CN106883294B

CN106883294B - A kind of hLeg1 albumen and its application and drug

Info

Publication number: CN106883294B
Application number: CN201611229669.3A
Authority: CN
Inventors: 彭金荣; 胡敏杰
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2016-12-27
Filing date: 2016-12-27
Publication date: 2018-08-31
Anticipated expiration: 2036-12-27
Also published as: CN106883294A

Abstract

The present invention provides a kind of hLeg1 albumen and its application and drugs, are related to the function and applied technical field of gene.The present invention is using mLeg1 knock out mice as research object, utilize science of heredity, molecular biology, biochemistry, the means of cell biology have carried out very comprehensive research to the function of mLeg1 genes, result of study shows that mLeg1 albumen can regulate and control the signal of internal Akt by EGFR, and then regulate and control the Fatty synthesis in body, which provides new means and thinking by the expression of human intervention hLeg1 genes and hLeg1 albumen for the later stage to treat the recovery of the constitution after human obesity and cancer patients undergoing chemotherapy.

Description

A kind of hLeg1 albumen and its application and drug

Technical field

The present invention relates to the function of gene and applied technical fields, in particular to a kind of hLeg1 albumen and its application And drug.

Background technology

In the past few years, obesity case increases rapidly in worldwide, has been to lead to human death at present No. five threat.In developed country, obesity has just made first appearance early in the 1980s, and case persistently increases behind Add, only increased speed and slowed down in past 8 years；And in developing country, obese patient is every year at a terrific speed Increasing.Although obesity will not generally directly result in death, complication, especially angiocardiopathy caused by obesity Can be fatal.In 2010, obesity about resulted in the death of 3,400,000 people.In addition, to the obesity patient of continental United States Studies have shown that obesity be likely to reduce future the mankind average life span.According to statistics, in order to treat obesity, the U.S. is poor Seldom 117,000,000,000 dollars are spent every year.Meanwhile it is also more and more to the concern of obesity in world wide.But it is currently, right It is also fewer and also fewer with obesity-related drug target in the achievement in research of the effectively drug for the treatment of obesity.

Invention content

The purpose of the present invention is to provide a kind of hLeg1 albumen, and amino acid sequence is as shown in SEQ ID NO.1.

The present invention also aims to provide above-mentioned hLeg1 albumen preparing or screening for treating as target point protein Application in obesity or the drug of weight-reducing, the drug are the drugs for inhibiting hLeg1 protein levels；Or the drug is to block The drug that hLeg1 albumen is combined with EGFR receptor proteins；Or the drug is the active drug for inhibiting hLeg1 albumen.Wherein, Inhibit hLeg1 protein levels refer to：Inhibit the expression of hLeg1 albumen；Alternatively, the background level of inhibition hLeg1 albumen is HLeg1 albumen degrade to reduce the content of hLeg1 albumen.

The present invention also aims to provide above-mentioned hLeg1 albumen preparing or screening for treating as target point protein Fat lacks the application in the drug of disease or getting fat, which is the drug for enhancing hLeg1 protein levels；Or the drug is The drug for promoting hLeg1 albumen to be combined with EGFR receptor proteins；Or the drug is the active drug for enhancing hLeg1 albumen.

The present invention also aims to provide above-mentioned hLeg1 albumen to lack disease or getting fat for treating fat in preparation Drug in application, the active constituent of the drug is above-mentioned hLeg1 albumen.

The present invention also aims to provide above-mentioned hLeg1 albumen preparing or screening for treating as target point protein Application in the drug of diabetes, the drug are by enhancing hLeg1 protein levels or enhancing hLeg1 protein actives to activate Akt signal paths make GLUT2 transport the drug of cell membrane surface.

The present invention also aims to provide a kind of drug for treating obesity or weight-reducing, which is hLeg1 eggs It is target spot in vain, inhibits the drug of hLeg1 protein levels；Alternatively, the drug is using hLeg1 albumen as target spot, hLeg1 albumen is blocked The drug combined with EGFR receptor proteins；Alternatively, the drug is using hLeg1 albumen as target spot, inhibit the activity of hLeg1 albumen Drug.Wherein, hLeg1 protein levels are inhibited to can be understood as：Inhibit the expression of hLeg1 albumen；Alternatively, inhibiting The background level of hLeg1 albumen degrades hLeg1 albumen to reduce the content of hLeg1 albumen.

The present invention also aims to provide a kind of drug lacking disease or getting fat for treating fat, the work of the drug Property ingredient is above-mentioned hLeg1 albumen；The active constituent of the drug is mLeg1 albumen or the medicine shown in SEQ ID NO.2 The active constituent of object is substitution and/or missing of the sequence shown in SEQ ID NO.2 by one or several amino acid residues And/or add albumen obtain and that there is identical bioactivity with SEQ ID NO.2；Alternatively, the drug is with hLeg1 albumen For target spot, enhance the drug of hLeg1 protein levels；Alternatively, the drug be using hLeg1 albumen as target spot, promote hLeg1 albumen The drug combined with EGFR receptor proteins；Alternatively, the drug is using hLeg1 albumen as target spot, enhance the active of hLeg1 albumen Drug.

The present invention also aims to provide a kind of drug for treating diabetes, the active constituent of the drug is above-mentioned HLeg1 albumen；Alternatively, the active constituent of the drug is the work of mLeg1 albumen or the drug shown in SEQ ID NO.2 Property ingredient is by SEQ ID NO:Sequence shown in 2 is by the substitution of one or several amino acid residues and/or missing and/or adds It is adding and with SEQ ID NO:2 albumen with identical bioactivity；Alternatively, the drug is using hLeg1 albumen as target spot, Enhance hLeg1 protein levels or enhances the activity of hLeg1 albumen to activate Akt signals that GLUT2 albumen is made to transport cell membrane table Face.Wherein, the Leg1 albumen in inhuman source refers to the Leg1 albumen such as SEQ ID from spinal animals body (not including the mankind) Any one in NO.5-8.

The present invention also aims to provide above-mentioned hLeg1 albumen preparing for detecting salivary gland shape as marker Application in the kit of state structure or disease.The result of study of the present invention shows that hLeg1 albumen is mainly special in salivary gland Property expression, be then transported in liver and play a role and function, therefore, using hLeg1 albumen as marker, according to hLeg1 eggs The height of white expression, according to the foundation as diagnosis salivary gland morphosis or disease, to judge knot in the form of salivary gland Whether structure normal or salivary gland relevant disease.

HLeg1 albumen provided by the invention and its advantageous effect of application and drug are：

The hLeg1 albumen of the mankind for the Unknown Function that the present invention was not studied with the prior art is (such as SEQ ID NO.1 institutes Show) and hLeg1 genes (as shown in SEQ ID NO.3) be research object, to study its function, with mLeg1 knock out mice For animal pattern, using science of heredity, molecular biology, biochemistry, the means of cell biology are to mLeg1 albumen (SEQ ID NO.2) and its function of encoding gene mLeg1 genes (as shown in SEQ ID NO.4) has carried out very comprehensive research.Research As a result it shows：MLeg1 albumen can regulate and control the signal of internal Akt by EGFR receptor proteins, and then regulate and control the fat in body Synthesis shows mLeg1 genes and mLeg1 albumen and closely related (the expression water of enhancing mLeg1 genes of Fatty synthesis in body The flat or expression of mLeg1 albumen or the content of mLeg1 albumen, promote Fatty synthesis to accumulate；Inhibit the table of mLeg1 genes Up to the horizontal or expression of mLeg1 albumen or the content of mLeg1 albumen, Fat Accumulation is reduced), further show that the mankind HLeg1 genes (as shown in SEQ ID NO.3) or hLeg1 albumen (as shown in SEQ ID NO.1) target gene can be used as Or target point protein is used to prepare and regulates and controls in relevant drug with Fatty synthesis, such as treatment obesity or the relevant drug of getting fat, The result of study of the present invention is that the constitution after the treatment or prevention of later stage obesity, cancer Chemotherapy in Patients is restored, fat lacks Medicament research and development in the fields such as disease treatment, getting fat, treating diabetes, disease of salivary gland detection has supplied a completely new medicine target Point and new treatment means and thinking.

Description of the drawings

In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this A little attached drawings obtain other relevant attached drawings.

