol and cholesterol level in mouse and wild type mouse serum；D is mLeg1^Δ/ΔIt is small The testing result figure of triacylglycerol and cholesterol level in mouse and wild-type mice liver)；

Fig. 9 is the mLeg1 of the embodiment of the present invention 9^Δ/ΔThe fatty size contrast of the different parts of mouse and wild-type mice Figure is (in figure：A is mLeg1^Δ/ΔMouse and wild-type mice back fat comparison diagram directly perceived；B is 1mLeg1^Δ/ΔMouse and wild type Mouse dorsal part fat block size comparison diagram directly perceived；C is mLeg1^Δ/ΔMouse and wild-type mice stomach fat comparison diagram directly perceived；d It is mLeg1^Δ/ΔMouse and wild-type mice belly side fat block size comparison diagram directly perceived)；

Figure 10 is the mLeg1 of the embodiment of the present invention 9^Δ/ΔChanges of weight testing result figure (the figure of mouse and wild-type mice In：A is mLeg1^Δ/ΔThe changes of weight curve map of mouse and wild-type mice under chow diet and high lipid food rearing conditions； B is mLeg1^Δ/ΔThe body size comparison diagram directly perceived of mouse and wild-type mice after high lipid food raises half a year)；

Figure 11 is the expression testing result figure of the fat synthesis related gene of the embodiment of the present invention 9 (in figure：A is mLeg1^Δ/ΔThe testing result figure of the expression of fatty beta-oxidation related gene in mouse and wild-type mice liver；B is bright mLeg1^Δ/ΔThe testing result figure of the expression of fat synthesis related gene in mouse and wild-type mice liver)；

Figure 12 is the schematic diagram of Fatty synthesis approach in the mouse liver of the embodiment of the present invention 10；

Figure 13 is the mLeg1 of the embodiment of the present invention 11^Δ/ΔRegulate and control turning for Fatty synthesis in mouse and wild-type mice liver Record the testing result figure of the expression of the factor；

Figure 14 is the horizontal testing result figure of Akt phosphorylation of embodiment of the present invention 12-14 (in figure：A is mLeg1^Δ/ΔMouse With the testing result figure of the Akt phosphorylation level in wild-type mice liver；B is mLeg1^Δ/ΔMouse and wild-type mice saliva The testing result figure of the Akt phosphorylation level in gland；C is through wild type and mLeg1^Δ/ΔThe cell culture of mouse salivary gland cell The protein level of mLeg1 in liquid；D is through mLeg1^Δ/ΔAfter mouse and wild-type mice salivary gland cell culture supernatant culture The testing result figure of the Akt phosphorylation level of HepG2 cells)

Figure 15 is the testing result figure of the Akt phosphorylation level of embodiment of the present invention 15-16 (in figure：A be through abdominal cavity or MLeg1 is induced after tail vein injection salivary gland original cuiture supernatant^Δ/ΔThe testing result of the Akt phosphorylation level of mouse liver Figure；B is the Akt phosphorylation level that the different mLeg1 protein concentrations purified by the salivary gland of wild-type mice activate HepG2 cells Testing result figure)

Figure 16 is the testing result figure of the Akt phosphorylation level of embodiment of the present invention 16-18 (in figure：A is by column chromatography The testing result of the Akt phosphorylation level of the mLeg1 protein activation HepG2 cells for obtaining is purified from salivary gland with ion exchange Figure；B is under the action condition of inhibitor LY290004, through mLeg1^Δ/ΔMouse and the primary training of wild-type mice salivary gland cell The testing result figure of the Akt phosphorylation level of the HepG2 cells after foster supernatant culture；C is in inhibitor LY290004 Under action condition, the mLeg1 protein activation HepG2 cells that obtain are purified from salivary gland by column chromatography and ion exchange The testing result figure of Akt phosphorylation level；D is the tyrosine phosphorylation level through the HepG2 cells after mLeg1 albumen cultures Testing result figure)；

Figure 17 is membrane receptor EGFR-TK (RTK) selective mechanisms result figure of the embodiment of the present invention 19；

Figure 18 for embodiment of the present invention 19-22 testing result figure (a be mLeg1 protein on cells in EGFR receptor proteins Activation level testing result figure；B is the EGFR acceptors in mLeg1 protein on cells under inhibitor AG1478 action conditions The testing result figure of the activation level of albumen；C is that the phase interaction between mLeg1 albumen and EGFR is detected using co-immunoprecipitation method Result figure；D is mLeg1 albumen gavages mLeg1^Δ/ΔAfter mouse, between different time points detection mLeg1 albumen and EGFR The result figure of interaction).

Specific embodiment

To make the purpose, technical scheme and advantage of the embodiment of the present invention clearer, below will be in the embodiment of the present invention Technical scheme be clearly and completely described.Unreceipted actual conditions person, builds according to normal condition or manufacturer in embodiment The condition of view is carried out.Agents useful for same or the unreceipted production firm person of instrument, are the conventional product that can be obtained by commercially available purchase Product.

HLeg1 albumen of the invention and its application and medicine are specifically described below.

It is research model animal that the present inventor chooses mouse, to Leg1 genes (liver enriched gene 1st, liver enrichment gene 1, the albumen that the gene code gives expression to referred to as Leg1 albumen) and homologous base of the Leg1 albumen in mouse Because mLeg1 genes (as shown in SEQ ID NO.4) and mLeg1 albumen (SEQ ID NO.2) carry out correlation function Journal of Sex Research.Disclose , up to the function of mLeg1 albumen, also disclosing simultaneously has homology in all vertebrates for mLeg1 genes and its coding schedule Leg1 genes and corresponding Leg1 albumen function.

MLeg1 is also referred to as 2310057J18Rik RIKEN cDNA 2310057J18gene (GeneID：67719), it is Leg1 Homologous gene in mouse, its functional study in mouse almost blank.Analysis of biological information shows, mLeg1 gene positions In on No. 10 chromosomes, total length about 14.016kb, comprising 6 extrons and 5 intrones, wherein translation initiation site ATG In on first extron.The albumen (as shown in SEQ ID NO.2) of a length of 337 amino acid of mLeg1 gene codes one, point It contains one with 20 targeting signal peptides of amino acid to analysis predictive display, and the sequence of targeting signal peptide is SEQ ID NO.2 institutes The 1-21 amino acids sequences shown, show that mLeg1 is a new secretory protein.

It is homologous in the hLeg1 albumen (its amino acid sequence such as SEQ ID NO.1) of people (Homo sapiens) and mouse Albumen mLeg1 albumen (its amino acid sequence is as shown in SEQ ID NO.2) has 71.2% similitude, therefore, by mouse The encoding gene of mLeg1 albumen be that mLeg1 genes (as shown in SEQ ID NO.4) and the functional study of mLeg1 albumen can It is the hLeg1 genes (coded sequence is CDS sequences as shown in SEQ ID NO.3) and the function and application of hLeg1 albumen of the mankind The meaning for instructing and referring to is provided, while providing theoretical foundation to research and develop the medicine of associated fat disease.

Leg1 albumen has two copies in zebra fish (Danio rerio), is respectively dLeg1a albumen (amino acid sequence Row are as shown in SEQ ID NO.5) and dLeg1b albumen (amino acid sequence is as shown in SEQ ID NO.6), the two and mLeg1 albumen There is 47.5% and 48.6% similitude respectively；It is present in the oLeg1 albumen (amino acid sequences in sheep (Ovis aries) As shown in SEQ ID NO.7), it has 49.1% similitude with mLeg1 albumen；It is present in ox (Bos taurus) BLeg1 albumen (amino acid sequence is as shown in SEQ ID NO.8), it has the 45.7% similitude (present invention with mLeg1 albumen The used method of similitude contrast be：Matched using European Bioinformatics center (ebi) and compare software needle, parameter setting For：Matrix:EBLOSUM62, Gap_penalty:10.0, Extend_penalty:0.5 compares).

Because Leg1 albumen is that the secretory protein for existing is guarded in all vertebrates highly, their Leg1 albumen With identical DUF domains (such as the 28th -320 the 28th -337 in SEQ ID NO.2, in SEQ ID NO.1 Position, the 29th -362 in SEQ ID NO.5, the 29th -362 in SEQ ID NO.6, in SEQ ID NO.7 the The 1st-317 in 34-354 and SEQ ID NO.8, these amino acid residue sequences all structure in three dimensions Into the similar DUF domains of One function), therefore, there is similar function and application prospect between them.Therefore, for institute The application related to Fatty synthesis for having the leg1 albumen and its encoding gene of vertebrate belongs to protection scope of the present invention.

Also, it should be noted that the substitution of sequence as shown in SEQ ID NO.1 by one or several amino acid residues And/or missing and/or addition obtain and there is albumen shown in the derived sequence of identical bioactivity with SEQ ID NO.1 And its application falls within protection scope of the present invention.As long as on the basis of the leg1 albumen shown in SEQ ID NO.1, by upper The transformation stated, makes the leg1 albumen shown in its improved mutant leg1 and SEQ ID NO.1 have identical DUF structures Domain, makes it have same or analogous bioactivity with leg1 albumen, for these mutant proteins and its fat of encoding gene The related application of fat synthesis also belongs to protection scope of the present invention.

It should be noted that the signified vertebrate of the present invention includes people, mouse, zebra fish, sheep, ox, also including rabbit, Pig, horse, tiger, leopard, wolf, dog, chicken, duck, fish, goose, bear and monkey etc., but it is not limited to foregoing animal.

The present invention by science of heredity, molecular biology, biochemistry, the means of cell biology, in mode biological mouse And Human cell line is research model, the function to novel secretion albumen mLeg1 carries out comprehensive and systematic research, big by providing Amount evidence proves that secretory protein mLeg1 is a new signaling molecule, sets up from mLeg1 to EGFR/PI3K, finally activates Akt Signals-modulating network, and prove that the network promotes the synthesis of mouse body fat.Simultaneously inventors proved that mLeg1 strikes The mouse energy normal growth for removing, the mouse that what is more important mLeg1 is knocked out can resist the obesity that high lipid food causes.

Feature of the invention and performance are described in further detail with reference to embodiments.

Experimental animal and raising

Experimental animal：It is the wild-type mice of C57BL/6 from background；Using Cre-loxP systems, from C57BL/6- The Cre tool mouse of Tg (Zp3-cre) 93Knw/Jnju is used for whole body and knocks out mLeg1 genes, and mLeg1 genes are knocked out to obtain whole body Mouse (mLeg1^Δ/ΔKnock-out mice).(mouse of above-mentioned each strain is purchased from Nanjing biological medicine research institute (NRI)).Raise Condition：22 DEG C of temperature, humidity 50%~60%, and give 12h illumination/12h dark photoperiods.The normal diet of mouse is upper The big mouse irradiation of Hai Si Leco Corp. production is bred as material (M02-F), and high lipid food is the size of this Leco Corp. of Shanghai production Mouse fat experiment material (M04-F) high.

Embodiment 1

Expressions of the 1.Northern engram analysis mLeg1 in different tissues

It is the mouse of C57BL/6 as research object using the male background of 8 week old, using the inspection of Northern engram analysis Survey the express spectra of mLeg1 genes.Antisense strand with mLeg1 genes carries out Northern marking analyses as probe, analyzes mLeg1 DNA murine comprising liver a series of digestive organs (heart (heart), liver (liver), pancreas (pancreas), Lung (lung), kidney (kidney), stomach (stomach), intestines (gut), salivary gland (SG)) in expression.

The experimental technique of Northern engram analysis is as follows.

1.1 RNA are extracted：

1.1.1 the tissue for needing to extract RNA is taken, is ground to without obvious particle with liquid nitrogen, process of lapping maintains liquid nitrogen and deposits In case RNA degrades.

1.1.2 take 50-100mg samples add 1ml Trizol (Reagent, Life Technologies, Cat.no.15596-026), fully homogenate is lashed by 26G syringe needles.

1.1.3 it is stored at room temperature 5min.Add 0.2ml chloroforms to exert oneself to mix 30 seconds, be stored at room temperature 5min.12000g at 4 DEG C Centrifugation 15min makes each liquid phase separation.

1.1.4 water intaking phase (i.e. the superiors' liquid) is added in 0.5ml isopropanols, and 10min is incubated at room temperature after reverse mixing, Separate out RNA.12000g centrifugations 15min, abandons supernatant at 4 DEG C.

1.1.5 precipitation adds the ethanol (being configured with DEPC water) of 1ml 75% to clean, and 12000g centrifugations 5min is abandoned at 4 DEG C Supernatant.Repetition is cleaned once with 75% ethanol, and fully removes supernatant.Add appropriate DEPC water dissolves after 42 DEG C of drying.Extract RNA be immediately used to subsequent experimental or be stored in -80 DEG C of refrigerators, it is necessary to when directly take out and use.

It is prepared by 1.2 digoxin (DIG) label probe：

(1) dNTP (10X PCR DIG Labeling Mix, Roche Cat.No.11585550910) marked with DIG Instead of dNTP, probe DIG being incorporated into double-stranded DNA as Norhern is reacted by PCR.PCR primer is：probeF： GGCTGTCCTGGCTTCCTG；probeR：CTCTCCATCTGTTCATTGTTCC.PCR uses common taq enzyme (reaction systems For：Template 1ul, positive each 0.3ul of anti-primer, the buffer2ul of taq enzymes 0.3ul, 10x, 2.5mM dNTP 1ul, water 15.1ul) (taq enzyme reactions system is similarly hereinafter), response procedures：Step 1：94 DEG C 3 minutes；Step 2：94 DEG C 30 seconds；Step 3：58 DEG C 30 seconds；Step Rapid 4：72 DEG C 30 seconds；Step 5：Repeat step 2 arrives step 4,33 times；Step 6：72 DEG C 10 minutes.

(2) PCR product is by agarose gel electrophoresis detected magnitude and purity, and is entered by PCR purification kits Row purifying.Probe after purification is denatured 10min in 100 DEG C, and at once in cooled on ice at least 2min, with DIG Easy Hyb (Roche Cat.No.11603558001) dilutes probe to 25ng/ml, and standby in being stored in -20 DEG C.