The testing result figure of Fig. 1 embodiment of the present invention 1-5 is (in figure：A is to analyze detection mLeg1 using the Northern markings In the result figure of the expression of the different tissues of wild-type mice；B is to analyze mLeg1 in wild type using the Northern markings The testing result figure of expression in 3 bodies of gland of the salivary gland of mouse；C is to detect mLeg1 albumen using Western Blot The result figure of distribution situation in the different tissues of wild-type mice；D is wild-type mice and mLeg1 gene knockout type mouse The testing result figure of mLeg1 protein contents in saliva)；

Fig. 2 is the mLeg1 gene knockout strategy schematic diagrames of the embodiment of the present invention 4；

Fig. 3 is the detected through gel electrophoresis result figure of invention embodiment 4-5 (in figure：A is using regular-PCR side Method detects mLeg1^Δ/ΔThe Gel electrophoresis results figure that third exon is knocked in mouse；B is to detect mLeg1 using RT-PCR^Δ/ΔThe Gel electrophoresis results figure that third exon is knocked in mouse；C is to detect mLeg1 using Western blot methods Albumen is in mLeg1^Δ/ΔThe result figure of the expression of mouse salivary glands)；

Fig. 4 is the mLeg1 of the embodiment of the present invention 5^Δ/ΔThe sequencing result comparison diagram of the mLeg1 genes of mouse；

Fig. 5 is the mLeg1 of the embodiment of the present invention 6^Δ/ΔThe HE coloration results of the salivary gland of mouse and wild-type mice compare Figure；

Fig. 6 is that the embodiment of the present invention 6 is exempted from using ptyalin and cell junction protein pan-Cadherin progress albumen Epidemic disease fluorescent marker observes mLeg1^Δ/ΔThe comparative result figure of the salivary gland of mouse and wild-type mice；

Fig. 7 is the mLeg1 of the embodiment of the present invention 6^Δ/ΔThe A Xin of the mucus of the salivary gland secretion of mouse and wild-type mice Indigo plant dyeing testing result comparison diagram；

Fig. 8 is the testing result figure of 7-8 of the embodiment of the present invention (in figure：A is mLeg1^Δ/ΔThe blood of mouse and wild-type mice The testing result figure of index；B is mLeg1^Δ/ΔThe glucose sugar of mouse and wild-type mice is resistant to the testing result figure of situation；C is mLeg1^Δ/ΔThe testing result figure of triacylglycerol and cholesterol level in mouse and wild type mouse serum；D is mLeg1^Δ/ΔIt is small The testing result figure of mouse and triacylglycerol and cholesterol level in wild-type mice liver)；

Fig. 9 is the mLeg1 of the embodiment of the present invention 9^Δ/ΔThe fatty size of the different parts of mouse and wild-type mice compares Figure is (in figure：A is mLeg1^Δ/ΔMouse and the intuitive comparison diagram of wild-type mice back fat；B is 1mLeg1^Δ/ΔMouse and wild type The intuitive comparison diagram of mouse back side fat block size；C is mLeg1^Δ/ΔMouse and the intuitive comparison diagram of wild-type mice stomach fat；d For mLeg1^Δ/ΔMouse and the intuitive comparison diagram of wild-type mice abdomen side fat block size)；

Figure 10 is the mLeg1 of the embodiment of the present invention 9^Δ/ΔChanges of weight testing result figure (the figure of mouse and wild-type mice In：A is mLeg1^Δ/ΔThe changes of weight curve graph of mouse and wild-type mice under chow diet and high lipid food rearing conditions； B is mLeg1^Δ/ΔThe intuitive comparison diagram of body size of mouse and wild-type mice after high lipid food raises half a year)；

Figure 11 is the expression testing result figure of the fat synthesis related gene of the embodiment of the present invention 9 (in figure：A is mLeg1^Δ/ΔThe testing result figure of the expression of fatty beta-oxidation related gene in mouse and wild-type mice liver；B is bright mLeg1^Δ/ΔThe testing result figure of the expression of fat synthesis related gene in mouse and wild-type mice liver)；

Figure 12 be the embodiment of the present invention 10 mouse liver in Fatty synthesis approach schematic diagram；

Figure 13 is the mLeg1 of the embodiment of the present invention 11^Δ/ΔRegulate and control turning for Fatty synthesis in mouse and wild-type mice liver Record the testing result figure of the expression of the factor；

Figure 14 is the horizontal testing result figure of Akt phosphorylation of 12-14 of the embodiment of the present invention (in figure：A is mLeg1^Δ/ΔMouse With the testing result figure of the Akt phosphorylation level in wild-type mice liver；B is mLeg1^Δ/ΔMouse and wild-type mice saliva The testing result figure of Akt phosphorylation level in gland；C is through wild type and mLeg1^Δ/ΔThe cell culture of mouse salivary gland cell The protein level of mLeg1 in liquid；D is through mLeg1^Δ/ΔAfter mouse and wild-type mice salivary gland cell culture supernatant culture The testing result figure of the Akt phosphorylation level of HepG2 cells)

Figure 15 is the testing result figure of the Akt phosphorylation level of 15-16 of the embodiment of the present invention (in figure：A be through abdominal cavity or MLeg1 is induced after tail vein injection salivary gland original cuiture supernatant^Δ/ΔThe testing result of the Akt phosphorylation level of mouse liver Figure；B is that the different mLeg1 albumen concentration purified by the salivary gland of wild-type mice activate the Akt phosphorylation of HepG2 cells horizontal Testing result figure)

Figure 16 is the testing result figure of the Akt phosphorylation level of 16-18 of the embodiment of the present invention (in figure：A is to pass through column chromatography The testing result of the Akt phosphorylation level of the mLeg1 protein activation HepG2 cells purified from salivary gland with ion exchange Figure；B is under the action condition of inhibitor LY290004, through mLeg1^Δ/ΔMouse and the primary training of wild-type mice salivary gland cell The testing result figure of the Akt phosphorylation level of HepG2 cells after foster supernatant culture；C is inhibitor LY290004's Under action condition, the mLeg1 protein activation HepG2 cells that are purified from salivary gland by column chromatography and ion exchange The testing result figure of Akt phosphorylation level；D is the tyrosine phosphorylation level of the HepG2 cells after mLeg1 albumen cultures Testing result figure)；

Figure 17 is membrane receptor tyrosine kinase (RTK) selective mechanisms result figure of the embodiment of the present invention 19；

(a is EGFR receptor proteins in mLeg1 protein on cells to the testing result figure that Figure 18 is 19-22 of the embodiment of the present invention Activation level testing result figure；B is the EGFR receptors in mLeg1 protein on cells under inhibitor AG1478 action conditions The testing result figure of the activation level of albumen；C is the phase interaction detected using co-immunoprecipitation method between mLeg1 albumen and EGFR Result figure；D is mLeg1 albumen gavages mLeg1^Δ/ΔAfter mouse, different time points detect between mLeg1 albumen and EGFR The result figure of interaction).

Specific implementation mode

It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, builds according to normal condition or manufacturer The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase Product.

The hLeg1 albumen to the present invention and its application and drug are specifically described below.

It is research model animal that the present inventor, which chooses mouse, to Leg1 genes (liver enriched gene 1, liver is enriched with gene 1, and the albumen which gives expression to is referred to as Leg1 albumen) and homologous base of the Leg1 albumen in mouse Because mLeg1 genes (as shown in SEQ ID NO.4) and mLeg1 albumen (SEQ ID NO.2) carry out correlation function Journal of Sex Research.It discloses The function of mLeg1 genes and its coding expression mLeg1 albumen, also disclosing simultaneously has homology in all vertebrates Leg1 genes and corresponding Leg1 albumen function.

MLeg1 is also referred to as 2310057J18Rik RIKEN cDNA 2310057J18gene (GeneID：67719), it is Leg1 Homologous gene in mouse, functional study in mouse almost blank.Analysis of biological information shows, mLeg1 gene positions In on No. 10 chromosomes, overall length about 14.016kb, including 6 exons and 5 intrones, wherein translation initiation site ATG In on first exon.The albumen (as shown in SEQ ID NO.2) of a length of 337 amino acid of mLeg1 gene codes one, point It contains a targeting signal peptide with 20 amino acid to analysis predictive display, and the sequence of targeting signal peptide is SEQ ID NO.2 institutes The 1-21 amino acids sequences shown show that mLeg1 is a novel secretory protein.

The hLeg1 albumen (its amino acid sequence such as SEQ ID NO.1) of people (Homo sapiens) with it is homologous in mouse Albumen mLeg1 albumen (its amino acid sequence is as shown in SEQ ID NO.2) has 71.2% similitude, therefore, by mouse MLeg1 albumen encoding gene, that is, mLeg1 genes (as shown in SEQ ID NO.4) and the functional study of mLeg1 albumen can For the function and application of hLeg1 genes (coded sequence, that is, CDS sequences are as shown in SEQ ID NO.3) and hLeg1 albumen of the mankind The meaning of guidance and reference is provided, while theoretical foundation is provided for the drug for researching and developing associated fat disease.

Leg1 albumen tool in zebra fish (Danio rerio) is dLeg1a albumen (amino acid sequence respectively there are two copy Row are as shown in SEQ ID NO.5) and dLeg1b albumen (amino acid sequence is as shown in SEQ ID NO.6), the two and mLeg1 albumen It is respectively provided with 47.5% and 48.6% similitude；OLeg1 albumen (the amino acid sequences being present in sheep (Ovis aries) As shown in SEQ ID NO.7), there is 49.1% similitude with mLeg1 albumen；It is present in ox (Bos taurus) BLeg1 albumen (amino acid sequence is as shown in SEQ ID NO.8), with mLeg1 albumen with the 45.7% similitude (present invention The used method of similitude comparison be：It is matched using European Bioinformatics center (ebi) and compares software needle, parameter setting For：Matrix:EBLOSUM62, Gap_penalty:10.0 Extend_penalty:0.5 is compared).

Since Leg1 albumen is to guard existing secretory protein height, their Leg1 albumen in all vertebrates DUF structural domains having the same (such as the 28th -320 the 28th -337 in SEQ ID NO.2, in SEQ ID NO.1 Position, the 29th -362 in SEQ ID NO.5, the 29th -362 in SEQ ID NO.6, the in SEQ ID NO.7 The 1st-317 in 34-354 and SEQ ID NO.8, these amino acid residue sequences all structure in three dimensions At an intimate DUF structural domain), therefore, there is similar function and application foreground between them.Therefore, for institute There are the leg1 albumen of vertebrate and its being all belonged to the scope of protection of the present invention with the relevant application of Fatty synthesis for encoding gene.

It should also be noted that, the sequence shown in SEQ ID NO.1 passes through the substitution of one or several amino acid residues And/or lack and or add and with albumen shown in the derived sequence of SEQ ID NO.1 bioactivity having the same And its application also belongs to protection scope of the present invention.As long as shown in SEQ ID NO.1 on the basis of leg1 albumen, in process The transformation stated makes leg1 albumen DUF structures having the same shown in its improved mutant leg1 and SEQ ID NO.1 Domain makes it have same or analogous bioactivity with leg1 albumen, for the fat of these mutant proteins and its encoding gene Fat synthesizes relevant application and also belongs to protection scope of the present invention.

It should be noted that the vertebrate of present invention meaning includes not only people, mouse, zebra fish, sheep, ox, further include Rabbit, pig, horse, tiger, leopard, wolf, dog, chicken, duck, fish, goose, bear and monkey etc., but it is not limited to animal above-mentioned.

The present invention is by science of heredity, molecular biology, biochemistry, the means of cell biology, in mode biological mouse And Human cell line is research model, and comprehensive and systematic research is carried out to the function of novel secretion albumen mLeg1, it is big by providing Measuring evidence proves that secretory protein mLeg1 is a new signaling molecule, establishes from mLeg1 to EGFR/PI3K, finally activates Akt Signals-modulating network, and prove the network promote mouse body fat synthesis.Simultaneously inventors proved that mLeg1 strikes The mouse energy normal growth removed, the mouse that is more important mLeg1 is knocked out can resist obesity caused by high lipid food.

The feature and performance of the present invention are described in further detail with reference to embodiments.

Experimental animal and raising

Experimental animal：It is the wild-type mice of C57BL/6 to select background；Using Cre-loxP systems, C57BL/6- is selected The Cre tool mouse of Tg (Zp3-cre) 93Knw/Jnju knocks out mLeg1 genes for whole body, and mLeg1 genes are knocked out to obtain whole body Mouse (mLeg1^Δ/ΔKnock-out mice).(mouse of above-mentioned each strain is purchased from Nanjing biological medicine research institute (NRI)).Raising Condition：22 DEG C of temperature, humidity 50%~60%, and give the photoperiod of 12h illumination/12h dark.The normal diet of mouse is upper The rats and mice irradiation of Hai Si Leco Corp. production is bred as material (M02-F), and high lipid food is the size of this Leco Corp. of Shanghai production Mouse experiment material (M04-F) high in fat.

Embodiment 1

Expressions of the 1.Northern engram analysis mLeg1 in different tissues

Using 8 week old male background for C57BL/6 mouse be used as research object, using Northern engram analysis inspection Survey the express spectra of mLeg1 genes.Using the antisense strand of mLeg1 genes as probe, Northern marking analyses are carried out, analyze mLeg1 DNA murine include liver including a series of digestive organs (heart (heart), liver (liver), pancreas (pancreas), Lung (lung), kidney (kidney), stomach (stomach), intestines (gut), salivary gland (SG)) in expression.

The experimental method of Northern engram analysis is as follows.

1.1 RNA are extracted：

1.1.1 the tissue for needing to extract RNA is taken, is ground to without apparent particle with liquid nitrogen, process of lapping maintains liquid nitrogen and deposits It degrades to prevent RNA.

1.1.2 take 50-100mg samples be added 1ml Trizol (Reagent, Life Technologies, Cat.no.15596-026), abundant homogenate is lashed by 26G syringe needles.

1.1.3 it is stored at room temperature 5min.0.2ml chloroforms are added to exert oneself mixing 30 seconds, are stored at room temperature 5min.12000g at 4 DEG C Centrifugation 15min makes each liquid phase separation.

1.1.4 water intaking phase (i.e. top layer's liquid) is added in 0.5ml isopropanols, and 10min is incubated at room temperature after reverse mixing, RNA is set to be precipitated.12000g centrifuges 15min at 4 DEG C, abandons supernatant.

1.1.5 the ethyl alcohol (being configured with DEPC water) of precipitation addition 1ml 75% cleans, and 12000g centrifugations 5min is abandoned at 4 DEG C Supernatant.Repetition is cleaned once with 75% ethyl alcohol, and fully removes supernatant.Add appropriate DEPC water dissolutions after 42 DEG C of drying.Extraction RNA be immediately used to subsequent experimental or be stored in -80 DEG C of refrigerators, use is directly taken out when needing.

It is prepared by 1.2 digoxin (DIG) label probe：

(1) dNTP (10X PCR DIG Labeling Mix, Roche Cat.No.11585550910) marked with DIG Instead of dNTP, DIG is incorporated into the probe for being used as Norhern in double-stranded DNA by PCR reactions.PCR primer is：probeF： GGCTGTCCTGGCTTCCTG；probeR：CTCTCCATCTGTTCATTGTTCC.PCR uses common taq enzyme (reaction systems For：Template 1ul, positive each 0.3ul of anti-primer, the buffer2ul of taq enzymes 0.3ul, 10x, 2.5mM dNTP 1ul, water 15.1ul) (taq enzyme reactions system is similarly hereinafter), response procedures：Step 1：94 DEG C 3 minutes；Step 2：94 DEG C 30 seconds；Step 3：58 DEG C 30 seconds；Step Rapid 4：72 DEG C 30 seconds；Step 5：Repetition from Step 2 to Step 4,33 times；Step 6：72 DEG C 10 minutes.

(2) PCR reaction products are by agarose gel electrophoresis detected magnitude and purity, and by PCR purification kits into Row purifying.Probe after purification is denaturalized 10min in 100 DEG C, and cools down at least 2min on ice at once, with DIG Easy Hyb (Roche Cat.No.11603558001) dilutes probe to 25ng/ml, and is stored in spare in -20 DEG C.

It is prepared by 1.3 RNA denaturant gels：RNA gel electrophoresises carry out in the buffer solution and gel in denaturation.By 10X's The deionized water of MOPS buffer solutions (0.2M MOPS, 50mM NaoAc, 10mM EDTA, pH 7.0) sterilizing is diluted to 1X, and 1.3% agarose powder is added, is fully melted by microwave stove heat, 5.3% is added when being cooled to 50 DEG C or so A concentration of 37% formaldehyde pours into glue mold after mixing, and it is spare to stand cooled and solidified.

The processing of 1.4 RNA samples：Appropriate RNA (RNA sample that i.e. step 1.1 extracts, 10 to 30 μ g) is taken to be added to (contain 10 μ l deionized formamides, 2 μ l 10X 37% formaldehyde of MOPS, 3.5 μ l, 2 μ l RNA loadings in 17.5 μ l RNA denaturants Buffer solution (Gel Loading Buffer II, Life Technologies, Cat.No.AM8546G), 65 DEG C of changes It is placed in 10min on ice at once after property 20min.

1.5 RNA denaturing gel electrophoresis：It takes the RNA of cooled and solidified to be denaturalized glue to be placed in 1X MOPS electrophoretic buffers, be added RNA sample carries out electrophoresis, while RNA molecule Marker (Fermentas Cat.No.SM1821) is added and carries out molecular weight estimation, Electrophoresis is carried out with the voltage of 4-10V/CM, electrophoresis time is determined according to clip size, generally 4~7 hours.

1.6 RNA transferring films：

1.6.1 the gel (RNA glue) that RNA denaturing gel electrophoresis is completed is taken out, is cleaned with the deionized water of sterilizing, juxtaposition It is balanced in the SSC of 10X.Appropriately sized Hybond-N+ films (Amersham Bioscience are cut by glue size Cat.No.RPN303B) and 3MM filter paper (Whatman Cat.No.3030917), equally balanced in 10XSSC.

1.6.2 a clean open porcelain dish container is taken, pours into the SSC buffer solutions of 10X, and an organic glass is taken to be placed on porcelain dish On.It cuts 2 layers of length and is slightly longer than organic glass, width is slightly wider than the 3MM filter paper of RNA glue, infiltrates rear cover in organic with 10X SSC On glass, filter paper longitudinal direction both ends are soaked in the SSC buffer solutions in porcelain dish.RNA glue is tipped upside down on filter paper, then successively in covering Hybond-N⁺Film and two layers of 3MM filter paper and multi-layer absorbent paper, and upper ballast, transferring film are overnight.After the completion of transferring film, film is removed Under UV crosslinking instrument (UVP Ultraviolet Crosslinker Cat.No.CL-1000), 150m j/cm2 energy is handed over Connection.It is then dyed with RNA methylene blue stainings liquid (0.3M NaOAc, pH 5.2,0.03%Methylene Blue), detection RNA transferring films effect and quality.