It is prepared by 1.3 RNA denaturant gels：RNA gel electrophoresises are carried out in the buffer solution and gel of denaturation.By 10X's MOPS buffer solutions (0.2M MOPS, 50mM NaoAc, 10mM EDTA, pH 7.0) are diluted to 1X with the deionized water of sterilizing, and 1.3% agarose powder is added, is fully melted by microwave stove heat, 5.3% is added when being cooled to 50 DEG C or so Concentration is 37% formaldehyde, is poured into after mixing in glue mould, stands cooled and solidified standby.

The treatment of 1.4 RNA samples：Appropriate RNA (RNA sample that i.e. step 1.1 is extracted, 10 to 30 μ g) is taken to be added to (contain 10 μ l deionized formamides, 2 μ l 10X MOPS, 3.5 μ l 37% formaldehyde, on 2 μ l RNA in 17.5 μ l RNA denaturants Sample buffer solution (Gel Loading Buffer II, Life Technologies, Cat.No.AM8546G), 65 DEG C 10min on ice is placed at once after denaturation 20min.

1.5 RNA denaturing gel electrophoresis：The RNA denaturation glue for taking cooled and solidified is placed in 1X MOPS electrophoretic buffers, is added RNA sample carries out electrophoresis, while addition RNA molecule Marker (Fermentas Cat.No.SM1821) carries out molecular weight estimation, Electrophoresis is carried out with the voltage of 4-10V/CM, electrophoresis time, generally 4~7 hours are determined according to clip size.

1.6 RNA transferring films：

1.6.1 the gel (RNA glue) for having completed RNA denaturing gel electrophoresis is taken out, is cleaned with the deionized water of sterilizing, juxtaposition Balanced in the SSC of 10X.Appropriately sized Hybond-N+ films (Amersham Bioscience are cut by glue size Cat.No.RPN303B) and 3MM filter paper (Whatman Cat.No.3030917), balanced equally in 10XSSC.

1.6.2 a clean open porcelain dish container is taken, the SSC buffer solutions of 10X is poured into, and is taken a lucite and be placed on porcelain dish On.2 layers of length slightly longer than lucite is cut, width is slightly wider than the 3MM filter paper of RNA glue, bonnet is infiltrated in organic with 10X SSC On glass, filter paper longitudinal direction two ends are soaked in the SSC buffer solutions in porcelain dish.RNA glue is tipped upside down on filter paper, then successively in covering Hybond-N⁺Film and two-layer 3MM filter paper, and multi-layer absorbent paper, and upper ballast, transferring film is overnight.After the completion of transferring film, film is removed Under UV-crosslinked instrument (UVP Ultraviolet Crosslinker Cat.No.CL-1000), 150m j/cm2 energy is handed over Connection.Then dyeed with RNA methylene blue stainings liquid (0.3M NaOAc, pH 5.2,0.03%Methylene Blue), detection RNA transferring films effect and quality.

1.7 probes hybridize and development analysis：

The hybridization and cleaning of DIG probes are washed and closed reagent box (Roche with the DIG of Roche companies Cat.No.11585762001) carried out according to specification.It is specific as follows.

1.7.1 a hybrid pipe is taken, RNA films (being obtained by 1.6.2 steps) is placed in one, add appropriate prehybridization solution (Roche Cat.No.11603558001), 50 DEG C are closed 2 hours.Period, -20 DEG C of probes of the DIG marks of preservation are taken, In 50 DEG C of balances after 100 DEG C of denaturation 10min.After closing 2 hours, the probe that addition has been balanced, 50 DEG C of hybridized overnights.

1.7.2 next day, probe is reclaimed, RNA films are cleaned successively in the following order：2X SSC/0.1%SDS normal temperature is cleaned, often Secondary 10min；65 DEG C of 0.5X SSC/0.1%SDS are cleaned twice, each 15min；65 DEG C of cleanings two of 0.1X SSC/0.1%SDS It is secondary, each 15min；Lavation buffer solution room temperature cleans 10min.Add 10%DIG blocking buffer to close 1 hour, connect And change to 10%DIG blocking buffer with 1:The Anti-Digoxigenin-AP Fab of 20000 dilutions Fragments antibody (Roche Cat.No.11093274910) is incubated at room temperature 2 hours.Lavation buffer solution is cleaned twice, every time 15。

1.7.3 film is finally balanced into 5min with detection buffer solution.Film is taken to be sandwiched in plastic foil, and in wherein instilling Ready- To-use CDP-star solution (Roche Cat.No.12041677001) develops the color, in fluorogenic chemiluminescence imager (Clinx Science Instruments Cat.No.3400) inner imaging.Shown in (a) in result such as Fig. 1.

Understood (in (a) of Fig. 1 by (a) in Fig. 1：SG represent salivary gland, liver represent liver, gut represent enteron aisle, Lung represents lung, heart and represents heart, stomach and represent stomach, kidney and represent kidney, pancrease and represents pancreas), mLeg1 Gene does not have expression is enriched with liver, but there is expression very high in salivary gland (SG), and in other tissues Substantially the expression of mLeg1 is not detected in (heat, liver, pancreas, lung, kidney, stomach, gut).

The salivary gland of mouse mainly includes three parts：(salivary gland (submandibular gland), sublingual gland (sublingular gland) and the parotid gland (parotid), therefore, using the analysis of the Northern blot markings, (specific method is same Embodiment 1), the present inventor has probed into expression of the mLeg1 genes in this 3 bodies of gland respectively, as a result as in Fig. 1 (b) shown in.

Understood (in (b) of Fig. 1 by (b) in Fig. 1：Parotid represent the parotid gland, sub-lingual represent sublingual gland, Sub-maxillary represents salivary gland), mLeg1 genes have substantially expression in this 3 bodies of gland, and it is in parotid gland tissues Expression is higher than salivary gland and sublingual gland.

Embodiment 2

Because homologous protein Leg1 of the mLeg1 albumen in zebra fish is a secretory protein, the above results have shown MLeg1 genes are main in salivary gland expression, but its mLeg1 albumen is likely to secrete transport in other tissue and plays a role. Therefore, the present inventor extracts the total protein of different tissues of mice, detects mLeg1 albumen not by Western Blot Distribution situation in same tissue.

MLeg1 albumen distribution situation in different tissues is detected using Western Blot.Experimental technique is as follows.

2.1 protein extractions：

Mouse sudden death after, win purpose tissue (SG, liver, gut, blood, lung, heat, stomach, kindney, Pancrease), it is respectively placed in 1.5ml centrifuge tubes, and the rapid freezing in liquid nitrogen, prevent degraded.During leach protein, sample is taken out Product, are crushed by liquid nitrogen grinding, sample powder are collected in centrifuge tube, and add protein lysate (150mM NaCl, 50mM PH7.6Tris-Hcl, 0.1%SDS, 1%Triton X100,1.5% NaTDC, the Complete (EDTA-free) of 1X (Roche Cat.No.11873580001), 100mg samples add 100 μ l lysates), it is placed on ice, 26G syringe needles lash number Secondary, 4 DEG C are incubated 15min in vertical shaking table, and 4 DEG C of 12000g are centrifuged 15min, take supernatant, and protein concentration is surveyed by Braford methods.

2.2 protein immunizations draw mark (Western blot)：

2.2.1 10~20 μ g protein samples for taking preparation carry out PAGE gel electrophoresis, by half-dried transferring film instrument (TRANS SD SEMI-DRY TRANSFER CELL (Bio-Rad Cat.No.170-390) turn albumen in gel In moving on to pvdf membrane (Millipore Cat.No.IPVH00010).Transferring film condition is 20V, and 140mA, the transferring film time is big according to albumen Depending on small, between generally 50min to 60min.

2.2.2 after transferring film, closed 1 hour with 5% skim milk, add the destination protein antibody being diluted in milk (target protein according to detection determines, the present embodiment is mLeg1 antibody, its dilution ratio depending on antibody, generally 1: 1000) 1 hour or 4 DEG C of overnight incubations, are incubated at room temperature.

2.2.3 PBST (0.1%Tween 20in PBS) 100~150rpm cleans 5x5min.Add corresponding 1: 10000 be diluted in milk secondary antibody (horseradish peroxidase-labeled goat anti-mouse IgG (green skies Cat.No.A0216) or Horseradish peroxidase-labeled goat anti-rabbit igg (green skies Cat.No.A0208)), it is incubated at room temperature 1 hour, PBST 100~ 150rpm cleans 5x5min.

2.2.4 chromogenic substrate (Thermo Cat.No.34095) is added in fluorogenic chemiluminescence imager (Clinx Science Instruments Cat.No.3400) inner imaging.Shown in (c) in result such as Fig. 1.

Understood (in (c) of Fig. 1 by (c) in Fig. 1：SG represent salivary gland, liver represent liver, gut represent enteron aisle, Blood represents serum, lung and represents lung, heart and represent heart, stomach and represent stomach, kidney and represents kidney, pancrease generations Table pancreas), consistent with rna expression position, mLeg1 albumen is also primarily present in salivary gland (SG), and other tissues include Liver, enteron aisle, lung, heart, position, kidney, pancreas does not all detect the presence of obvious mLeg1 albumen, meanwhile, in mouse blood There is no substantial amounts of mLeg1, therefore, in mouse, the albumen synthesis and storage of mLeg1 all occur mainly in salivary gland In.

Embodiment 3

Because salivary gland is a secretory body of gland, its most important functions is to salivate, and mLeg1 is also a secretion Albumen.Therefore, the present inventor is studied whether mLeg1 can be secreted into saliva.

Using contents of the Western Blot detections mLeg1 in saliva.Comprise the following steps that.

3.1 saliva collections：The amount for pressing 0.5mg/kg in mouse peritoneal injects PILO (Pilocarpine, Sigma), Capillary is placed in the saliva that secretion is collected in murine oral drainage.PILO is a kind of medicine for treating xerostomia, It can promote a large amount of secretions of saliva.(its method for obtaining sees below for collection wild-type mice and mLeg1 whole bodies knock-out mice respectively Text) secretion saliva.

3.2 salivas are processed：The saliva of collection, with the Laemmli buffer of the 5x of 1/5 saliva volume (10%SDS, 250mM Tris-HCl, 0.1 ‰ Bromphenol blue, 500mM DTT, 50%Glycerol), 100 DEG C are boiled 5 minutes.

3.3 using mLeg1 protein contents in Western Blot markings analysis saliva, concrete operations reference implementation example 2 Western Blot detecting steps.Shown in (d) in result such as Fig. 1.

Understood (in (d) of Fig. 1 by (d) in Fig. 1：WT is wild-type mice, mLeg1^Δ/ΔFor mLeg1 gene whole bodies strike Except type mouse), mLeg1 albumen is largely present in the saliva of wild-type mice really, and the saliva of mLeg1 whole body knock-out mices In and do not exist mLeg1 albumen.

Embodiment 4

MLeg1 gene whole body knock-out mices (mLeg1^Δ/Δ) acquisition

In order to obtain mleg whole body knock-out mices, the present inventor is from traditional Cre-loxP systems by mouse MLeg1 genes knocked out.The system relies primarily on Cre enzymes and is capable of identify that loxP sequences, and by two loxP in the same direction Sequence in sequence is deleted, so as to reach the purpose of gene knockout.And when Cre enzymes are in specific spatial and temporal expression, you can with MLeg1 is set to be knocked out in specific space-time, so as to the Research Challenges for avoiding embryonic death from causing.Here the present inventor is by loxP Sequence is inserted into the 3rd both sides of extron of mLeg1, at the same between loxP sequences in the 3rd extron and behind plus Enter a NEO gene, for positive resistance screening.By homologous recombination, embryo transfer and genetic screening the present inventor Obtain the mleg that the 3rd extron two ends of mLeg1 add loxP sequences^fl/flThe transgenic mice of stabilization heredity.

The one other component of Cre-loxP systems is Cre enzymes.When Cre enzymes receive what particular space or special time were activated When promoter drives expression, loxP sequences can just be deleted in particular space or time.MLeg1 is obtained based on the principle to strike Except the knockout strategy of mouse is as shown in Figure 2.Here, the present inventor drives the mouse pair of Cre expression from zp3 promoters MLeg1 carries out whole body knockout.Zp3 is egg vitellary membrane 3 (zona pellucida glycoprotein 3) gene, and the gene is only Expressed in egg mother cell before initial meiosis.

Therefore, by mLeg1^fl/flMouse drives mouse (C57BL/6-Tg (Zp3-cre) 93Knw/ of Cre expression with Zp3 When JNju) breeding, Zp3-CRE is obtained⁺mLeg1^fl/wtMouse.In the egg mother cell that dams therein are produced, because zp3 starts The activation of son, induces the expression of CRE enzymes, so as to the 3rd extron of mLeg1 genes be knocked out.The dams that to obtain with After wild type public affairs mouse breeding, ZP3-CRE is obtained⁺mLeg1^Δ/WTAnd ZP3-CRE^-mLeg1^Δ/WTMouse.ZP3-CRE^-mLeg1^Δ/WTIt is small Mouse selfing is that can obtain mLeg1^Δ/ΔAnd mLeg1^WT/WTMouse.mLeg1^Δ/ΔMouse is mLeg1 gene whole body knock-out mices.

Using PCR methods, from mLeg1 obtained above^Δ/ΔAnd mLeg1^WT/WTIn mouse, mLeg1 is identified^Δ/ΔMouse：

Taking mouse and clip toe is used to number, while toe alkaline lysis method of extracting genomic DNA is cut in collection.Toward receipts The lysate I (25mM NaOH, EDTA0.2mM, PH 12) of 75 μ l, 95 DEG C of 30min, cooled on ice are added in the toe of collection.Again Add conjunction in the lysate II (Tris 40mM, PH5) of 75 μ l.Fully as pcr template after reaction, in every 20 μ l PCR reactions 4 μ l templates are added to be reacted.Genotype identification primer：Sense primer mLeg1Fwd： CCTTTCTTAATGACACTTCAGTATGT；Anti-sense primer mLeg1Rv：CACATGCCTATTCACTCTCTCC.PCR is using common Taq enzymes, reaction condition is：1st, 94 DEG C 3 minutes, 2,94 DEG C 30 seconds, 3,58 DEG C 30 seconds, 4,72 DEG C 30 seconds, 5, repeat 2 to 4 steps 33 times, 6,72 DEG C 10 minutes.PCR primer is carried out into gel electrophoresis experiment, wherein wild-type mice produces a bar of 685bp Band, mutant mice is deleted due to the 3rd extron and part of intron, produces the band of a 293bp sizes (such as Fig. 3 In (a) shown in).