1.7 probes hybridize and development analysis：

The hybridization and cleaning of DIG probes are washed and closed reagent box (Roche with the DIG of Roche companies Cat.No.11585762001 it) is carried out according to specification.It is specific as follows.

1.7.1 a hybrid pipe is taken, RNA films (being obtained by 1.6.2 steps) are placed in one, appropriate prehybridization solution is added (Roche Cat.No.11603558001), 50 DEG C are closed 2 hours.Period takes the probe of the DIG labels of -20 DEG C of preservations, It is balanced at 50 DEG C after 100 DEG C of denaturation 10min.After closing 2 hours, the probe balanced, 50 DEG C of hybridized overnights are added.

1.7.2 next day, probe is recycled, RNA films clean successively in the following order：2X SSC/0.1%SDS room temperature cleans, often Secondary 10min；65 DEG C of 0.5X SSC/0.1%SDS are cleaned twice, each 15min；65 DEG C of cleanings two of 0.1X SSC/0.1%SDS It is secondary, each 15min；Washing buffer room temperature cleans 10min.10%DIG blocking buffer are added to close 1 hour, connect Change 10%DIG blocking buffer with 1:20000 diluted Anti-Digoxigenin-AP Fab Fragments antibody (Roche Cat.No.11093274910) is incubated at room temperature 2 hours.Washing buffer is cleaned twice, every time 15。

1.7.3 film detection buffer solution is finally balanced into 5min.Film is taken to be sandwiched in plastic foil, and in wherein instilling Ready- To-use CDP-star solution (Roche Cat.No.12041677001) develops the color, in fluorogenic chemiluminescence imager (Clinx Science Instruments Cat.No.3400) it inner is imaged.As a result as shown in (a) in Fig. 1.

Known to (a) in Fig. 1 (in (a) of Fig. 1：SG represents salivary gland, liver represents liver, gut represents enteron aisle, Lung represents lung, heart represents heart, stomach represents stomach, kidney represents kidney, pancrease represents pancreas), mLeg1 Gene is but having very high expression there is no expression is enriched in liver in salivary gland (SG), and in other tissues Substantially the expression of mLeg1 is not detected in (heat, liver, pancreas, lung, kidney, stomach, gut).

The salivary gland of mouse includes mainly three parts：(salivary gland (submandibular gland), sublingual gland (sublingular gland) and the parotid gland (parotid), therefore, using the analysis of the Northern blot markings, (specific method is same Embodiment 1), the present inventor has probed into expression of the mLeg1 genes in this 3 bodies of gland respectively, as a result as in Fig. 1 (b) shown in.

Known to (b) in Fig. 1 (in (b) of Fig. 1：Parotid represents the parotid gland, sub-lingual represents sublingual gland, Sub-maxillary represents salivary gland), mLeg1 genes have apparent expression in this 3 bodies of gland, in parotid gland tissues Expression is higher than salivary gland and sublingual gland.

Embodiment 2

Since homologous protein Leg1 of the mLeg1 albumen in zebra fish is a secretory protein, the above results have shown MLeg1 genes are mainly expressed in salivary gland, but its mLeg1 albumen may also be secreted to transport and be played a role in other tissue. Therefore, the present inventor extracts the total protein of different tissues of mice, and mLeg1 albumen is detected not by Western Blot Distribution situation in same tissue.

MLeg1 albumen distribution situation in different tissues is detected using Western Blot.Experimental method is as follows.

2.1 protein extraction：

Mouse sudden death after, win purpose tissue (SG, liver, gut, blood, lung, heat, stomach, kindney, Pancrease), it is respectively placed in 1.5ml centrifuge tubes, and is freezed in liquid nitrogen rapidly, prevents from degrading.When leach protein, sample is taken out Product are crushed by liquid nitrogen grinding, and sample powder is collected in centrifuge tube, and protein lysate (150mM NaCl, 50mM is added PH7.6Tris-Hcl, 0.1%SDS, 1%Triton X100,1.5% NaTDC, the Complete (EDTA-free) of 1X 100 μ l lysates are added in (Roche Cat.No.11873580001), 100mg samples), it is placed on ice, 26G syringe needles lash number Secondary, 4 DEG C are incubated 15min in vertical shaking table, and 4 DEG C of 12000g centrifuge 15min, take supernatant, and albumen concentration is surveyed by Braford methods.

2.2 protein immunizations draw mark (Western blot)：

2.2.1 it takes 10~20 μ g protein samples of preparation to carry out PAGE gel electrophoresis, passes through half-dried transferring film instrument (TRANSSD SEMI-DRY TRANSFER CELL (Bio-Rad Cat.No.170-390) are by protein delivery in gel Into pvdf membrane (Millipore Cat.No.IPVH00010).Transferring film condition is 20V, and 140mA, the transferring film time is according to albumen size Depending on, between generally 50min to 60min.

2.2.2 it after transferring film, is closed 1 hour with 5% skim milk, adds the destination protein antibody being diluted in milk (determined according to the target protein of detection, the present embodiment be mLeg1 antibody, other embodiments according to the antibody in table 2.4 into Row selection, dilution ratio is depending on antibody, and generally 1:1000, antibody dilutes specific dilution ratio referring also to table 2.4), room Temperature is incubated 1 hour or 4 DEG C and is incubated overnight.

2.2.3 PBST (0.1%Tween 20in PBS) 100~150rpm cleans 5x5min.It is added corresponding 1: 10000 be diluted in milk secondary antibody (horseradish peroxidase-labeled goat anti-mouse IgG (green skies Cat.No.A0216) or Horseradish peroxidase-labeled goat anti-rabbit igg (green skies Cat.No.A0208)), it is incubated at room temperature 1 hour, PBST 100~ 150rpm cleans 5x5min.

2.2.4 chromogenic substrate (Thermo Cat.No.34095) is added in fluorogenic chemiluminescence imager (Clinx Science Instruments Cat.No.3400) it inner is imaged.As a result as shown in (c) in Fig. 1.

Known to (c) in Fig. 1 (in (c) of Fig. 1：SG represents salivary gland, liver represents liver, gut represents enteron aisle, Blood represents serum, lung represents lung, heart represents heart, stomach represents stomach, kidney represents kidney, pancrease generations Table pancreas), consistent with rna expression position, mLeg1 albumen is also primarily present in salivary gland (SG), and other tissues include Liver, enteron aisle, lung, heart, position, kidney, pancreas all do not detect the presence of apparent mLeg1 albumen, meanwhile, in mouse blood There is no there are a large amount of mLeg1, therefore, in mouse, the albumen synthesis and storage of mLeg1 all occur mainly in salivary gland In.

Embodiment 3

Since salivary gland is a secretory body of gland, most important functions are to salivate, and mLeg1 is also a secretion Albumen.Therefore, the present inventor is studied whether mLeg1 can be secreted into saliva.

Using contents of the Western Blot detections mLeg1 in saliva.It is as follows.

3.1 saliva collection：Pilocarpine (Pilocarpine, Sigma) is injected by the amount of 0.5mg/kg in mouse peritoneal, Capillary is placed in the saliva that secretion is collected in murine oral drainage.Pilocarpine is a kind of drug for treating xerostomia, It can promote a large amount of secretions of saliva.(its method obtained is seen below for collection wild-type mice and mLeg1 whole bodies knock-out mice respectively Text) secretion saliva.

3.2 salivas are handled：The saliva of collection, with the Laemmli buffer of the 5x of 1/5 saliva volume (10%SDS, 250mM Tris-HCl, 0.1 ‰ Bromphenol blue, 500mM DTT, 50%Glycerol), 100 DEG C are boiled 5 minutes.

3.3 analyze mLeg1 protein contents in saliva using the Western Blot markings, concrete operations reference implementation example 2 Western Blot detecting steps.As a result as shown in (d) in Fig. 1.

Known to (d) in Fig. 1 (in (d) of Fig. 1：WT is wild-type mice, mLeg1^Δ/ΔIt is struck for mLeg1 gene whole bodies Except type mouse), mLeg1 albumen is largely present in the saliva of wild-type mice really, and the saliva of mLeg1 whole body knock-out mices In and be not present mLeg1 albumen.

Embodiment 4

MLeg1 gene whole body knock-out mices (mLeg1^Δ/Δ) acquisition

In order to obtain mleg whole body knock-out mices, the present inventor selects traditional Cre-loxP systems will be in mouse MLeg1 genes knocked out.The system, which relies primarily on Cre enzymes, can identify loxP sequences, and by two loxP in the same direction Sequence in sequence is deleted, to achieve the purpose that gene knockout.And when Cre enzymes are in specific spatial and temporal expression, you can with MLeg1 is set to be knocked out in specific space-time, Research Challenges caused by avoid embryonic death.Here the present inventor is by loxP Sequence is inserted into the both sides of mLeg1 third exons, while adding between loxP sequences in third exon and behind Enter a NEO gene, for positive resistance screening.By homologous recombination, embryo transfer and genetic screening the present inventor Obtain the mleg that loxP sequences are added in mLeg1 third exons both ends^fl/flStablize the transgenic mice of heredity.

The one other component of Cre-loxP systems is Cre enzymes.It is activated by particular space or specific time when Cre enzymes When promoter driving expression, loxP sequences can be deleted in particular space or time.MLeg1 is obtained based on the principle to strike Except the knockout strategy of mouse is as shown in Figure 2.Here, the present inventor selects the mouse pair of zp3 promoters driving Cre expression MLeg1 carries out whole body knockout.Zp3 is egg vitellary membrane 3 (zona pellucida glycoprotein 3) gene, and the gene is only It is expressed in egg mother cell before initial meiosis.

Therefore, by mLeg1^fl/flMouse (C57BL/6-Tg (Zp3-cre) 93Knw/ of mouse and Zp3 driving Cre expression When JNju) breeding, Zp3-CRE is obtained⁺mLeg1^fl/wtMouse.In the egg mother cell that female rat therein generates, since zp3 starts The activation of son induces the expression of CRE enzymes, to knock out the third exon of mLeg1 genes.By obtained female rat with After the breeding of wild type public affairs mouse, ZP3-CRE is obtained⁺mLeg1^Δ/WTAnd ZP3-CRE^-mLeg1^Δ/WTMouse.ZP3-CRE^-mLeg1^Δ/WTIt is small Mouse selfing can be obtained mLeg1^Δ/ΔAnd mLeg1^WT/WTMouse.mLeg1^Δ/ΔMouse is mLeg1 gene whole body knock-out mices.

Using PCR methods, from mLeg1 obtained above^Δ/ΔAnd mLeg1^WT/WTIn mouse, mLeg1 is identified^Δ/ΔMouse：

It takes mouse and clip toe is for numbering, be collected simultaneously and cut toe alkaline lysis method of extracting genomic DNA.Toward receipts The lysate I (25mM NaOH, EDTA 0.2mM, PH 12) of 75 μ l, 95 DEG C of 30min, cooled on ice are added in the toe of collection.Again It is added in the lysate II (Tris 40mM, PH5) of 75 μ l and closes.Pcr template is fully used as after reaction, in every 20 μ l PCR reactions 4 μ l templates are added to be reacted.Genotype identification primer：Sense primer mLeg1Fwd： CCTTTCTTAATGACACTTCAGTATGT；Downstream primer mLeg1Rv：CACATGCCTATTCACTCTCTCC.PCR is using common Taq enzymes, reaction condition is：1,94 DEG C 3 minutes, 2,94 DEG C 30 seconds, 3,58 DEG C 30 seconds, 4,72 DEG C 30 seconds, 5, repeat 2 to 4 steps 33 times, 6,72 DEG C 10 minutes.PCR product is subjected to gel electrophoresis experiment, wherein wild-type mice generates the item of a 685bp Band, mutant mice generate band (such as Fig. 3 of a 293bp size since third exon and part of intron are deleted In (a) shown in).

The mLeg1 that will be identified^Δ/ΔMouse is raised according to a conventional method, is used for subsequent experimental.

In addition, the result of cross mating is shown：When to mLeg1^Δ/WWhen selfing breeding, mLeg1^Δ/ΔMouse can be normal Birth is presented normal 1:3 Mendelian inheritance ratios.Young rat can growth and development be health into mouse, and mLeg1^Δ/ΔAdult mice Offspring can be normally generated, does not have notable difference with wild type per tire mouse number.

Embodiment 5

mLeg1^Δ/ΔThe verification of mouse

It is knocked really to further verify mLeg1, the present inventor collects be accredited as mLeg1 respectively^Δ/ΔWith mLeg1^WT/WTMouse salivary gland, extract total serum IgE, further synthesize cDNA.Experimental method is as follows.

5.1 extraction total serum IgEs：MLeg1 is extracted respectively^Δ/ΔAnd mLeg1^WT/WTMouse salivary gland total serum IgE, extracting method RNA with 1.1 steps in embodiment 1 is extracted.

5.2 RNA reverse transcriptions are at cDNA：The RNA sample for taking 1 μ g extractions, is added the OligodT of 50 μM of 1 μ l, 1 μ is added L10mM dNTP, with water polishing to 10 μ l.65 DEG C denaturation 5min, at least 1 minute on ice.10 μ l cDNA mixtures (4 μ l are added 5x First Line Buffer, 2 μ l 0.1M DTT, 1 μ l M-MLVRT enzymes, 3 μ l DEPC water).37 DEG C reaction 50min after 70 DEG C of 15min terminate reaction.The cDNA of synthesis is for subsequent experimental or is stored in -20 refrigerators.

5.3 PCR are identified：

With the primer 2 qPCR F282 of the third exon both sides of mLeg1 genes：CCTCTGCAGTTTGGCTGGCAGT With 3 ' ARM rev-1：TCCAAGGATGAGGCATGGGCTTC respectively carries out the cDNA of wild type and mLeg1 knock-out mices PCR.PCR uses common taq enzymes, and reaction condition is:1,94 DEG C 3 minutes, 2,94 DEG C 30 seconds, 3,58 DEG C 30 seconds, 4,72 DEG C 30 Second, 5, repeat 2 to 4 step 33 times, 6,72 DEG C 10 minutes.

Product after 5.4 amplifications carries out gel electrophoresis, as a result as shown in (b) in Fig. 3 (in (b) of Fig. 3：WT is wild Type mouse, mLeg1^Δ/ΔFor mLeg1 gene whole body knockout types mouse), wild-type mice will generate the item of a treaty 377bp sizes Band, and mutant mice will generate the band that a size is 192bp sizes due to the deletion of third exon.It expands simultaneously Sequencing after rear product is purified, sequencing result is as shown in figure 9, through sequence verification, mLeg1^Δ/ΔPCR product third it is outer Aobvious son is really deleted (as shown in Figure 4).

5.5 detect mLeg1 using Western blot^Δ/ΔWith the mLeg1 albumen water in the salivary gland of the mouse of wild type Flat, specific steps can refer to embodiment 2.Shown in (c) in testing result such as Fig. 3.

By (c) in Fig. 3 it is found that mLeg1^Δ/ΔThe salivary gland of mouse does not give expression to mLeg1 albumen really, and wild type Mouse salivary glands give expression to mLeg1 albumen.

Data above absolutely proves that the present inventor obtains mLeg1^Δ/ΔMouse, and after mLeg1 gene knockouts simultaneously The existence and breeding for not influencing the mouse, with this mLeg1^Δ/ΔAnimal pattern of the mouse as the function of research mLeg1 genes, institute Obtained result of study is with a high credibility.

Embodiment 6

The knockout of detection mLeg1 has an impact the structure and function of salivary gland.

MLeg1 is all expressed in three bodies of gland of mouse salivary glands, and salivary gland is the maximum component part of mouse salivary glands, Therefore, for the present inventor using salivary gland as research object, whether the knockout of research mLeg1 genes can be to its structure and function It has an impact.

Whether 6.1 can impact the morphosis of salivary gland using HE decoration methods observation mLeg1 gene knockouts.

6.1.1 preparing submandibular organization's slice：Mouse submandibular gland with 4% paraformaldehyde (Sigma, catalog number (Cat.No.)：P6148, Be dissolved in PBS) fix 1 hour at room temperature after, washed twice with PBS, 10 minutes every time.In a small space, such as 1.5ml In the cap of Eppendorf pipes, (boiled with 30% sucrose PBS solution with about 45 DEG C of 1.5% low melting-point agarose solution of temperature Boil-offization is prepared) cooling fixation.4 DEG C of balances are stayed overnight in 30% sucrose PBS solution later.After balance, these fritters are used O.C.T. compound (Sakura catalog number (Cat.No.)s：4583) it is fixed on the bottom of plastic pattern.The alcohol of -80 DEG C of precoolings is taken to be added dry Ice wherein freezes plastic pattern merging.The sample of frost uses immediately, or is stored in seal box at -80 DEG C.When slice, The sample blocks of frost are fixed on O.C.T. compounds in supporter.In -30 DEG C of slicer (Leica, HM505) before sample sections Lower precooling balances two hours.Sample is cut into the thin slice of 8~12 μ m thicks, and poly relies ammonia coated glass slide (Menzel, mesh Record number：J2800AMNZ it) collects on the thin slice cut, collection sample, which is used or is placed at -80 DEG C at once, to be preserved.

6.1.2 HE is dyed：Taking out the frozen section that has cut, haematoxylin dyeing 5min, flowing water rinses 5min, 1% Acidic alcohol (1%+99% absolute ethyl alcohol of hydrochloric acid) breaks up 5s, and flowing water rinses 10min, eosin stains 5min, and then 80%, 95%, 100% ethyl alcohol once cleans, each 2s, cleans Yihong.It is transparent to be put into dimethylbenzene, Canadian resin mounting, mirror in drop Inspection observation.The results are shown in Figure 5.

As shown in Figure 5, mLeg1^Δ/ΔThe salivary gland HE coloration results of mouse and wild-type mice have no marked difference, the two All comprising the slightly shallow substantive acinar tissue of hollow, the deeper conduit of eosin stains and eosin stains, and they have completely And compact structure, it is meant that the tubular delivery system of salivary gland and development and the shape of salivary secretion unit after mLeg1 knockouts State structure does not make significant difference simultaneously.