The mLeg1 that will be identified^Δ/ΔMouse is raised according to a conventional method, for subsequent experimental.

Additionally, the result of cross mating shows：When to mLeg1^Δ/WWhen selfing is bred, mLeg1^Δ/ΔMouse can be normal Birth, is presented normal 1:3 Mendelian inheritance ratios.It is health into mouse that young mouse can grow, and mLeg1^Δ/ΔAdult mice Offspring can be normally produced, it does not have notable difference per tire mouse number with wild type.

Embodiment 5

mLeg1^Δ/ΔThe checking of mouse

In order to further verify that mLeg1 is knocked really, the present inventor collects be accredited as mLeg1 respectively^Δ/ΔWith mLeg1^WT/WTMouse salivary gland, extract total serum IgE, further synthesize cDNA.Experimental technique is as follows.

5.1 extract total serum IgE：MLeg1 is extracted respectively^Δ/ΔAnd mLeg1^WT/WTMouse salivary gland total serum IgE, extracting method Extracted with the RNA of 1.1 steps in embodiment 1.

5.2 RNA reverse transcriptions are into cDNA：The RNA sample of 1 μ g extractions is taken, the OligodT of 50 μM of 1 μ l is added, 1 μ l are added 10mM dNTP, with water polishing to 10 μ l.65 DEG C are denatured 5min, on ice at least 1 minute.Add 10 μ l cDNA mixtures (4 μ l 5x First Line Buffer, 2 μ l 0.1M DTT, 1 μ l M-MLVRT enzymes, 3 μ l DEPC water).37 DEG C reaction 50min after 70 DEG C of 15min terminating reactions.The cDNA of synthesis is used for subsequent experimental or is stored in -20 refrigerators.

5.3 PCR are identified：

With the primer 2 qPCR F282 of the 3rd extron both sides of mLeg1 genes：CCTCTGCAGTTTGGCTGGCAGT With 3 ' ARM rev-1：TCCAAGGATGAGGCATGGGCTTC, respectively the cDNA to wild type and mLeg1 knock-out mices carry out PCR.PCR uses common taq enzymes, and reaction condition is:1st, 94 DEG C 3 minutes, 2,94 DEG C 30 seconds, 3,58 DEG C 30 seconds, 4,72 DEG C 30 Second, 5, repeat 2 to 4 step 33 times, 6,72 DEG C 10 minutes.

Product after 5.4 amplifications carries out gel electrophoresis, as a result as shown in (b) in Fig. 3 (in (b) of Fig. 3：WT is wild Type mouse, mLeg1^Δ/ΔIt is mLeg1 gene whole body knockout types mouse), wild-type mice will produce the bar of a treaty 377bp sizes Band, and mutant mice will produce the band that one article of size is 192bp sizes due to the deletion of the 3rd extron.Expand simultaneously The purified rear sequencing of product afterwards, sequencing result is as shown in figure 9, through sequence verification, mLeg1^Δ/ΔThe 3rd of PCR primer it is outer Aobvious son is really deleted (as shown in Figure 4).

5.5 using Western blot detections mLeg1^Δ/ΔWith the mLeg1 albumen water in the salivary gland of the mouse of wild type Flat, specific steps refer to embodiment 2.Shown in (c) in testing result such as Fig. 3.

From (c) in Fig. 3, mLeg1^Δ/ΔThe salivary gland of mouse does not give expression to mLeg1 albumen really, and wild type Mouse salivary glands give expression to mLeg1 albumen.

Data above absolutely proves that the present inventor obtains mLeg1^Δ/ΔAfter mouse, and mLeg1 gene knockouts simultaneously The existence and breeding of the mouse are not influenceed, with this mLeg1^Δ/ΔMouse as research mLeg1 genes function animal pattern, institute The result of study for obtaining is with a high credibility.

Embodiment 6

Detect that the knockout of mLeg1 produces influence to the 26S Proteasome Structure and Function of salivary gland.

MLeg1 is all expressed in three bodies of gland of mouse salivary glands, and salivary gland is the maximum part of mouse salivary glands, Therefore, the present inventor is with salivary gland as research object, and whether the knockout for studying mLeg1 genes can be to its 26S Proteasome Structure and Function Produce influence.

Whether 6.1 can be impacted using HE decoration methods observation mLeg1 gene knockouts to the morphosis of salivary gland.

6.1.1 submandibular organization's section is prepared：Mouse submandibular gland with 4% paraformaldehyde (Sigma, catalog number (Cat.No.)：P6148, Be dissolved in PBS) fix 1 hour at room temperature after, washed twice with PBS, 10 minutes every time.In a small space, such as 1.5ml In the cap of Eppendorf pipes, (boiled with 30% sucrose PBS solution with the 1.5% of about 45 DEG C of temperature low melting-point agarose solution Boil-offization is prepared) cooling fixation.Afterwards in 30% sucrose PBS solution 4 DEG C balance overnight.After balance, these fritters are used O.C.T. compound (Sakura catalog number (Cat.No.)s：4583) it is fixed on the bottom of plastic pattern.The alcohol addition for taking -80 DEG C of precoolings is dry Ice, plastic pattern is inserted and is wherein freezed.The sample of frost is used immediately, or is stored in seal box at -80 DEG C.During section, The sample blocks of frost are fixed in supporter with O.C.T. compounds.In -30 DEG C of slicer (Leica, HM505) before sample sections Lower precooling is balanced two hours.Sample is cut into the thin slice of 8~12 μ m thicks, and poly relies the coated glass slide of ammonia (Menzel, mesh Record number：J2800AMNZ) collect on the thin slice cut, collect at sample is used or be placed in -80 DEG C at once and preserve.

6.1.2 HE dyeing：The frozen section that has cut of taking-up, haematoxylin dyeing 5min, flowing water rinses 5min, 1% Acidic alcohol (1% absolute ethyl alcohol of hydrochloric acid+99%) breaks up 5s, and flowing water rinses 10min, eosin stains 5min, and then 80%, 95%, 100% ethanol is once cleaned, each 2s, cleans Yihong.It is put into dimethylbenzene transparent, Canadian resin mounting, mirror in drop Inspection observation.Result is as shown in Figure 5.

As shown in Figure 5, mLeg1^Δ/ΔThe salivary gland HE coloration results of mouse and wild-type mice have no marked difference, both All comprising the conduit that hollow, eosin stains are deeper, and the slightly shallow substantive acinar tissue of eosin stains, and they have completely And compact structure, it is meant that to the tubular delivery system and development and the shape of salivary secretion unit of salivary gland after mLeg1 knockouts State structure does not make significant difference simultaneously.

Whether 6.2 can be made using protein immunization fluorescent marker method observation mLeg1 gene knockouts to the morphosis of salivary gland Into influence.

Whether the morphosis of salivary gland can be impacted to further verify that mLeg1 is knocked out, invention of the invention People chooses two the labelled protein ptyalins (Amylase) and cell junction protein (pan-cadherin) of salivary gland, enters Row immunofluorescence label, influence of the knockout of analysis and research mLeg1 to salivary gland morphosis from cell aspect.Experimental technique It is as follows.

6.2.1 submandibular organization's section is prepared：Method is with 6.1.1 steps, or directly uses step 6.1.1 to prepare Histotomy.

6.2.2 the histotomy for taking treatment as described above is permeated with PBST (0.2%triton X100), increases the logical of film Permeability, is easy to antibody through cell membrane, and general process time is 5min, then with PBB (0.5%BSA (Sangon Cat.No.A0332) it is dissolved in 1 × PBS) cleaning 10min.

6.2.3 the lowlenthal serum for configuring 20% with PBB is closed, by 100:It is to resist that 1 ratio PBB dilutes primary antibody Pan-cadherin antibody (Sigma C1821), in 4 DEG C of samples of incubation overnight.Under 60rpm, PBB cleanings 3x10min.With 1: 400 ratios dilute fluorescence secondary antibody (Goat anti-Mouse IgG (H+L) Secondary Antibody, Alexa with PBB Fluor Plus 647, Thermo, A32728), and DAPI (Beyotime Cat.No.C1002) is added with 1/500 ratio, Incubation at room temperature 1 hour.Under 60rpm, after PBB cleanings 3x10min, mounting is carried out with 80% glycerine.

6.2.4 laser confocal microscope (Olympus FV1000) gathered data.Result is as shown in Figure 7.

6.2.5 Amylase protein immunizations fluorescence labeling, method is essentially identical with step 6.2.1-6.2-4, and difference is, In 6.2.3 steps anti-pan-cadherin antibody, fluorescence two are replaced with anti-Amylase antibody (Santa Cruz sc-9890) It is anti-replace with (Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor 488, Thermo, A-11034).Result is as shown in Figure 6.

It will be appreciated from fig. 6 that mLeg1 is knocked out does not have an impact ptyalin (Amylase) and cell junction protein (pan- Cadherin expression and distribution), imply the knockout of mLeg1 really institutional framework not no to salivary gland, cell composition and Distribution produces obvious influence.

6.4 couples of mLeg1^Δ/ΔThe salivary gland saliva of mouse produces function to be studied.

One critical function of salivary gland is to produce and salivate, therefore, the present inventor is also to mLeg1^Δ/Δ The salivary gland saliva of mouse produces function to be studied.The mucus (mucin) that acinar cells secretion is produced can be by Ah Xinlan (Alcian Blue) is dyeed.Therefore, the present inventor dyes the secretion capacity of assessment salivary gland with Ah Xinlan.Use A Xin It is blue to dye wild type and mLeg1 respectively^Δ/ΔThe salivary gland section of mouse.Method is as follows.

6.4.1 submandibular organization's section is prepared：With step 6.1.1.

6.4.2 Ah Xinlan dyeing：Distilled water rehydration is used in section, afterwards with 3% acetic acid treatment 3 minutes, then Ah Xinlan Dyeing liquor (1% Ah Xinlan, 3% glacial acetic acid, PH 2.5) room temperature is dyeed 30 minutes, after flowing water is rinsed 2 minutes, distilled water profit Wash, observed with Canadian resin mounting microscopy after being dehydrated with dimethylbenzene rinse.Result is as shown in Figure 7.

The result shown from Fig. 7, wild-type mice and mLeg1^Δ/ΔAcinus between the conduit of mouse all exists non- The Ah Xinlan positive signal (arrow pointed location in Fig. 7) for often significantly concentrating, it is meant that salivary gland acinus can be normal Produce and secreting mucus.Therefore, the knockout of mLeg1 genes does not have an impact the salivary ability of salivary gland.

Embodiment 7

7.1 detection mLeg1^Δ/ΔMice plasma fat content.

Because mLeg1 is a secretory protein, and the knockout of mLeg1 seems to the development of the salivary gland of mouse and function simultaneously Do not impact, therefore salivary gland may not be the target organ of mLeg1, that is to say, that mLeg1 may transport other device Official and then function.In order to the function to mLeg1 is studied, the present inventor carries out general physical checkup to mouse, grinds Study carefully mLeg1^Δ/ΔWhether mouse occurs some exceptions physiologically.The present inventor extracts the blood of mouse, to serum In every blood index detected.Experimental technique is as follows.

7.1.1 by mouse anesthesia after, blood is taken by femoral artery and is placed into anticoagulant tube, in 1000g be centrifuged 5min, take Clearly.

7.1.1 the supernatant that will be diluted detects every blood by automatic biochemistry analyzer (Dean diagnoses generation inspection) (Olympus) Index.Shown in (a) in testing result such as Fig. 8.

Understood (in (a) of Fig. 8 by (a) in Fig. 8：The frame of braces half above is shown the index item of reduction Mesh, the mLeg1 that the frame of underlying braces half shows^Δ/ΔElevated index subjet in mouse, WT1WT2 is wild type, ZCBA1, ZGA2, ZGA3, are mLeg1^Δ/ΔMouse), mLeg1^Δ/ΔThe content of triacylglycerol is substantially reduced in mouse.Additionally, 3 kinds Bile acid (T-BIL, DBIL and IBIL) has all been reduced, and bile acid is also related with the Absorption And Metabolism of fat, which imply that mLeg1^Δ/ΔThe metabolism of mouse, especially fat metabolism are likely to occur exception.Therefore, the present inventor is carried out to mouse Screen the whether disorderly Classic Experiments of metabolism：Glucose tolerance test.

7.2 glucose tolerance tests, specific method is as follows.

7.2.1 mouse overnight starvation makes blood sugar be reduced to floor level before testing, by 1g glucose per kg Mouse Weights Amount intraperitoneal injection Glucose Liquid (glucose is dissolved in sterilizing PBS), 0min after injection respectively, 15min, 30min, 60min and 90min detects mouse's blood sugar content.Blood-sugar content is detected by Roche blood glucose meters (ACCU CHEK).(b) in result such as Fig. 8 It is shown.

Result as shown by (b) in Fig. 8 is understood (in (b) of Fig. 8：Solid line is mLeg1^Δ/ΔMouse, dotted line is wild Type mouse), the wild-type mice of intraperitoneal injection glucose is absorbed due to glucose, and blood sugar rose before this, after injection 30min culminates, and in order to maintain the blood glucose balance of body, body can by excreting insulin reduction blood-sugar content, therefore After injectable dextrose monohydrate 30min, the blood sugar of wild-type mice starts slow decline.And injected the mLeg1 of glucose^Δ/ΔIt is small Mouse, glucose is but absorbed and is entered blood circulation at faster speed, and 10min after injection, blood-sugar content has just reached highest Point, and it is higher than the blood sugar peak of wild-type mice.On the other hand, mLeg1^Δ/ΔGlucose in the blood of mouse is also with more Fast speed returns to poised state.Therefore, although mLeg1^Δ/ΔThe blood sugar that mouse remains absorbs and regulation and control function, but mLeg1^Δ/ΔThe metabolism of mouse occurs in that exception to a certain degree.