Whether 6.2 can make the morphosis of salivary gland using protein immunization fluorescent marker method observation mLeg1 gene knockouts At influence.

In order to further verify whether mLeg1 knockouts can impact the morphosis of salivary gland, invention of the invention Person takes the labelled protein ptyalin (Amylase) and cell junction protein (pan-cadherin) of two salivary gland, into Row immunofluorescence label, influence of the knockout of analysis and research mLeg1 to salivary gland morphosis from cell level.Experimental method It is as follows.

6.2.1 preparing submandibular organization's slice：Method has been prepared with 6.1.1 steps, or directly using step 6.1.1 Histotomy.

6.2.2 it takes the histotomy handled as described above to be permeated with PBST (0.2%triton X100), increases the logical of film Permeability, it is 5min to pass through cell membrane, general processing time convenient for antibody, then uses PBB (0.5%BSA (Sangon Cat.No.A0332) it is dissolved in 1 × PBS) cleaning 10min.

6.2.3 it is closed with the lowlenthal serum of PBB configurations 20%, by 100:It is i.e. anti-that 1 ratio PBB dilutes primary antibody Pan-cadherin antibody (Sigma C1821) is stayed overnight in 4 DEG C of samples of incubation.Under 60rpm, PBB cleans 3x10min.With 1: 400 ratios dilute fluorescence secondary antibody (Goat anti-Mouse IgG (H+L) Secondary Antibody, Alexa with PBB Fluor Plus 647, Thermo, A32728), and DAPI (Beyotime Cat.No.C1002) is added with 1/500 ratio, Incubation at room temperature 1 hour.Under 60rpm, after PBB cleans 3x10min, mounting is carried out with 80% glycerine.

6.2.4 laser confocal microscope (Olympus FV1000) gathered data.The results are shown in Figure 7.

6.2.5 Amylase protein immunizations fluorescent marker, method and step 6.2.1-6.2-4 are essentially identical, difference lies in, In 6.2.3 steps anti-pan-cadherin antibody, fluorescence two are replaced with anti-Amylase antibody (Santa Cruz sc-9890) It is anti-replace with (Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor 488, Thermo, A-11034).The results are shown in Figure 6.

It will be appreciated from fig. 6 that mLeg1 knockouts do not have an impact ptyalin (Amylase) and cell junction protein (pan- Cadherin expression) and distribution, imply mLeg1 knockout really to the institutional framework of salivary gland, cell form and Distribution generates apparent influence.

6.4 couples of mLeg1^Δ/ΔThe salivary gland saliva of mouse generates function and is studied.

One critical function of salivary gland is to generate and salivate, and therefore, the present inventor is also to mLeg1^Δ/Δ The salivary gland saliva of mouse generates function and is studied.The mucus (mucin) that acinar cells secretion generates can be by Ah Xinlan (Alcian Blue) is dyed.Therefore, the present inventor dyes the secretion capacity of assessment salivary gland with Ah Xinlan.Use A Xin It is blue to dye wild type and mLeg1 respectively^Δ/ΔThe salivary gland of mouse is sliced.Method is as follows.

6.4.1 preparing submandibular organization's slice：With step 6.1.1.

6.4.2 Ah Xinlan dyes：Slice distilled water rehydration, later with 3% acetic acid treatment 3 minutes, then Ah Xinlan Dyeing liquor (1% Ah Xinlan, 3% glacial acetic acid, PH 2.5) room temperature dyes 30 minutes, after flowing water rinses 2 minutes, distilled water profit It washes, with Canadian resin mounting microscopy observation after being dehydrated with dimethylbenzene rinse.The results are shown in Figure 7.

By Fig. 7 results shown it is found that wild-type mice and mLeg1^Δ/ΔAcinus between the conduit of mouse all exists non- The Ah Xinlan positive signal (arrow pointed location in Fig. 7) often significantly concentrated, it is meant that salivary gland acinus can be normal Generation and secreting mucus.Therefore, the knockout of mLeg1 genes does not have an impact the salivary ability of salivary gland.

Embodiment 7

7.1 detection mLeg1^Δ/ΔMice plasma fat content.

Since mLeg1 is a secretory protein, and the knockout of mLeg1 seems the development to the salivary gland of mouse and function simultaneously It does not impact, therefore salivary gland may not be the target organ of mLeg1, that is to say, that mLeg1 may transport other device Official functions in turn.In order to which the function to mLeg1 is studied, the present inventor carries out general physical checkup to mouse, grinds Study carefully mLeg1^Δ/ΔWhether mouse will appear some exceptions physiologically.The present inventor extracts the blood of mouse, to serum In every blood index be detected.Experimental method is as follows.

7.1.1 it by after mouse anesthesia, takes blood to be placed into anticoagulant tube by femoral artery, centrifuges 5min in 1000g, take Clearly.

7.1.1 diluted supernatant is passed through into the every blood of automatic biochemistry analyzer (inspection of Dean diagnosis generation) (Olympus) detection Index.Shown in (a) in testing result such as Fig. 8.

Known to (a) in Fig. 8 (in (a) of Fig. 8：The index item of reduction is shown in half frame of braces being located above Mesh, the mLeg1 that half frame of underlying braces is shown^Δ/ΔRaised index subjet in mouse, WT1WT2 are wild type, ZCBA1, ZGA2, ZGA3 are mLeg1^Δ/ΔMouse), mLeg1^Δ/ΔThe content of triacylglycerol substantially reduces in mouse.In addition, 3 kinds Bile acid (T-BIL, DBIL and IBIL) is all reduced, and bile acid is also related with the Absorption And Metabolism of fat, which imply that mLeg1^Δ/ΔThe metabolism of mouse, especially fat metabolism are likely to occur exception.Therefore, the present inventor carries out mouse Screen the whether disorderly Classic Experiments of metabolism：Glucose tolerance test.

7.2 glucose tolerance tests, the specific method is as follows.

7.2.1 mouse overnight starvation makes blood glucose be reduced to floor level before testing, by 1g glucose per kg mouse weights Amount intraperitoneal injection Glucose Liquid (glucose be dissolved in sterilizing PBS in), 0min, 15min, 30min after injection respectively, 60min and 90min detects mouse's blood sugar content.Blood-sugar content is detected by Roche blood glucose meters (ACCU CHEK).As a result such as (b) in Fig. 8 It is shown.

Known to the result shown by (b) in Fig. 8 (in (b) of Fig. 8：Solid line is mLeg1^Δ/ΔMouse, dotted line are wild Type mouse), the wild-type mice of glucose is injected intraperitoneally since glucose is absorbed, blood glucose rose before this, after injection 30min culminates, and in order to maintain the blood glucose balance of body, body that can reduce blood-sugar content by excreting insulin, therefore After injectable dextrose monohydrate 30min, the blood glucose of wild-type mice starts slowly to decline.And the mLeg1 of glucose is injected^Δ/ΔIt is small Mouse, glucose are but absorbed and are entered blood circulation, 10min after injection at faster speed, and blood-sugar content just has reached highest Point, and than the blood glucose peak higher of wild-type mice.On the other hand, mLeg1^Δ/ΔGlucose in the blood of mouse is also with more Fast rate returns to equilibrium state.Therefore, although mLeg1^Δ/ΔThe blood glucose that mouse remains absorbs and regulation and control function, but mLeg1^Δ/ΔThere is exception to a certain degree in the metabolism of mouse.

Embodiment 8

Detect mLeg1^Δ/ΔMouse liver fat content

Liver is maximum organ in the mammalian body, where being the maincenter of organism metabolism, be lipid anabolism and point Solve the important place of metabolism.In addition, needing to transport adipose tissue to by blood circulation when liver synthctic fat, when body is in Starvation, when needing using fat, the fat of fat tissue storage, which needs to transport liver to by blood circulation, to be utilized.It is logical It crosses and the fat content in mice serum is detected to verify the function that mLeg1 knockouts affect liver.

Fat content in 8.1 detection serum.Experimental method is as follows.

8.1.1 10 week old wild types and mLeg1 are taken^Δ/ΔThe serum of mouse, the trigalloyl detected in serum on instrument are sweet Oil and cholesterol level, are repeated 3 times, are as a result indicated with average value.As a result as shown in (c) in Fig. 8.

Known to (c) in Fig. 8 (in (c) of Fig. 8：Grey column is mLeg1^Δ/ΔMouse, white column are that wild type is small Mouse, TRIG represent triacylglycerol, and TCHOL represents cholesterol), mLeg1^Δ/ΔTriacylglycerol is reduced in mouse blood, only wild The half or so of type mouse.

Fat content in 8.2 detection liver organizations.

The above results imply that mLeg1 knocks out the function of affecting liver.Therefore, the present inventor carries out weight to liver Point research, is detected hepatic fat content.As a result as shown in (d) in Fig. 8.

Known to (d) in Fig. 8 (in (d) of Fig. 8：Grey column is mLeg1^Δ/ΔMouse, white column are that wild type is small Mouse, TRIG represent triacylglycerol, and TCHOL represents cholesterol), in liver, triacylglycerol be also significantly reduce, meanwhile, mLeg1^Δ/ΔThe content of cholesterol also significantly decreases in mouse liver.

Embodiment 9

Fatty storage capacity is reduced in mLeg1 knock-out mice adipose tissues.

mLeg1^Δ/ΔThe reduction of fat content promotes the present inventor to remove research fat in mouse blood and liver Whether the fat content in storage place namely adipose tissue is reduced.The adipose tissue of mouse mainly have abdominal adipose tissue and Back fat tissue.

10.1 detect the fat content of the abdominal adipose tissue and back fat tissue of mouse respectively, and experimental method is as follows.

10.1.1 after mouse sudden death, abdomen and back fat are dissected and observed using conventional method.The results are shown in Figure 9.

By the display result of (a) and (b) in Fig. 9 it is found that the mLeg1 of 10 week old^Δ/ΔIn mouse, in back fat tissue Fat content reduce it is particularly evident, and in abdominal adipose tissue fat content also have it is a degree of reduction (in such as Fig. 9 (c) and shown in (d)).Therefore the knockout of mLeg1 reduces the fat storage in Mice Body really.

Growing state of 10.2 mouse under the conditions of feeding high in fat

The above results also further promote the present inventor to guess whether mouse can be to caused by high lipid food feeding Obesity generates resistance.By to different types of mouse constantly feeding high lipid food.Experimental method is as follows.

10.2.1, sufficient normal diet or high lipid food are provided in mouse cage, mouse is allowed to be freely eaten.

10.2.2 point (4,5,6,7,9,10,11,12,13,15,16,17,19,22,24 week old) detects in different times Its weight, is repeated twice, as a result each every group of 3 to 6 mouse are indicated with average value.Using detection time point as abscissa, with body (unit g) is ordinate to weight values, draws the changes of weight curve graph of mouse, shown in (a) in result figure 10.

Known to (a) in Figure 10 (in figure：Chow represents normal diet raising, HFD represents high lipid food raising, mLeg1^Δ/ΔChow represents the mLeg1 using normal diet raising^Δ/Δ、mLeg1^Δ/ΔHFD represents the mLeg1 using high lipid food raising^Δ/Δ, wt chow represent the wild-type mice using normal diet raising, wt HFD are represented using the wild of high lipid food raising Type mouse), when to wild type and mLeg1^Δ/ΔWhen mouse carries out the feeding of normal diet, the weight of two kinds of mouse is all with the age Increase and increases.And when replacing normal diet to carry out feeding with high lipid food, the mouse of wild type is due to obtaining excessive energy It measures and stores these energy in the form of fat, therefore, for the mouse of wild type in the case of feeding high in fat, weight is fast Speed increases, and is eventually developed to as obesity.Meanwhile mutant mice is under feeding high in fat, body weight increase and normal diet Mouse has no significant difference.

In addition, after carrying out feeding six months with high lipid food, wild-type mice build increases, and abdomen and back exist very Thick fat deposit, shows obviously obesity symptom, and mLeg1^Δ/ΔMouse then continues to remain in diet situation The build of lower mouse (shown in (b) in such as Figure 10).These results further confirm that the function of mLeg1 is ceased with fat metabolism really Manner of breathing closes.

Embodiment 10

The decrease of fatty acid synthesis ability power leads to mLeg1^Δ/ΔMouse lipid is reduced

The expression of beta-oxidation relevant enzymes in 10.1 detection livers

On the one hand the reduction of fat content may be that fat consumption increases, on the other hand then may aliphatic acid or triacylglycerol Caused by synthesis is reduced.The catabolism of aliphatic acid is mainly realized in liver by beta-oxidation.Therefore, pass through quantitative fluorescent PCR (qRT-PCR) expression of beta-oxidation relevant enzymes is detected to verify mLeg1^Δ/ΔThe reduction of mouse adipose content is by fat Consumption increases caused by still aliphatic acid or triacylglycerol synthesis reduction.Experimental method is as follows.

10.1.1 qRT-PCR detection wild types and mLeg1 are used^Δ/ΔMouse liver beta-oxidation relative enzyme gene (FBP1/ PCX/ACOX/PEPCK expression), it is with reference to normalizing with β-actin that every group, which takes three independent mouse, gene expression amount, After change, expression quantity is indicated with average value.The detection method of qRT-PCR is following (hereinafter herewith)：

(1) RNA is extracted：Operating method is used with the 1.1RNA extraction steps in embodiment 1, or directly in embodiment 1 The RNA samples that are extracted of 1.1RNA extraction steps be detected.(2) RNA is purified：Due to the total serum IgE of Trizol methods extracting May be containing the pollution of genomic DNA, therefore, the RNA sample for quantitative fluorescent PCR is first removed with dnase digestion may Existing DNA.In 50 μ l reaction systems, the DNaseI (NEB that 2 units are polluted without RNA enzyme are added by every 10 μ g total serum IgEs Cat.No.M0303S), the reaction buffer of 5 μ l 10x is added, with DEPC water polishing to 50 μ l.It is used after 37 DEG C of reaction 20minMini Kit (QIAGEN Cat.NO.74106) carry out RNA purifying.(3) RNA reverse transcriptions：RNA after purification is through upper It is cDNA to state step reverse transcription, and RNA passes through Reverse Transcriptase kit (M-MLV First Strand Kit, Life Technologies, Cat.No.C28025-032) synthesis cDNA.(4) synthesis step is as follows：The RNA sample for taking 1 μ g extractions, adds Enter the OligodT of 50 μM of 1 μ l, 1 μ l 10mM dNTP is added, with water polishing to 10 μ l.65 DEG C denaturation 5min, at least 1 point on ice Clock.10 μ l cDNA mixtures (4 μ l 5x First Line Buffer, 2 μ l 0.1M DTT, 1 μ l M-MLVRT enzymes, 3 μ are added L DEPC water).After 37 DEG C of reaction 50min reaction is terminated in 70 DEG C of 15min.The cDNA of synthesis for subsequent experimental or be stored in- In 20 refrigerators.(5) quantitative fluorescent PCR：Using obtained cDNA quantitative fluorescent PCR is carried out as template.Fluorescent quantitation is reacted according to production Product specification uses SsoFastTM EvaSupermix kits (Bio-Rad Cat.No.172-5201) carry out.Often A reaction is carried out with 10 μ l systems, wherein template containing cDNA 0.5 μ l, Supermix 5 μ l, 10 μM of forward and reverse each 0.5 μ l of primer, 3.5 μ l of distilled water.Forward and reverse primer used in quantitative fluorescent PCR is：Forward primer beta actin Fwd： GTGACGTTGACATCCGTAAAGA；Reverse primer beta actin Rv：GCCGGACTCATCGTACTCC.Fluorescence signal is determined Amount is carried out by CFX96TM Real-Time System (Bio-Rad C1000TM Thermal Cycler).Used in each gene Primer is as shown in table 1.

Shown in (a) of testing result such as Figure 11.

1. embodiment of the present invention of table carries out the primer sequence table used in qRT-PCR

Known to (a) in Figure 11 (in (a) of Figure 11：Ordinate is relative expression levels, and abscissa is relevant β oxygen Change the relative expression levels of enzyme gene), the catabolism of aliphatic acid is mainly realized in liver by beta-oxidation, and wild type is compared And mLeg1^Δ/ΔThe expression of beta-oxidation relevant enzymes in mouse liver finds that the knockout of mLeg1 genes does not cause these The abnormal of gene expression increases, and illustrates that the knockout of mLeg1 there is no the generation for accelerating beta-oxidation, i.e., does not cause fat consumption Increase.mLeg1^Δ/ΔThe fat of mouse, which is reduced, to be synthesized by aliphatic acid or triacylglycerol caused by reduction.

The expression of aliphatic acid synthesis relevant enzymes, experimental method are as follows in 10.2 detection livers.

10.2.1 using the method detection wild type similar with 10.1.1 and mLeg1^Δ/ΔMouse liver aliphatic acid synthesizes phase The expression of enzyme (ACC1/ACC2/FAS/SCD1/ACL/GPAT1/DGAT1/DGAT2) is closed, the primer is as shown in table 1 below.

Shown in (b) in testing result such as Figure 11.

Known to (b) in Figure 11 (in (b) of Figure 11：Ordinate is relative expression levels, and abscissa synthesizes for aliphatic acid Relevant enzyme), by comparing wild type and mLeg1^Δ/ΔIn mouse liver when the express spectra of aliphatic acid synthesis relevant enzymes, this is found The expression of a little enzymes has different degrees of reduction.The expression of the relevant several enzymes of aliphatic acid de novo formation has different degrees of It reduces, essentially the half or so of wild type.Wherein, ACC1, ACC2, FAS and DGAT1 are in mLeg1^Δ/ΔIt is all aobvious in knock-out mice It writes and reduces.

When further observing the effect that these genes play in lipid building-up process, the inventors found that (as shown in figure 12, the catalysis of these gene codes synthesizes a series of enzyme of biochemical reactions from Krebs cycle products to aliphatic acid In figure：What box marked is the gene of differential expression after mLeg1 is knocked out).The expression of these genes (SCD1/FASN/ACC/ACL) It lowers, it is meant that mLeg1^Δ/ΔThe decrease of fatty de novo formation ability, i.e., convert other energy substances in the liver of mouse The aliphatic acid and ability for carrying out fatty storage is obviously reduced.The reduction of synthctic fat in liver, it is attached to explain liver internal blood vessel The reduction of weakly acidic pH fat, explains mLeg1^Δ/ΔWhy triacylglycerol is reduced in mouse blood, also explains mLeg1^Δ/ΔMouse The lipopenic reason of adipose tissue.