Embodiment 8

Detection mLeg1^Δ/ΔMouse liver fat content

Liver is organ maximum in mammal body, be organism metabolism maincenter where, be lipid anabolism and point Solve the important place of metabolism.Additionally, need to transport adipose tissue to by blood circulation when liver synthctic fat, when body is in , it is necessary to during using fat, the fat of fat tissue storage needs to transport liver to by blood circulation and is utilized starvation.It is logical Cross to the fat content detection in mice serum and have impact on the function of liver verifying that mLeg1 is knocked out.

Fat content in 8.1 detection serum.Experimental technique is as follows.

8.1.1 10 week old wild types and mLeg1 are taken^Δ/ΔThe serum of mouse, detects that the trigalloyl in serum is sweet on instrument Oil and cholesterol level, are repeated 3 times, and are as a result represented with average value.Shown in (c) in result such as Fig. 8.

Understood (in (c) of Fig. 8 by (c) in Fig. 8：Grey column is mLeg1^Δ/ΔMouse, white column is that wild type is small Mouse, TRIG represents triacylglycerol, and TCHOL represents cholesterol), mLeg1^Δ/ΔTriacylglycerol is reduced in mouse blood, only wild Half of type mouse or so.

Fat content in 8.2 detection liver organizations.

The above results imply that mLeg1 knocks out the function of have impact on liver.Therefore, the present inventor carries out weight to liver Point research, detects to hepatic fat content.Shown in (d) in result such as Fig. 8.

Understood (in (d) of Fig. 8 by (d) in Fig. 8：Grey column is mLeg1^Δ/ΔMouse, white column is that wild type is small Mouse, TRIG represents triacylglycerol, and TCHOL represents cholesterol), in liver, triacylglycerol is also significant reduction, meanwhile, mLeg1^Δ/ΔThe content of cholesterol is also significantly decreased in mouse liver.

Embodiment 9

Fatty storage capacity is reduced in mLeg1 knock-out mice adipose tissues.

mLeg1^Δ/ΔThe reduction of fat content promotes the present inventor to remove research fat in mouse blood and liver Whether the fat content in storage place, namely adipose tissue is reduced.The adipose tissue of mouse mainly have abdominal adipose tissue and Back fat tissue.

The fat content of 10.1 abdominal adipose tissues for detecting mouse respectively and back fat tissue, experimental technique is as follows.

10.1.1 after mouse sudden death, using conventional method anatomic observation belly and back fat.Result is as shown in Figure 9.

From the display result of (a) and (b) in Fig. 9, the mLeg1 of 10 week old^Δ/ΔIn mouse, in back fat tissue Fat content reduce it is particularly evident, and fat content also has a certain degree of reduction (in Fig. 9 in abdominal adipose tissue Shown in (c) and (d)).Therefore the knockout of mLeg1, reduces the fat storage in Mice Body really.

Growing state of 10.2 mouse under the conditions of fat feeding high

The above results, also further promote the present inventor to guess whether mouse can cause to high lipid food feeding Obesity produces resistance.By to different types of mouse constantly feeding high lipid food.Experimental technique is as follows.

10.2.1, the normal diet or high lipid food of abundance are provided in mouse cage, mouse free choice feeding is allowed.

10.2.2 detected at different time points (4,5,6,7,9,10,11,12,13,15,16,17,19,22,24 week old) Its body weight, is repeated twice, each every group of 3 to 6 mouse, is as a result represented with average value.With detection time point as abscissa, with body Weight values (unit is g) are ordinate, draw the changes of weight curve map of mouse, shown in (a) in result figure 10.

Understood (in figure by (a) in Figure 10：Chow represents normal diet raising, HFD and represents high lipid food raising, mLeg1^Δ/ΔChow represents the mLeg1 raised using normal diet^Δ/Δ、mLeg1^Δ/ΔHFD represents the mLeg1 raised using high lipid food^Δ/Δ, wt chow represent using normal diet raise wild-type mice, wt HFD represent using high lipid food raise it is wild Type mouse), when to wild type and mLeg1^Δ/ΔWhen mouse carries out the feeding of normal diet, two kinds of body weight of mouse are all with the age Increase and increase.And when replacing normal diet to carry out feeding with high lipid food, the mouse of wild type is due to obtaining excessive energy Measure and these energy are stored in the form of fat, therefore, the mouse of wild type is in the case of fat feeding high, and body weight is fast Speed increases, and is eventually developed to be obesity.Meanwhile, mutant mice under fat feeding high, body weight increase and normal diet Mouse has no significant difference.

In addition, after feeding six months is carried out with high lipid food, the increase of wild-type mice build, belly and back are present very Thick fat deposit, shows obviously obesity symptom, and mLeg1^Δ/ΔMouse then continues to remain in diet situation The build (shown in (b) in such as Figure 10) of lower mouse.The function that these results are further characterized by mLeg1 ceases with fat metabolism really Manner of breathing is closed.

Embodiment 10

The decrease of fatty acid synthesis ability power causes mLeg1^Δ/ΔMouse lipid is reduced

The expression of beta-oxidation relevant enzymes in 10.1 detection livers

On the one hand the reduction of fat content is probably that fat consumption increases, on the other hand then may aliphatic acid or triacylglycerol Caused by synthesis is reduced.The catabolism of aliphatic acid is main to be realized in liver by beta-oxidation.Therefore, by quantitative fluorescent PCR (qRT-PCR) expression of beta-oxidation relevant enzymes is detected to verify mLeg1^Δ/ΔThe reduction of mouse adipose content is by fat Consumption increases caused by still aliphatic acid or triacylglycerol synthesis reduction.Experimental technique is as follows.

10.1.1 wild type and mLeg1 are detected using qRT-PCR^Δ/ΔMouse liver beta-oxidation relative enzyme gene (FBP1/ PCX/ACOX/PEPCK expression), every group takes three independent mouse, and gene expression amount is with reference to normalizing with β-actin After change, expression quantity is represented with average value.The detection method of qRT-PCR is following (hereinafter herewith)：

(1) RNA is extracted：Operating method with the 1.1RNA extraction steps in embodiment 1, or directly using in embodiment 1 The RNA samples that are extracted of 1.1RNA extraction steps detected.(2) RNA purifying：Due to the total serum IgE of Trizol methods extracting May the pollution containing genomic DNA, therefore, for quantitative fluorescent PCR RNA sample first with dnase digestion remove may Presence DNA.In 50 μ l reaction systems, by the DNaseI (NEB that 2 units of every 10 μ g total serum IgEs addition pollute without RNase Cat.No.M0303S), the reaction buffer of 5 μ l 10x is added, with DEPC water polishing to 50 μ l.Used after 37 DEG C of reaction 20minMini Kit (QIAGEN Cat.NO.74106) carry out RNA purifying.(3) RNA reverse transcriptions：RNA after purification is through upper Step reverse transcription is stated for cDNA, RNA passes through Reverse Transcriptase kit (M-MLV First Strand Kit, Life Technologies, Cat.No.C28025-032) synthesis cDNA.(4) synthesis step is as follows：The RNA sample of 1 μ g extractions is taken, plus Enter the OligodT of 50 μM of 1 μ l, 1 μ l 10mM dNTP are added, with water polishing to 10 μ l.65 DEG C are denatured 5min, on ice at least 1 point Clock.Add 10 μ l cDNA mixtures (4 μ l 5x First Line Buffer, 2 μ l 0.1M DTT, 1 μ l M-MLVRT enzymes, 3 μ L DEPC water).In 70 DEG C of 15min terminating reactions after 37 DEG C of reaction 50min.The cDNA of synthesis is used to subsequent experimental or being stored in- In 20 refrigerators.

(5) quantitative fluorescent PCR：With the cDNA that obtains as template carries out quantitative fluorescent PCR.Fluorescent quantitation is reacted according to product Specification uses SsoFastTM EvaSupermix kits (Bio-Rad Cat.No.172-5201) are carried out.Often Individual reaction is carried out with 10 μ l systems, wherein template containing cDNA 0.5 μ l, Supermix 5 μ l, 10 μM of forward and reverse each 0.5 μ l of primer, The μ l of distilled water 3.5.Forward and reverse primer is used by quantitative fluorescent PCR：Forward primer beta actin Fwd： GTGACGTTGACATCCGTAAAGA；Reverse primer beta actin Rv：GCCGGACTCATCGTACTCC.Fluorescence signal is determined Amount is carried out by CFX96TM Real-Time System (Bio-Rad C1000TM Thermal Cycler).Used by each gene Primer is as shown in table 1.

Shown in (a) of testing result such as Figure 11.

The embodiment of the present invention of table 1. carries out the primer sequence table used by qRT-PCR

Understood (in (a) of Figure 11 by (a) in Figure 11：Ordinate is relative expression levels, and abscissa is related β oxygen Change the relative expression levels of enzyme gene), the catabolism of aliphatic acid is main to be realized in liver by beta-oxidation, contrasts wild type And mLeg1^Δ/ΔThe expression of beta-oxidation relevant enzymes in mouse liver, it is found that the knockout of mLeg1 genes does not have and cause these The abnormal rising of gene expression, illustrates that the knockout of mLeg1 does not accelerate the generation of beta-oxidation, i.e., do not cause fat consumption Increase.mLeg1^Δ/ΔThe fat reduction of mouse is synthesized caused by reduction by aliphatic acid or triacylglycerol.

Aliphatic acid synthesizes the expression of relevant enzymes in 10.2 detection livers, and experimental technique is as follows.

10.2.1 using method detection wild type and the mLeg1 similar with 10.1.1^Δ/ΔMouse liver aliphatic acid synthesizes phase The expression of enzyme (ACC1/ACC2/FAS/SCD1/ACL/GPAT1/DGAT1/DGAT2) is closed, the primer is as shown in table 1 below.

Shown in (b) in testing result such as Figure 11.

Understood (in (b) of Figure 11 by (b) in Figure 11：Ordinate is relative expression levels, and abscissa synthesizes for aliphatic acid Relevant enzyme), by comparing wild type and mLeg1^Δ/ΔWhen aliphatic acid synthesizes the express spectra of relevant enzymes in mouse liver, this is found The expression of a little enzymes has different degrees of reduction.The expression of the related several enzymes of aliphatic acid de novo formation has different degrees of subtracting Lack, essentially half of wild type or so.Wherein, ACC1, ACC2, FAS and DGAT1 are in mLeg1^Δ/ΔIt is all notable in knock-out mice Reduce.

When the effect that these genes are played in lipid building-up process is further observed, the inventors found that (as shown in figure 12, these gene codes are catalyzed a series of enzyme of biochemical reactions of synthesis from Krebs cycle products to aliphatic acid In figure：What square frame was marked is the gene of differential expression after mLeg1 is knocked out).The expression of these genes (SCD1/FASN/ACC/ACL) Lower, it is meant that mLeg1^Δ/ΔThe decrease of fatty de novo formation ability in the liver of mouse, will other energy substances be converted into Aliphatic acid simultaneously carries out the ability of fatty storage and is obviously reduced.The reduction of synthctic fat in liver, explains liver internal blood vessel attached The reduction of weakly acidic pH fat, explains mLeg1^Δ/ΔWhy triacylglycerol is reduced in mouse blood, also explains mLeg1^Δ/ΔMouse The lipopenic reason of adipose tissue.

Embodiment 11

The expression of the transcription factor of 11.1 detection regulation and control lipid synthetic gene expressions

The transcription factor for regulating and controlling lipid synthetic gene expression mainly has 4, PPAR γ, chrebp, PGC1 α and srebp1c. Therefore, expression of the present inventor first to these transcription factors in liver is studied.Experimental technique is as follows.

11.1.1 using method detection wild type and the mLeg1 similar with step 11.1.1^Δ/ΔMouse liver transcription factor (PPAR γ, chrebp, PGC1 α and srebp1c) horizontal specific experiment method of table refers to the step 2.1-2.4 in embodiment 2, Relevant primer used is shown in Table 1, and testing result is as shown in figure 13.

As shown in Figure 13 (in figure：Ordinate is relative expression levels, and abscissa is the transcription factor for regulating and controlling Fatty synthesis), There was only the expression of srebp1c in 4 kinds of transcription factors (PPAR γ, chrebp, PGC1 α and srebp1c) in mLeg1^Δ/ΔMouse Liver Substantially reduced in dirty, therefore, mLeg1^Δ/ΔIt is that srebp1c expression reduces institute that the expression of the lipid synzyme of liver declines in mouse Cause.

Embodiment 12

12.1 mLeg1^Δ/ΔThe phosphorylation level of the Akt in mouse liver

The activity regulation of Srebp1c mainly has two ways：One is the Srebp1c not being phosphorylated is generally resided on carefully In kytoplasm, and Akt regulates and controls the phosphorylation of Srebp1c by mTORC1, so that it is transferred in nucleus from cytoplasm, And play its transcriptional activity；The second is Akt can with it is a kind of be not especially clear mechanism positive regulation srebp1c transcription water It is flat.Therefore the activity regulation of Srebp1c is mainly by the activity of Akt to realize.

In the present embodiment, the present inventor's detection lipid synthesis center liver, and in the salivary gland of mLeg1 expression Akt activity levels.And the activity of Akt can be indicated with its phosphorylation level.Therefore, can be by detecting phosphorylation level come anti- Answer the activity of Akt.Experimental technique is as follows.

12.1.1 liver is extracted by step 3.1 method, salivary gland albumen, by Western blot, uses Akt phosphorylation Antibody (Cell signalling#4060P) detects the phosphorylation level of Akt.

Shown in (a) and (b) in testing result such as Figure 14.

Understood (in figure by (a) and (b) in Figure 14：WT represents wild-type mice, mLeg1^Δ/ΔRepresent mLeg1 clpp genes Except mouse), mLeg1^Δ/ΔThe phosphorylation level of the Akt in mouse liver is substantially less than wild-type mice (such as (a) institute of Figure 14 Show).There is obvious phosphorylation Akt albumen and the difference of the Akt phosphorylation in salivary gland is more notable, in wild-type mice, And mLeg1^Δ/ΔThe phosphorylation (such as shown in (b) of Figure 14) of Akt is substantially not detectable in the salivary gland of mouse.These results are all demonstrate,proved It is bright, mLeg1^Δ/ΔThe activity of mouse Akt is inhibited, and also gives the explanation that srebp1c expression is reduced.

Embodiment 13

The factor that salivary gland cell is secreted into supernatant can induce HepG2 cell Akt phosphorylations

In order to whether the knockout for verifying mLeg1 is directly related with Akt reduced activities in liver, the present inventor is first External experimental system is taken to detect that can mLeg1 activate Akt.Because mLeg1 is that expression is enriched in mouse salivary glands Secretory protein, if carrying out original cuiture to salivary gland cell, can be secreted in cells and supernatant mLeg1.Therefore, the present inventor carries out Western blot to the cell and cells and supernatant of salivary gland original cuiture Detection.Experimental technique is as follows.

The original cuiture of 13.1 salivary gland cells：

13.1.1 at the disconnected neck of mouse after death, salivary gland is rapidly removed, and, eliminate adhesion with the PBS for sterilizing twice Hair.The salivary gland that will be removed with scissors is shredded.

13.1.2 the salivary gland that will be shredded with the ratio of 40mg/ml is collected into buffer (volume is as V).Per 2ml 25 μ l hyaluronidases (hyaluronidase), 25 μ l Type Ⅱ collagens enzyme (collagenase II) and 250 are added in buffer The CaCl of μ l 50mM₂, 40min is incubated in 37 DEG C.

13.1.3 supernatant, and repeat step 13.1.2 are removed in 1500rpm centrifugations.

13.1.4 supernatant is removed in 1500rpm centrifugations, and is cleaned with the buffer of V volumes, and supernatant is removed in centrifugation, then with 1/2V's Once, supernatant is removed in centrifugation to buffer repeated washings.

13.1.5 the tissue being centrifuged with the buffer resuspensions of 1/2V, and with cell filter (Cell Strainer, BD Cat.NO.352340) filtrate is filtered to take with MSG nutrient solution cultures.

Wherein, solution formula used is as follows：

Buffer：(1%BSA (Amresco Cat.NO.0332) in Hank ' s buffer (Beyotime, Cat.NO.C0218))。

Recombinase is formulated：Hyaluronidase (Sangon Biotech, Cat.NO.A002594), concentration are dissolved with buffer It is 40mg/ml；Type Ⅱ collagen enzyme (GIBCO Cat.NO.17101-015) is dissolved with buffer, concentration is 23mg/ml.Enzyme solutions Fresh configuration is advisable.

MSG nutrient solutions：DMEM high glucose mediums (GIBCO Cat.NO.11965-092), the penicillin and streptomysin of 1X (Beyotine, Cat.NO.C0222), insulin-transferin-Selenium-X (GIBCO, the Cat.NO.41400- of 1X 045), 1 μM of dexamethasone (Sigma D4902), 10% hyclone (GIBCO Cat.NO.16000-044).

13.2 extract through the total protein of the salivary gland cell after original cuiture：The nutrient solution that above-mentioned steps are obtained is taken, in 1000g is centrifuged 5min, and SDS lysate (63mM Tris-Hcl, PH6.8,10% glycerine, 5% β-sulfydryl second are added after abandoning supernatant Alcohol, the Complete of 3.5%SDS, 1X) cracking, follow-up Western blot detection and analysis is carried out after 100 DEG C of denaturation 7min or is protected It is stored in -20 DEG C.(for attached cell, it is performed as follows：After going culture supernatant, SDS lysates are added, scraped with cell It is collected in after attached cell in 1.5ml centrifuge tubes.Follow-up Western blot detection and analysis is carried out after 100 DEG C of denaturation 7min or is protected It is stored in -20 DEG C).

13.3 directly take the cells and supernatant after original cuiture for subsequently carrying out Western blot detections.

The step of method of 13.4 Western blot detections is with step embodiment 3 3.2.In testing result such as Figure 14 Shown in (c).

Understood (in (c) of Figure 14 by (c) in Figure 14：CK media represent the cell culture for not cultivating salivary gland cell Liquid, salivary media represent the cell culture fluid for having cultivated wild type salivary gland cell, and salivary cell represent saliva The cell of gland original cuiture), all there is mLeg1 albumen in cell and cells and supernatant, and by detecting the Akt in cell MLeg1 in protein content confirmation cells and supernatant is not due to caused by cell contamination.

Embodiment 14

On the experiment basis of embodiment 13, the present inventor is with this nutrient solution containing mLeg1 (from wild Type salivary gland cell culture supernatant) and without mLeg1 albumen nutrient solution (come from mLeg1^Δ/ΔIn mouse salivary glands cell culture Go clearly) to cultivate human liver cancer cell HepG2, can research salivary gland secretion directly facilitate the phosphorylation of HCC Akt, and The ability of this induced activation phosphorylation Akt whether there is difference under the conditions of mLeg1 albumen is whether there is.Experimental technique is as follows.

14.1 human liver cancer cell HepG2 are cultivated：10% NBCS (GIBCO is added with DMEM high glycoforms culture medium Cat.NO.16010-159) culture is in 5%CO₂, cultivated in 37 DEG C of constant temperature and the incubator of saturated humidity.During passage, eliminate Nutrient solution, is digested in good time with 0.25% pancreatin (EDTA-free, Sigma Cat.NO.T4549), takes appropriate passage culture Or subsequent experimental.

14.2 with original cuiture wild-type mice salivary gland cell and mLeg1^Δ/ΔMouse salivary glands cells and supernatant is incubated The HepG2 cells of adherent growth are educated, cell sample is collected behind 20 minutes and 10 hours respectively.

14.3 by Western blot, with the content of Akt phosphorylation antibody test p-Akt, to react the phosphorylation of Akt Level.

Shown in (d) in 14.4 results such as Figure 14.

Understood (in (d) of Figure 14 by (d) in Figure 14：CK represents mLeg1^Δ/ΔMouse salivary glands cells and supernatant, MLeg1 represents wild-type mice salivary gland cell culture supernatant), whether cultivate HepG2 cells 10 hours, or 20 minutes, All it is significantly higher than with the phosphorylation level of the Akt of the HepG2 cells of wild type salivary gland cell supernatant culture and uses mLeg1^Δ/ΔOn The cell of clear culture, and mLeg1 can just induce the phosphorylation of Akt in short 20 minutes, it was demonstrated that wild-type mice saliva Liquid glandular secretion thing can actually promote Akt phosphorylation, and after working as mLeg1 knockouts, the ability that salivary gland secretion is activated to Akt shows Write and decline, it was demonstrated that what the mLeg1 of salivary gland secretion can be direct or indirect carries out Active Regulation to Akt.

Embodiment 15

The factor that salivary gland cell is secreted into supernatant can induce mLeg1^Δ/ΔThe phosphorylation of mouse liver Akt

Above-mentioned experiment in vitro proves that wild type salivary gland cell secretion can promote the phosphorylation of the Akt of HCC. Further, the present inventor can these secretion to the phosphorylation level of internal liver Akt regulate and control into Row research.Experimental technique is as follows.

15.1 are respectively adopted intraperitoneal injection and tail vein injection method by wild type and mLeg1^Δ/ΔMouse salivary glands are primary The supernatant of cultured cells secretion is expelled to mLeg1^Δ/ΔIn mouse.

1 hour sudden death mouse, collects liver, and by Western Blot, use Akt phosphorylation antibody after 15.2 injections Whether the phosphorylation level of Akt changes in detection liver.Shown in (a) in result such as Figure 15.

Understood (in (a) of Figure 15 by (a) in Figure 15：WT represents wild-type mice salivary gland cell culture supernatant, mLeg1^Δ/ΔRepresent mLeg1^Δ/ΔMouse salivary glands cells and supernatant, lumbar represents intraperitoneal injection, and vein represents tail vein note Penetrate), whether the salivary gland cell secretion of the wild type of intraperitoneal injection or tail vein injection can promote mLeg1^Δ/ΔMouse The phosphorylation of liver Akt.Result above proves that the salivary gland secretion containing mLeg1 equally can be to the Akt phosphorus in internal liver Acidifying is regulated and controled, additionally, the result also implies that salivary gland secretion can be eventually arrived at liver and be played by blood transportation making With.

Embodiment 16

The phosphorylation of the protein induced Akt of mLeg1 of the various concentrations obtained by salivary gland purifying

Wild type and mLeg1^Δ/ΔThe most direct difference of mouse salivary gland cell is that can they express mLeg1, then, Wild type and mLeg1^Δ/ΔWhether the Akt phosphorylation difference that mouse salivary glands cell secreta is caused is to be directly contributed by mLeg1 , i.e., whether mLeg1 albumen can directly induce the phosphorylation of Akt.The present inventor is carried out by following experimental technique Research.

The phosphorylation level of the protein induced Akt of mLeg1 of 16.1 column chromatographic isolation and purifications.Experimental technique is as follows.

16.1.1 two to three salivary gland of wild-type mice are taken, is placed in the PBS of precooling and is rinsed, used after taking-up Scissors is cut into tiny fragment, is transferred to afterwards in tissue homogenizer.Add 4ml lysates (Tris-Hcl of 50mM, PH 8.0,150mM NaCl, 0.5% NP40, the complete of 2x), fully homogenate on ice.Take out broken repeatedly with 23G syringe needles afterwards, 4 DEG C of vertical shaking tables are incubated 30min, and 4 DEG C of centrifuge 12000g are centrifuged 15min, take supernatant.

16.1.2 supernatant is at the uniform velocity passed through into sephalose 6B molecular sieves in 4 DEG C, wherein wash-out PBS.With 4ml/ pipes collect different elution fractions.

16.1.3 the content of mLeg1 in each component and by Western blot is detected.Take the pipe of mLeg1 contents highest one It is the mLeg1 of purifying, and is control with the mLeg1 albumen of recombination expression in Escherichia coli, estimates the concentration of mLeg1, and be used for Subsequent experimental.

16.1.4 the mLeg1 albumen of purifying is diluted to different concentration (respectively 3.14x10^-2ng/μl、0.314ng/μ L and 3.14ng/ μ l) it is separately added into HepG2 medium cultures HepG2, after 37 DEG C are incubated 20 minutes, then extract the total egg of cell In vain (extracting method refers to step 13.2), and by Western blot the phosphorylation level (reference of the Akt under each concentration is detected Step 14.3, corresponding antibodies select anti-p-Akt antibody (S473, Cell signalling#4060P), and dilution ratio is when using 1:1000).Shown in (b) in result such as Figure 15.

Understood (in (b) of Figure 15 by (b) in Figure 15：A represents 3.14ng/ μ l, B and represents 0.314ng/ μ l, C representative 3.14x10^-2Ng/ μ l, "-" are represented and not added), mLeg1 albumen can induce the phosphorylation of Akt, and the mLeg1 of nanogram level to be The Akt phosphorylation of inducible HepG2 cells.

16.2 come from wild-type mice and mLeg1^Δ/ΔThe phosphorylation level of the component induction Akt of mouse salivary glands.Experiment Method is as follows.

16.2.1 wild-type mice and mLeg1 are extracted respectively^Δ/ΔComponent of the mouse salivary glands rich in mLeg1 albumen.

16.2.2 the component that 16.2.1 is extracted is added separately to cultivate HepG2 in HepG2 culture mediums, 37 DEG C are incubated 20 points Zhong Hou, then extracts the total protein (extracting method refers to step 13.2) of the cell after culture.

16.2.3 the phosphorylation level for detecting the Akt under each concentration by Western blot (specifically refers to step 13.2, corresponding antibodies select anti-p-Akt antibody (S473, Cell signalling#4060P), and dilution ratio is 1 when using: 1000).Shown in (a) in result such as Figure 16.

Understood (in (a) of Figure 16 by (a) in Figure 16："-" represents mLeg1^Δ/ΔMouse salivary glands total protein, "+" is represented Wild-type mice salivary gland total protein), the wild-type mice salivary gland Akt phosphorylation of component induction containing mLeg1 is significantly stronger than mLeg1^Δ/ΔMouse salivary glands respective components.

Embodiment 17

MLeg1 activation Akt relies on PI3K paths

Because mLeg1 is a cell secretory protein, and with mLeg1 cultivate HepG2 cells experiment in, mLeg1 is suitable In an extracellular protein, while the phosphorylation of Akt is an intracellular important signal transduction process, therefore, relate to here And extracellular signal is converted into the process of signal in active cell.The Akt phosphorylation of known extracellular signal induction is made a general survey of, it is main PI3K phosphorylation PIP2 are depended on, and is translated into PIP3, so as to further induce the phosphorylation of Akt.Therefore, mLeg1 The Akt phosphorylation of induction may be also relied on PI3K paths.Specific inhibitor of the present inventor from PI3K LY290004 suppress PI3K signal paths, and observe PI3K paths be suppressed after, whether mLeg1 changes to Akt activation capabilities Become.Experimental technique is as follows.

17.1 before processings, 0.1% serum starved overnight of HepG2 cells, with 0.25% pancreatin (EDTA-free, Sigma Cat.NO.T4549) digestion in good time, take appropriate cell and be placed in centrifuge tube,

17.2 use wild type (containing mLeg1) and mLeg1^Δ/Δ(be free of mLeg1) mouse salivary glands cell primary culture it is upper Clear liquid culture HepG2 cells, and in the culture supernatant of wild type mouse salivary gland cell add various concentrations (it is low to high according to Secondary is 10 μM, 20 μM and 40 μM) PI3K inhibitor LY290004 (cell signaling) suppress PI3K paths.

17.3 phosphorylation levels that the Akt under each concentration is detected by Western blot, concrete operations refer to step 18.2.2.Shown in (b) in testing result such as Figure 16.

17.4 in addition, after step 17.1, and the LY290004 of mLeg1 and 10 μM purified with column chromatography cultivates HepG2 Cell, cultivates 15min in cell culture incubator, 1000g centrifugations 5min removes supernatant.SDS lysates cell lysis are added to extract albumen (concrete operations refer to step 13.2).

The phosphorylation level of 17.5 Akt that HepG2 cells are detected by Western blot.In testing result such as Figure 16 Shown in (c).

Understood (in (b) of Figure 16 by (b) in Figure 16：It is thin that WT media represent wild-type mice salivary gland original cuiture Born of the same parents' culture supernatant, "-" is represented and not added, and it is 10 μM that A represents addition concentration, and it is 10 μM that B represents addition concentration, and it is dense that C represents addition Spend for 10 Μ m, CK media represent mLeg1^Δ/ΔMouse salivary glands cells and supernatant), the primary training of wild-type mice salivary gland The ability for supporting cells and supernatant (WT media) activation Akt is significantly stronger than mLeg1^Δ/ΔMouse salivary glands cells and supernatant (CK media), when various concentrations PI3K inhibitor LY29004 are added inside WT media, can very significantly press down The phosphorylation of the Akt that the salivary gland composition of wild-type mice processed causes.Illustrate, when LY290004 is added, the culture containing mLeg1 Liquid can no longer induce the phosphorylation of Akt, and intracellular Akt phosphorylation is maintained at extremely low level.And the phosphoric acid of PTEN Change level does not have as the addition of LY290004 is raised, it was demonstrated that the suppression of this Akt phosphorylation level is not due to PTEN Cause.

Meanwhile, understood (in (c) of Figure 16 by (c) in Figure 16："-" in upper row represents mLeg1^Δ/ΔMouse salivary glands, "+" represents wild-type mice salivary gland；"-" in lower row is represented and adds LY29004, and "+" is represented and do not add LY29004), this hair Bright inventor adds mLeg1 and 10 μM of LY290004 that column chromatography is purified in HepG2 culture mediums, finds LY290004 energy Enough complete inductions for suppressing mLeg1 to Akt phosphorylation.Therefore, the Akt phosphorylation of mLeg1 inductions depends on PI3K signals to lead to Road.

Embodiment 18

MLeg1 activates Akt by RTK

Extracellular signal be delivered to it is intracellular need through cell membrane, and connect extracellular signal with intracellular PI3K signals A class memebrane protein be receptor tyrosine kinase (Receptor tyrosine kinase, RTK).RTK is combined with respective ligand After can autophosphorylation and phosphorylation stream substrates, and this phosphorylation occurs on tyrosine residue, therefore, it can lead to Cross detect the level difference of intracellular total tyrosine phosphorylation screen mLeg1 inductions Akt phosphorylation whether be by RTK come Realize.Experimental technique is as follows.

18.1, toward adding mLeg1 in HepG2 cell culture mediums and cultivating HepG2 cells, then extract total protein of cell.

18.2 check intracellular total tyrosine by tyrosine phosphorylation antibody 4G10 (Millipore, 05-321) The level of phosphorylation.Shown in (d) in result such as Figure 16.

Understood (in (d) of Figure 16 by (d) in Figure 16：CK is not add mLeg1), it is intracellular after mLeg1 albumen is added Tyrosine phosphorylation level be significantly larger than control group.Additionally, Western results are also indicated that, the egg that tyrosine phosphorylation occurs White molecular weight is all larger, and this is all larger very identical with the molecular weight of RTK.Further imply the phosphoric acid that mLeg1 promotes Akt Change is realized possibly via RTK.

Embodiment 19

MLeg1 activates EGFR

In human genome, a total of 58 gene code RTK, therefore, the present inventor determines that research mLeg1 is Signal is transmitted especially by which RTK is activated, the present inventor have chosen the RTK screening systems of R＆D here.This is System is crosslinked on same film respectively by by 49 antibody of RTK, will be corresponding in cell pyrolysis liquid by these antibody RTK albumen is left behind and is attached on film.Phosphorylation characteristic can be occurred on the tyrosine of itself based on RTK activation, can be passed through Tyrosine phosphorylation antibody test each attachment RTK tyrosine phosphorylation levels, be used to indicate the activation situation of RTK.Experiment Method is as follows.

The screening of 19.1 receptor tyrosine kinases passes through RTK assay kit (Proteome Profiler Human Phospho-RTK Array Kit, R＆D Cat.no.ARY001B) operated according to specification.The kit can detect 58 altogether 49 in individual RTK, operating procedure in brief, with mLeg1 and control treatment cell (covering with 10cm culture dishes) respectively, is used 500 μ l lysis buffer17 cell lysis.After RTK screens film through Assay buffer1 closings 1 hour, cell cracking is applied Liquid is combined overnight, is washed 3 times by 1X Wash Buffer, 10 minutes every time, is added with 1X Array Buffer2 with 1：5000 The Anti-Phospho-Tyrosine-HRP Detection Antibody of dilution, are incubated at room temperature 2 hours again.1X Wash Buffer is washed 3 times, every time after 10 minutes, Chemi Reagent Mix developments is applied, by fluorogenic chemiluminescence imager Signal is collected in (Clinx Science Instruments Cat.No.3400) inner imaging.Shown in result figure 17.

As shown in Figure 17, whether the activity of major part RTK, not by adding the mLeg1 to be influenceed, all keeps in HepG2 cells In relatively low level, and only EGFR (as shown in the point that circle in Figure 17 is irised out) is after mLeg1 incorporations, its tyrosine phosphorylation Dramatically increase, it is meant that mLeg1 is added, and have activated EGFR, one-step activation downstream Akt signals of going forward side by side.

Further, the present inventor detects mLeg1 to intracellular by the phospho-specific antibody of EGFR The influence of the activation level of EGFR, is displayed that (in (a) of Figure 18 by the result of (a) of Figure 18："-" is represented and not added, "+" generation Table is added), the incorporation of mLeg1 can very rapidly activate EGFR acceptors, and Akt signals are activated after.

Embodiment 20

MLeg1 activates the activation of Akt EGFR dependents

The phosphoric acid of Akt is induced likely via the activation of EGFR by the selection result display mLeg1 of the RTK of embodiment 21 Change, if the phosphorylation of the Akt that mLeg1 is induced can be blocked by the activity that the inhibitor of EGFR suppresses EGFR, will be further Confirm that mLeg1 is to activate Akt by EGFR.Here the present inventor chooses the specific inhibitor AG1478 of EGFR To suppress the activity of EGFR.Experimental technique is as follows.

20.1 HepG2 cell culture, specifically refer to step 18.1.

20.2, toward additive (BSA, mLeg1, AG1478) is separately added into cell culture fluid, are processed, and cultivate 15 points Zhong Hou, extracts total protein (refer to step 13.2), and carry out each albumen during Western blot detect each treatment group (p-Akt, Akt, P-EGFR) level (referring to step 2.2).Shown in (b) in result such as Figure 18.

From (b) in Figure 18, when the mLeg1 of column chromatography for separation is added in the culture medium of HepG2 cells, can lure Lead Akt phosphorylation, and add the BSA control groups of bovine serum albumin(BSA), Akt phosphorylation is substantially unaffected.In toward culture medium When the AG1478 for adding 1 μM suppresses activity of EGFR, the inventors found that the Akt phosphorylation of mLeg1 inductions is blocked. Meanwhile, the phosphorylation level to EGFR studies discovery, and mLeg1 processes the phosphorylation induction of EGFR, and after adding AG1478, The activation of EGFR is then suppressed.Therefore, the phosphorylation of mLeg1 inductions Akt depends on the activation of the EGFR acceptors of surface of cell membrane.

Embodiment 21

There is the interaction between albumen and albumen in mLeg1 and EGFR acceptors

Result display mLeg1 above can activate PI3K signals by EGFR, so as to induce the phosphorylation of Akt.EGFR It is a receptor protein of surface of cell membrane, and mLeg1 is a secretory protein, therefore mLeg1 may be combined directly with EGFR, Downstream signal is directly activated as a signaling molecule.Therefore, the present inventor is then detected by co-immunoprecipitation Whether there is interaction between mLeg1 and EGFR.

The function of liver can be influenceed due to result above display mLeg1, the present inventor divides by by column chromatography Go to be incubated the isolated cell of liver homogenate from the mLeg1 albumen of purifying.Because the reaction of mLeg1 activation EGFR is very fast Speed, and the EGFR after activating moves towards degraded quickly, therefore, the present inventor is incubated liver cell with mLeg1 at 4 DEG C, while Cross liner DS P stabilization mLeg1 and the interaction of its potential interaction albumen are added, then mLeg1 is cleaned and is split by NP40 Solution liquid cracking liver cell carries out co-immunoprecipitation.Experimental technique is as follows.

21.1 is antibody linked：Take 30 μ l proteinA/G (beyotime Cat.NO.P2012), low speed (500~ Supernatant is removed in 1000g) centrifugation.4 DEG C of PBSs of precooling add antibody (20 μ g antibody are dissolved in the μ l PBS of 1X 100) afterwards twice, Incubation at room temperature 30min.Supernatant is removed in centrifugation.With 300 3 pearls of μ l PBSs, add 50 μ l DSS solution (5 μ l 10x PBS, 36 μ l H2O, 9 μ l 2.5mM DSS (Thermo, Cat.No.21655), are incubated at room temperature 50 minutes.After supernatant is removed in centrifugation, 50 μ are used L 100mM PH2.2 glycine cleaning pearl 3 times, PBSs of the 300 μ l containing 1%NP40 is twice, finally clear with 300 μ l PBS Wash once.The pearl of cross-linking antibody keeps moistening, and most supernatant is abandoned using preceding centrifugation.

21.2 by column chromatography for separation, obtains the component containing mLeg1 and mLeg1 of wild type salivary gland^Δ/ΔMouse saliva Component of the liquid gland without mLeg1.

21.3 are incubated the isolated cell of liver homogenate, 4 DEG C of incubation liver cells, while add handing over said components respectively The interaction of connection agent DSP stabilization mLeg1 and its potential interaction albumen.

21.4 co-immunoprecipitations：Tissue or cell by NP40 lysates (Tris-Hcl of 50mM, PH 8.0,150mM's The complete of NaCl, 1% NP40,2Mm EDTA, 1mM PMSF, 2x) fully it is homogenized, 4 DEG C of vertical shaking tables are fully cracked 15min, 12000g centrifugations 15min at 4 DEG C, takes supernatant for subsequent operation.The pearl for being crosslinked antibody, 4 are added toward supernatant After DEG C overnight incubation.Cleaned 3 times with 4 DEG C of PBST of precooling (0.1%Tween 20), then with precooling PBS twice.Add 50 The albumen combined on μ l 100mM PH2.2 glycine elution pearls, add 2 μ l 1M PH9.5 glycine in and PH after- 20 DEG C preserve or direct subsequent analysis.

21.5 detect the albumen that mLeg1 antibody is pulled down by Western Blot.Shown in (c) in result such as Figure 18.

Understood (in (c) of Figure 18 by (c) in Figure 18：Input represents the albumen for co-immunoprecipitation experiment；"-" generation Table is the control group of gavage mLeg1 albumen；"+" represents the experimental group of gavage mLeg albumen；IP:α-mLeg1 represent mLeg1 antibody With reference to and leave behind mLeg1 albumen and its interaction protein), do not add the EGFR in the liver cell of mLeg1 can not be by mLeg1 Antibody leave behind, and after adding mLeg1, in mLeg1 antibody co-precipitation component in addition to containing mLeg1 albumen, also contain EGFR Albumen, therefore, interaction is implicitly present between mLeg1 and EGFR.

Embodiment 22

Above-mentioned research shows the function of mLeg1 regulation liver Akt activity by combining and activates EGFR to realize, This needs mLeg1 to reach liver and be combined with EGFR.The present inventor knows that mLeg1 is expressed in salivary gland, And be secreted into saliva.Whether the mLeg1 in so this oral cavity can reach liver and phase interaction occurs with the EGFR in liver WithIn order to simulate this case, studied by following experimental technique.

The mLeg1 that column chromatography is purified is entered mLeg1 by 22.1 with the mLeg1 of 50ng by every gram of Mouse Weight from oral cavity gavage^Δ/ΔIn mouse.

Different time points after 22.2 gavages (0,10,20,40,60min) mouse is died suddenly and liver specimens are collected, pass through The antibody of mLeg1 mLeg1 albumen that may be present to liver carries out immunoprecipitation experiment, with mLeg1 after detection process^Δ/ΔMouse The result that mLeg1 albumen interacts with EGFR, specifically refers to step 21.2-21.5.

By the behavior that the mLeg1 of above method simulation salivary gland secretion enters after alimentary canal.

Theoretical based on more than, mLeg1 needs to be played a role in liver, then the liver of mouse ought to be present after gavage MLeg1 albumen.Shown in (d) in result such as Figure 18.

From (d) in Figure 18, mouse stomach can detect mLeg1 albumen after 10 minutes in its liver, and Protein content reaches maximum after 20 minutes in gavage, and mLeg1 of the gavage after 40 minutes and 60 minutes in liver starts to reduce.Together When, after the present inventor observes gavage 10 minutes, the EGFR that mLeg1 is combined is most, the EGFR protein contents for combining afterwards Continuity over time is constantly reduced.This is probably caused by mLeg1 and EGFR is quickly combined and transmits downstream signal rapidly： MLeg1 can just activate EGFR within 1 minute in experiment in vitro, and EGFR phosphorylation levels within 3 minutes begin to reduce. Meanwhile, the present inventor also checked the activation situation of the mLeg1 albumen to downstream Akt of this gavage.After mLeg1 gavages After 10 minutes, the Akt phosphorylation in liver just increased, and it is this increase gavage after 40 minutes to 60 minutes it is more bright It is aobvious.Based on the above results, salivary gland secretion expression mLeg1 can be absorbed by the blood by alimentary canal, and eventually arrive at it is dirty simultaneously EGFR in activation liver, so as to activate Akt, finally the physiological function to liver cell regulates and controls.

In sum, in the food to normal mouse fed continuous high fat content (10%), the body weight of the mouse will Lasting weightening, ultimately results in obesity, and a series of obesity syndromes generation.And when mLeg1 genes are knocked out, that is, suppress During the function of mLeg1, even if fed continuous high fat content food, it is substantially poor that Mouse Weight growth has no with feeding normal diet Not, the symptom of obesity is not developed.This means the function inhibitio of mLeg1, the obesity caused by excessive diet can be suppressed. The function of mLeg1 is that regulation and control Fatty synthesis are played by EGFR-Akt-Srebp1c signal shafts, it is meant that interference mLeg1, The compound of any one factor function in EGFR, Akt, Srebp1c, is possible as development and suppresses the fertilizer that diet causes Fat medicine.Therefore, suppress the effect of mLeg1-EGFR-Akt-Srebp1c signal shafts, block new fatty synthesis, having can The new tool for the treatment of obesity can be turned into.And Leg1 homologous genes are knocked out in agricultural animal or is lowered by specific compound The expression of Leg1 or activity, it is possible to reduce Fat Accumulation.

Additionally, mLeg1 albumen can promote Fatty synthesis by EGFR-Akt-Srebp1c signal shafts, therefore, mLeg1 Can be used for preparing the medicament for promoting Fatty synthesis, on the one hand for treating the disease that fat lacks, including the fat that chemotherapy causes Fat lacks, and getting fat effect is on the other hand can be used for, including the getting fat for thin and weak crowd, etc. the getting fat of letting animals feed.

In addition, mLeg1 albumen can activate Akt signals by being interacted with EGFR.Meanwhile, glycosuria is pointed out in forefathers' research A pathogenetic important mechanisms are that liver is resisted to insulin signaling so that insulin can not well activate Akt letters Number, so as to the GLUT2 albumen in liver cell endochylema cannot be made to transport to surface of cell membrane, cause blood sugar to be conveyed into liver Changed, final blood-sugar content is too high.And mLeg1 albumen can not pass through cells activated by insulin Akt, it means that mLeg1 eggs White is simultaneously a kind of medicine of potential treatment diabetes.

All guarded in all vertebrates due to mLeg1 (Leg1) albumen and existed, therefore, the Leg1 eggs in these species In vain, comprising the hLeg1 albumen in the mankind, will have similar function.Therefore, Leg1 albumen in these species and on The function of Leg1-EGFR-Akt-Srebp1c signal shafts and application are all within the protection domain of patent of the present invention.

Result of study in sum, Main Conclusions of the invention is as follows：

(1)mLeg1^Δ/ΔMouse body fat content is reduced, and produces resistance to obesity caused by fat feeding high.

(2)mLeg1^Δ/ΔBecause the decrease of Akt activity causes the decrease of Fatty synthesis ability in mouse liver.

(3) mLeg1 can promote the Akt phosphorylation of human liver cancer cell HepG2 and mouse liver.

(4) mLeg1 interacts by with EGFR, activates EGFR, then through EGFR/PI3K signal activation shafts Akt.Work as suppression In EGFR or PI3K signals one of them when, mLeg1 then can no longer activate Akt.

(5) in Mice Body, the exogenous mLeg1 of liver participates in regulation and control liver Akt activity levels.Salivary gland expression MLeg1 is secreted into saliva, and enters blood circulation by alimentary canal, and is eventually arrived at liver and played a role.External gavage Can enter blood within 10 minutes into the mLeg1 albumen in alimentary canal and reach liver, and activation downstream is combined with EGFR Akt signals.

This research had carried out full and accurate research to never reporting the mLeg1 of correlation function.Research points out that mLeg1 albumen is A fat metabolism regulatory factor of naturally occurring in body.It is mainly enriched with table by mLeg1 gene codes in salivary gland Reach, the mLeg1 albumen after transcription and translation can be transported to liver, combined by the EGFR acceptors with liver surface, activate PI3K-Akt-Srebp1c signal paths, the de novo synthesis of fat in regulation and control liver, so as to the fat to whole body Metabolism is regulated and controled.

This research points out that mLeg1 albumen is main and expression is enriched with salivary gland, therefore mLeg1 albumen can be as salivary gland Morphosis and a molecular labeling of medical diagnosis on disease.

This research is pointed out that mLeg1 is main and is expressed by salivary gland, therefore the promoter of mLeg1 can be used for preparing in salivary gland The transgenic animals of specific expressed certain gene outcome, including for etc. the instrument mouse for preparing the specific expressed Cre of salivary gland.

In a word, based on the mLeg1 genes that the present invention was not studied by prior art, with mLeg1 knock out mice It is research object, using science of heredity, molecular biology, biochemistry, the means of cell biology are entered to the function of mLeg1 genes Go and comprehensively study very much, result of study has shown that mLeg1 albumen can regulate and control the signal of internal Akt by EGFR, and then adjusts Fatty synthesis in control body, the result shows that mLeg1 genes and albumen are closely related with Fatty synthesis in body, also enters one It is related to obesity that step shows that the hLeg1 genes or hLeg1 albumen of the mankind can be used for preparation as target gene or target point protein Medicine in, the result of study is the later stage artificial to the constitution after treatment or prevention, the cancer patients undergoing chemotherapy of human obesity Recover or the field such as getting fat, treating diabetes medicament research and development supplied a brand-new drug target and new treatment means and Thinking.

The preferred embodiments of the present invention are the foregoing is only, is not intended to limit the invention, for the skill of this area For art personnel, the present invention can have various modifications and variations.It is all within the spirit and principles in the present invention, made any repair Change, equivalent, improvement etc., should be included within the scope of the present invention.

Sequence table

<110>Zhejiang University

<120>A kind of hLeg1 genes and its application and medicine

<160> 8

<170> PatentIn version 3.5

<210> 1

<212> PRT

<213>Homo sapiens（Homo sapiens）

<400> 1

Met Ala Phe Leu Pro Ser Trp Val Cys Val Leu Val Gly Ser Phe Ser

1 5 10 15

Ala Ser Leu Ala Gly Thr Ser Asn Leu Ser Glu Thr Glu Pro Pro Leu

20 25 30

Trp Lys Glu Ser Pro Gly Gln Leu Ser Asp Tyr Arg Val Glu Asn Ser

35 40 45

Met Tyr Ile Ile Asn Pro Trp Val Tyr Leu Glu Arg Met Gly Met Tyr

50 55 60

Lys Ile Ile Leu Asn Gln Thr Ala Arg Tyr Phe Ala Lys Phe Ala Pro

65 70 75 80

Asp Asn Glu Gln Asn Ile Leu Trp Gly Leu Pro Leu Gln Tyr Gly Trp

85 90 95

Gln Tyr Arg Thr Gly Arg Leu Ala Asp Pro Thr Arg Arg Thr Asn Cys

100 105 110

Gly Tyr Glu Ser Gly Asp His Met Cys Ile Ser Val Asp Ser Trp Trp

115 120 125

Ala Asp Leu Asn Tyr Phe Leu Ser Ser Leu Pro Phe Leu Ala Ala Val

130 135 140

Asp Ser Gly Val Met Gly Ile Ser Ser Asp Gln Val Arg Leu Leu Pro

145 150 155 160

Pro Pro Lys Asn Glu Arg Lys Phe Cys Tyr Asp Val Ser Ser Cys Arg

165 170 175

Ser Ser Phe Pro Glu Thr Met Asn Lys Trp Asn Thr Phe Tyr Gln Tyr

180 185 190

Leu Gln Ser Pro Phe Ser Lys Phe Asp Asp Leu Leu Lys Tyr Leu Trp

195 200 205

Ala Ala His Thr Ser Thr Leu Ala Asp Asn Ile Lys Ser Phe Glu Asp

210 215 220

Arg Tyr Asp Tyr Tyr Ser Lys Ala Glu Ala His Phe Glu Arg Ser Trp

225 230 235 240

Val Leu Ala Val Asp His Leu Ala Ala Val Leu Phe Pro Thr Thr Leu

245 250 255

Ile Arg Ser Tyr Lys Phe Gln Lys Gly Met Pro Pro Arg Ile Leu Leu

260 265 270

Asn Thr Asp Val Ala Pro Phe Ile Ser Asp Phe Thr Ala Phe Gln Asn

275 280 285

Val Val Leu Val Leu Leu Asn Met Leu Asp Asn Val Asp Lys Ser Ile

290 295 300

Gly Tyr Leu Cys Thr Glu Lys Ser Asn Val Tyr Arg Asp His Ser Glu

305 310 315 320

Ser Ser Ser Arg Ser Tyr Gly Asn Asn Ser

325 330

<210> 2

<211> 337

<212> PRT

<213>Mouse（Mus musculus）

<400> 2

Met Ala Val Leu Ala Ser Trp Val Trp Val Leu Ala Gly Cys Phe Cys

1 5 10 15

Ala Ala Val Ala Glu Val Ser Asp Ser Ser Asp Pro Tyr Pro Pro Leu

20 25 30

Trp Glu Asp Ser Pro Glu Gln Leu Ser Asp Tyr Met Met Glu Asp Gly

35 40 45

Asn Tyr Ile Ile Asn Pro Trp Val Tyr Thr Asp Arg Met Gly Met Tyr

50 55 60

Arg Ile Leu Leu Glu Glu Thr Ala Met Tyr Phe Ala Lys Tyr Gly Pro

65 70 75 80

Glu Asn Glu Gln Asn Leu Leu Trp Gly Leu Pro Leu Gln Phe Gly Trp

85 90 95

Gln Tyr Gln Ser Gly Arg Leu Ala Asp Pro Thr Gly Met Thr Asp Cys

100 105 110

Gly Asn Glu Leu Asn Glu Ser Leu Cys Val Ser Val Asp Ser Trp Trp

115 120 125

Ala Asp Ile Asn Tyr Tyr Leu Ser Val Ile Pro Phe Leu Ala Ala Val

130 135 140

Asp Ser Gly Ile Thr Gly Ile Ser Pro Asn Gln Ile Thr Ile Leu Pro

145 150 155 160

Pro Pro Lys Asp Gln Met Arg Phe Cys Tyr Asn Val Ser Asp Cys Gln

165 170 175

Ser Ala Val Pro Gly Thr Met Asn Arg Trp Arg Asp Phe Phe Gln Tyr

180 185 190

Met Gln Leu Asn Ser Ser Asp Phe Asp Gly Leu Leu Asn Tyr Leu Trp

195 200 205

Glu Ala His Ala Ser Ser Leu Asp Tyr Pro Thr Ser Ala Phe Gly Asp

210 215 220

Arg Tyr Asn Phe Tyr Ser Glu Lys Glu Ala Asn Phe Glu Glu Asn Trp

225 230 235 240

Ala Ile Ala Val Asn Tyr Leu Ala Ala Ala Arg Leu Pro Thr Thr Gln

245 250 255

Asn Arg Thr Tyr Ser Phe Gln Arg Gly Leu Pro Pro Arg Val Leu Val

260 265 270

Asp Thr Asp Ile Ala Pro Phe Ile Pro Asp Phe Thr Pro Leu Gln Asn

275 280 285

Glu Val Leu Val Ser Leu Lys Leu Leu Gly Asp Thr Asp Arg Asn Ser

290 295 300

Gly Ser Leu Ser Leu Thr Leu Trp Glu Asn Leu Met Ser Thr Lys Leu

305 310 315 320

Ala Arg Thr Leu Phe Leu Lys Ala Phe Glu Glu Phe Leu Ala Thr Ser

325 330 335

Ser

<210> 3

<211> 49

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 3

atggcttttc ttccttcctg ggtttgtgta ctagttggtt ccttttctgc ttccttagca 60

gggacttcca atctctcaga gacagagccc cctctgtgga aggagagtcc tggtcagctc 120

agtgactaca gggtggagaa cagcatgtac attattaatc cctgggtata ccttgagaga 180

atggggatgt ataaaatcat attgaatcag acagccaggt attttgcaaa atttgcacca 240

gataatgaac agaatatttt atgggggttg cctctgcagt atggctggca atataggaca 300

ggcagattag ctgatccaac ccgaaggaca aactgtggct atgaatctgg agatcatatg 360

tgcatctctg tggacagttg gtgggctgat ttgaattatt ttctgtcttc attacccttt 420

cttgctgcgg ttgattctgg tgtaatgggg atatcatcag accaagtcag gcttttgccc 480

ccacccaaga atgagaggaa gttttgttat gatgtttcta gctgtcgttc atccttccct 540

gagacaatga acaagtggaa caccttttac cagtatttgc agtcaccttt tagtaagttt 600

gatgatctgt tgaagtactt atgggctgca cacacttcaa ccttggcaga taatatcaaa 660

agttttgaag acagatatga ttattattct aaagcagaag cgcattttga gagaagttgg 720

gtactggctg tggatcattt agctgcagtc ctctttccta caaccttgat tagatcatat 780

aagttccaga agggcatgcc accacgaatt cttcttaata ctgatgtagc ccctttcatc 840

agtgacttta ctgcttttca gaatgtagtc ctggttcttc taaatatgct tgacaatgtg 900

gataaatcta taggttatct ttgtacagaa aaatctaatg tatatagaga tcattcggaa 960

tctagctcta gaagttatgg aaataactcc tga 993

<210> 4

<211> 1132

<212> DNA

<213>Mouse（Mus musculus）

<400> 4

atggctgtcc tggcttcctg ggtctgggta ctggctggct gcttctgtgc agctgtagca 60

gaggtttctg atagctcaga tccatatcct cctttatggg aagacagccc tgagcagttg 120

agtgactaca tgatggagga tgggaactac ataattaatc cttgggtata cactgacaga 180

atggggatgt acagaatctt actggaagag acagctatgt attttgcaaa atatggtcca 240

gaaaatgaac aaaatcttct ttggggattg cctctgcagt ttggctggca gtatcaatca 300

ggtagattag ctgatcccac tggaatgaca gactgtggca atgaacttaa tgagagtctg 360

tgtgtctctg tggacagttg gtgggcagat ataaattatt atctgagtgt gatacctttc 420

cttgctgctg ttgattctgg aataacagga atatcaccaa accaaatcac gatcctgcct 480

ccacccaagg atcagatgag gttttgttat aatgtttctg actgtcaatc tgccgtccct 540

ggaacaatga acagatggag agactttttt cagtacatgc agttgaattc cagtgacttt 600

gatggccttc ttaactactt atgggaagcc catgcctcat ccttggacta tcccaccagt 660

gcctttggag acagatataa tttctattct gaaaaagaag caaattttga ggaaaactgg 720

gctattgctg tgaactattt agcggcagcc cgtcttccta caacccaaaa tagaacatac 780

agctttcaga ggggcctgcc cccacgagtc cttgttgata ctgacatagc cccttttatt 840

cctgacttca ctcctcttca gaacgaagtc ctggtatcac tcaaacttct tggtgatact 900

gacagaaatt caggatcatt atctttgact ctatgggaaa atctcatgag tacaaaactt 960

gcaagaacat tatttctaaa agcctttgaa gagttcctgg caacatcttc ttaa 1014

<210> 5

<211> 364

<212> PRT

<213>Zebra fish（Danio rerio）

<400> 5

Met Ser Glu Met Gly Phe Leu Arg Ser Val Ala Ala Val Leu Leu Leu

1 5 10 15

Ala Val Phe Ser His Ala Ala Val Val Thr Glu Asn Gly Leu Pro Ile

20 25 30

Gln Trp Gly Lys Ala Pro Ser Asp Leu Ser His Leu Pro Ile Ser Asp

35 40 45

Thr Gly Val Gln Val Asn Pro Trp Asp Tyr Ser Gln Arg Met Thr Met

50 55 60

Tyr Lys Met Leu Ile Asn Ala Thr Asn Ala Tyr Met Ser Ser Met Gly

65 70 75 80

Pro Gly Glu Gln Glu Asn Pro Leu Trp Ser Leu Pro Leu Gln Leu Gly

85 90 95

Trp Lys Leu Lys Ser Gly Arg Leu Ala Asp Pro Thr Leu Asp Ser Ser

100 105 110

Ser Thr Cys Gly Ser Glu Ala Ser Asp Pro Val Cys Ile Ser Pro Leu

115 120 125

Ser Trp Phe Ala Cys Val Asn Tyr Tyr Leu Ser Val Leu Pro Phe Leu

130 135 140

Ala Ala Val Glu Thr Gly Val Val Ser Ser Gly Gly His Gln Val Leu

145 150 155 160

Ile Gln Val Pro Ala Glu Val Ala Gln Asp Tyr Cys Ser Ser Tyr Ser

165 170 175

Asp Cys Ser Thr Lys His Pro Asn Ala Met Ala Lys Trp His Leu Phe

180 185 190

Phe Gln Ser Leu Arg Gln Val Ser Gln Ser Glu Asp Ser Asp Phe Asn

195 200 205

Lys Lys Asp Ser Ile Leu Gly Leu Met Trp Ala Ala Glu Glu Glu Ser

210 215 220

Leu Gln Thr Ala Ser Gly Ala Cys Thr Glu Arg Gln Lys Leu Tyr Ser

225 230 235 240

Ser Pro Glu Val Ser Phe Gln Gln Ser Trp Leu Asn Ser Ala Ala Phe

245 250 255

Val Ser Ala Ala His Phe His Ala Asn Ile Glu Arg Ser Glu Lys Phe

260 265 270

Met Ala Pro Leu Pro Ser Arg Val Leu Gln Glu Ala Asp Ser Pro Pro

275 280 285

Asn Ile Ala Asp Leu Ser Thr Glu Glu Asn His Thr Leu Tyr Ile Phe

290 295 300

Gly Trp Met Asn Ser Val Asn Gln Leu Leu Gly Gly Ser Leu Val Asn

305 310 315 320

Leu Trp Arg Lys Ala Met Cys Ser Ala Gln Ala Arg Glu Lys Gly Gln

325 330 335

Ala Leu Leu His Asp Leu Ile Leu Asp Pro Lys Phe Pro Gly Ser Ser

340 345 350

Leu Trp Ser Ile Leu Ser Glu Met Ser Thr Ser Cys

355 360

<210> 6

<211> 364

<212> PRT

<213>Zebra fish（Danio rerio）

<400> 6

Met Ser Glu Met Gly Phe Leu Arg Ser Val Ala Ala Val Leu Leu Leu

1 5 10 15

Ala Val Phe Ser His Ala Ala Val Val Thr Glu Asn Gly Leu Pro Ile

20 25 30

Gln Trp Arg Lys Ala Pro Ser Asp Leu Ser His Leu Pro Ile Ser Asn

35 40 45

Thr Gly Val Gln Val Asn Pro Trp Val Tyr Ser Gln Arg Met Thr Met

50 55 60

Leu Lys Met Val Ile Asn Ala Thr Asn Ala Tyr Met Ser Ser Met Gly

65 70 75 80

Pro Gly Glu Gln Glu Asn Pro Leu Trp Ser Leu Pro Leu Gln Leu Gly

85 90 95

Trp Lys Leu Lys Ser Gly Arg Leu Ala Asp Pro Thr Pro Asp Ser Ser

100 105 110

Ser Thr Cys Gly Ser Glu Ala Ser Asp Pro Val Cys Ile Ser Pro Leu

115 120 125

Ser Phe Phe Gly Cys Val Asn Tyr Tyr Leu Ser Val Leu Pro Phe Leu

130 135 140

Ala Ala Val Glu Thr Gly Val Val Ser Ser Gly Gly His Gln Met Leu

145 150 155 160

Ile Gln Val Pro Ala Glu Val Ala Gln Asp Tyr Cys Ser Ser Tyr Ser

165 170 175

Asp Cys Ser Thr Lys His Pro Asn Thr Met Ala Lys Trp His Leu Phe

180 185 190

Phe Gln Ser Leu Arg Gln Val Ser Gln Ser Lys Glu Ser Asp Phe Asn

195 200 205

Lys Lys Asp Ser Ile Leu Gly Leu Met Trp Ala Ala Glu Glu Glu Ser

210 215 220

Ile Gln Thr Ala Ser Gly Ala Cys Thr Glu Arg Gln Lys Leu Tyr Ser

225 230 235 240

Ser Pro Glu Val Ser Phe Gln Gln Ser Ser Val Asn Leu Gly Ala Phe

245 250 255

Ile Ser Ala Ala His Tyr His Ala Ser Ile Glu Arg Ser Gly Lys Phe

260 265 270

Met Ser His Leu Pro Ser Arg Val Leu Gln Glu Ala Asp Ser Pro Pro

275 280 285

Asn Ile Ala Asp Leu Ser Thr Glu Glu Asn His Ala Leu Tyr Met Leu

290 295 300

Ser Trp Met Asn Ser Ile Asn Gln Leu Leu Gly Gly Ser Leu Val Asp

305 310 315 320

Leu Trp Arg Lys Ala Met Cys Ser Ala Gln Ala Arg Glu Lys Gly Gln

325 330 335

Ala Phe Leu Asp Asp Leu Ile Leu Asp Pro Lys Phe Pro Gly Ser Ser

340 345 350

Leu Trp Ser Ile Ile Cys Val Met Ser Thr Ser Cys

355 360

<210> 7

<211> 355

<212> PRT

<213>Sheep（Ovis aries）

<400> 7

Met Trp Ser Ser Leu Val Ile Pro Thr Phe Leu Phe Leu Ser Phe Ser

1 5 10 15

Ser Val Gly Leu Ala Pro Asp Pro Gly Ser Thr Thr His Glu Asn Asp

20 25 30

Asn Tyr Pro Pro Phe Trp Gly Gln Thr Asp Gly Asp Ile Ala Glu Phe

35 40 45

Pro Val Gln Asn Asn Lys Ile Ile Val Asp Pro Trp Lys Tyr Met Asp

50 55 60

Arg Leu Arg Ile Phe Lys Ile Leu Ile Thr Glu Ser Asn Lys Tyr Phe

65 70 75 80

Ala Ser Phe Gly Lys Asn Asp Thr Gly Asn Val Phe Trp Ala Leu Thr

85 90 95

Leu Leu Tyr Gly Ser Leu Phe Lys Ser Asp Arg Phe Ser Glu Pro Pro

100 105 110

Asn Ser Ser Arg Cys Ala Tyr Glu Ser Gly Val Ser Ser Cys Ile Ser

115 120 125

Ile Asn Ser Gly Trp Gly Gly Ile Ser Tyr Tyr Val Val Ile Met Tyr

130 135 140

Phe Leu Ala Ala Ile Glu Ser Glu Phe Leu Gly Asn Leu Pro Tyr Glu

145 150 155 160

Val Glu Leu Leu Ser Arg Lys Glu Tyr Arg Ser Asn Phe Cys Tyr Ser

165 170 175

Val Glu Glu Cys Arg Ala Ala Tyr Pro Gln Ala Met Asp Ile His Asn

180 185 190

Arg Phe Tyr Lys Tyr Leu Gln Ser Arg Lys Ile Val Ser Thr Thr Ser

195 200 205

Gly Ile Pro Gln Tyr Asn Thr Asp Glu Asp Thr Ala Ile Phe Lys Met

210 215 220

Trp Ala Ala His Gln Ala Ala Leu Asp Val Ala Lys Pro Lys Phe Arg

225 230 235 240

Asp Val Ser Phe Tyr Ser Ser Glu Thr Glu Arg Asp Phe Thr Met Asp

245 250 255

Phe Leu Leu Ala Ala Glu Phe Ile Glu Ala Val Leu Tyr Arg Pro Tyr

260 265 270

Phe Glu Ser Ser Ala Glu Phe Leu Ala Gly Phe Pro His Arg Leu Leu

275 280 285

Thr Asp Gln Asp Arg Asn Val Leu Thr Ser Asn Phe Ser Arg Arg Glu

290 295 300

Lys Ala Leu Ile Thr Val Val Lys Leu Ile Thr Lys Ile Asn Lys Ser

305 310 315 320

Thr Gly Gly Leu Leu Leu Thr Ile Trp Lys Lys Leu Met Thr Ser Lys

325 330 335

Phe Ala Arg Ala Met Gly Arg Phe Phe Ile Lys Arg Leu Leu Leu Ile

340 345 350

Pro Val Glu

355

<210> 8

<211> 317

<212> PRT

<213>Ox（Bos taurus）

<400> 8

Pro Pro Phe Trp Asp Gln Ile Asp Gly Asp Ile Ala Glu Phe Pro Val

1 5 10 15

Gln Asn Asn Lys Ile Ile Val Asp Pro Trp Lys Tyr Met Asp Arg Leu

20 25 30

Arg Ile Phe Lys Ile Leu Ile Thr Glu Ser Asn Lys Tyr Phe Ala Ser

35 40 45

Phe Gly Lys Asn Asn Thr Gly Asn Val Phe Trp Ala Leu Thr Leu Leu

50 55 60

Tyr Gly Arg Leu Phe Lys Thr Asp Arg Phe Ala Glu Pro Pro Asn Ser

65 70 75 80

Ser Arg Cys Ala Tyr Glu Ser Gly Ile Ser Ser Cys Ile Ser Ile Asn

85 90 95

Ser Gly Trp Gly Gly Ile Ser Tyr Tyr Val Val Met Met Tyr Phe Leu

100 105 110

Ala Ala Ile Glu Ser Glu Phe Leu Gly Ser Leu Pro Tyr Glu Val Glu

115 120 125

Leu Leu Ser Arg Glu Glu Tyr Arg Ser Asn Phe Cys Tyr Ser Ile Glu

130 135 140

Glu Cys Arg Ala Ala His Pro Gln Ile Met Asp Ile Ala Asn Arg Phe

145 150 155 160

Tyr Lys Gln Thr Lys Lys Ile Val Ser Thr Thr Ser Gly Ile Pro Gln

165 170 175

Tyr Asp Thr Asp Glu Asp Thr Ala Ile Phe Lys Met Trp Ala Ala His

180 185 190

Gln Ala Ala Ile Asp Val Ala Lys Pro Met Phe Ser Asp Val Ser Phe

195 200 205

Tyr Ser Ser Glu Thr Glu Arg Asp Phe Thr Met Asp Phe Leu Leu Ala

210 215 220

Ala Glu Phe Phe Glu Ala Ala Leu Tyr Arg Pro Tyr Phe Glu Ser Ser

225 230 235 240

Ala Glu Phe Leu Val Gly Phe Pro His Arg Leu Leu Thr Asp Gln Asp

245 250 255

Arg Asn Val Leu Met Ser Asn Phe Ser Arg Arg Glu Lys Ala Leu Ile

260 265 270

Thr Val Ala Lys Leu Thr Thr Lys Ile Asn Lys Ser Thr Gly Gly Leu

275 280 285

Leu Leu Thr Ile Trp Lys Lys Leu Met Thr Ser Lys Phe Ala Arg Ala

290 295 300

Thr Gly Arg Phe Phe Ile Lys Arg Leu Leu Leu Ile Pro

305 310 315

Claims (10)

1. a kind of hLeg1 genes, it is characterised in that its coding hLeg1 albumen, the amino acid sequence such as SEQ of the hLeg1 albumen Shown in ID NO.1.

2. hLeg1 genes according to claim 1, it is characterised in that the base sequence of the hLeg1 genes such as SEQ ID Shown in NO.3.

3. the hLeg1 genes described in claim 1 or 2 are being prepared or screened for treating obesity or fat-reducing as target gene Medicine in application, it is characterised in that the medicine is the medicine of the expression for suppressing the hLeg1 genes.

4. the hLeg1 genes described in claim 1 or 2 lack disease preparing or screen as target gene for treating fat Or the application in the medicine of getting fat, it is characterised in that the medicine is the medicine of the expression for strengthening the hLeg1 genes.

5. the hLeg1 genes described in claim 1 or 2 are being prepared or are screening the medicine for treating diabetes as target gene In application, it is characterised in that the medicine be by strengthen the hLeg1 genes expression activate Akt signal paths GLUT2 is set to transport the medicine to surface of cell membrane.

6. the RNAi interference carriers of the hLeg1 genes described in claim 1 or 2 are preparing the medicine for treating obesity or fat-reducing Application in thing, it is characterised in that the expression of hLeg1 genes described in the RNAi interference carriers silence.

7. a kind of medicine for treating obesity or fat-reducing, it is characterised in that the medicine is with described in claim 1 or 2 HLeg1 genes be target spot, suppress the expression of the hLeg1 genes.

8. the medicine for treating obesity or fat-reducing according to claim 7, it is characterised in that the medicine be for The RNAi interference carriers of hLeg1 gene expressions described in silence.

9. it is a kind of for treating the fatty medicine for lacking disease or getting fat, it is characterised in that it is with described in claim 1 or 2 HLeg1 genes are target spot, strengthen the expression of the hLeg1 genes.

10. plasmid vector, bacterium or cell containing the hLeg1 genes described in claim 1 or 2.