Embodiment 11

The expression of the transcription factor of 11.1 detection regulation and control lipid synthetic gene expressions

The transcription factor of regulation and control lipid synthetic gene expression mainly has 4, PPAR γ, chrebp, PGC1 α and srebp1c. Therefore, the present inventor first studies the expression of these transcription factors in liver.Experimental method is as follows.

11.1.1 using the method detection wild type similar with step 11.1.1 and mLeg1^Δ/ΔMouse liver transcription factor The horizontal specific experiment method of (PPAR γ, chrebp, PGC1 α and srebp1c) table can refer to the step 2.1-2.4 in embodiment 2, Relevant primer used is shown in Table 1, and testing result is as shown in figure 13.

As shown in Figure 13 (in figure：Ordinate is relative expression levels, and abscissa is the transcription factor for regulating and controlling Fatty synthesis), Only have the expression of srebp1c in mLeg1 in 4 kinds of transcription factors (PPAR γ, chrebp, PGC1 α and srebp1c)^Δ/ΔMouse Liver It is substantially reduced in dirty, therefore, mLeg1^Δ/ΔThe expression decline of the lipid synzyme of liver is that srebp1c expression reduces institute in mouse It causes.

Embodiment 12

12.1 mLeg1^Δ/ΔThe phosphorylation level of Akt in mouse liver

There are mainly two types of modes for the activity regulation of Srebp1c：One is the Srebp1c not being phosphorylated is generally resided on carefully In cytoplasm, and Akt regulates and controls the phosphorylation of Srebp1c by mTORC1, so that it is from being transferred in cytoplasm in nucleus, And play its transcriptional activity；The second is Akt can with it is a kind of be not especially clear mechanism positive regulation srebp1c transcription water It is flat.Therefore the activity regulation of Srebp1c is mainly to be realized by the activity of Akt.

In the present embodiment, the present inventor detects in lipid synthesis center liver and the salivary gland of mLeg1 expression Akt activity levels.And the activity of Akt can be indicated with its phosphorylation level.It therefore, can be by detecting phosphorylation level come anti- Answer the activity of Akt.Experimental method is as follows.

12.1.1 it presses step 3.1 method and extracts liver, salivary gland albumen uses Akt phosphorylation by Western blot Antibody (Cell signalling#4060P) detects the phosphorylation level of Akt.

Shown in (a) and (b) in testing result such as Figure 14.

Known to (a) and (b) in Figure 14 (in figure：WT represents wild-type mice, mLeg1^Δ/ΔRepresent mLeg1 clpp genes Except mouse), mLeg1^Δ/ΔThe phosphorylation level of Akt in mouse liver is substantially less than wild-type mice (such as (a) institute of Figure 14 Show).And the difference of the Akt phosphorylation in salivary gland is more notable, there are apparent phosphorylation Akt albumen in wild-type mice, And mLeg1^Δ/ΔThe phosphorylation of Akt is substantially not detectable in the salivary gland of mouse (shown in (b) of such as Figure 14).These results are all It proves, mLeg1^Δ/ΔThe activity of mouse Akt is inhibited, and is also given srebp1c and is expressed reduced explanation.

Embodiment 13

The factor that salivary gland cell is secreted into supernatant can induce HepG2 cell Akt phosphorylations

In order to which whether the knockout for verifying mLeg1 is directly related with Akt reduced activities in liver, the present inventor is first Can external experimental system be taken to detect mLeg1 can activate Akt.Since mLeg1 is to enrich expression in mouse salivary glands Secretory protein, if to salivary gland cell carry out original cuiture, can be secreted in cells and supernatant mLeg1.Therefore, the present inventor carries out Western blot to the cell and cells and supernatant of salivary gland original cuiture Detection.Experimental method is as follows.

The original cuiture of 13.1 salivary gland cells：

13.1.1 after mouse breaks neck execution, salivary gland is rapidly removed, the PBS cleanings that sterilizing is used in combination twice, eliminate adherency Hair.The salivary gland removed is shredded with scissors.

13.1.2 the salivary gland shredded is collected into buffer (volume V) with the ratio of 40mg/ml.Per 2ml 25 μ l hyaluronidases (hyaluronidase), 25 μ l Type Ⅱ collagens enzymes (collagenase II) and 250 are added in buffer The CaCl of μ l 50mM₂, 40min is incubated in 37 DEG C.

13.1.3 supernatant is removed in 1500rpm centrifugations, and repeats step 13.1.2.

13.1.4 supernatant is removed in 1500rpm centrifugations, and the buffer of V volumes is used in combination to clean, and supernatant is removed in centrifugation, then with 1/2V's Buffer repeated washings are primary, and supernatant is removed in centrifugation.

13.1.5 the tissue centrifuged with the buffer resuspensions of 1/2V, is used in combination cell filter (Cell Strainer, BD Cat.NO.352340) filtrate is filtered to take with MSG culture solution cultures.

Wherein, solution formula used is as follows：

Buffer：(1%BSA (Amresco Cat.NO.0332) in Hank ' s buffer (Beyotime, Cat.NO.C0218))。

Recombinase formula：With buffer dissolving hyaluronidases (Sangon Biotech, Cat.NO.A002594), concentration For 40mg/ml；With buffer dissolving Type Ⅱ collagen enzymes (GIBCO Cat.NO.17101-015), a concentration of 23mg/ml.Enzyme solutions Fresh configuration is advisable.

MSG culture solutions：DMEM high glucose mediums (GIBCO Cat.NO.11965-092), the penicillin and streptomysin of 1X (Beyotine, Cat.NO.C0222), insulin-transferin-Selenium-X (GIBCO, the Cat.NO.41400- of 1X 045), 1 μM of dexamethasone (Sigma D4902), 10% fetal calf serum (GIBCO Cat.NO.16000-044).

The total protein of salivary gland cell of 13.2 extractions after original cuiture：The culture solution that above-mentioned steps obtain is taken, in 1000g centrifuges 5min, and SDS lysate (63mM Tris-Hcl, PH6.8,10% glycerine, 5% β-sulfydryl second is added after abandoning supernatant Alcohol, the Complete of 3.5%SDS, 1X) it cracks, follow-up Western blot detection and analysis are carried out after 100 DEG C of denaturation 7min or are protected It is stored in -20 DEG C.It (for attached cell, is performed as follows：After going culture supernatant, SDS lysates are added, are scraped with cell scraper It is collected in after attached cell in 1.5ml centrifuge tubes.Follow-up Western blot detection and analysis are carried out after 100 DEG C of denaturation 7min or are protected It is stored in -20 DEG C).

13.3 directly take the cells and supernatant after original cuiture to carry out Western blot detections for follow-up.

Step 3.2 of the method for 13.4 Western blot detections with step embodiment 3.In testing result such as Figure 14 (c) shown in.

Known to (c) in Figure 14 (in (c) of Figure 14：CK media represent the cell culture for not cultivating salivary gland cell Liquid, salivary media represent the cell culture fluid for having cultivated wild type salivary gland cell, and salivary cell represent saliva The cell of gland original cuiture), all there is mLeg1 albumen in cell and cells and supernatant, and pass through the Akt detected in cell MLeg1 in protein content confirmation cells and supernatant is not due to caused by cell contamination.

Embodiment 14

On the experiment basis of embodiment 13, the present inventor is with this culture solution containing mLeg1 (from wild Type salivary gland cell culture supernatant) and without mLeg1 albumen culture solution (come from mLeg1^Δ/ΔIn mouse salivary glands cell culture Go culture human liver cancer cell HepG2, research salivary gland secretion that can directly facilitate the phosphorylation of liver cancer cells Akt clearly), and The ability of this induced activation phosphorylation Akt whether there is difference under the conditions of whether there is or not mLeg1 albumen.Experimental method is as follows.

14.1 human liver cancer cell HepG2 cultures：10% newborn bovine serum (GIBCO is added with DMEM high glycoform culture mediums Cat.NO.16010-159) culture is in 5%CO₂, cultivate in 37 DEG C of constant temperature and the incubator of saturated humidity.When passage, eliminate Culture solution is digested with 0.25% pancreatin (EDTA-free, Sigma Cat.NO.T4549), takes appropriate cell secondary culture in due course Or subsequent experimental.

14.2 with original cuiture wild-type mice salivary gland cell and mLeg1^Δ/ΔMouse salivary glands cells and supernatant is incubated The HepG2 cells of adherent growth are educated, collect cell sample behind 20 minutes and 10 hours respectively.

14.3 by Western blot, with the content of Akt phosphorylation antibody test p-Akt, to react the phosphorylation of Akt It is horizontal.

Shown in (d) in 14.4 results such as Figure 14.

Known to (d) in Figure 14 (in (d) of Figure 14：CK represents mLeg1^Δ/ΔMouse salivary glands cells and supernatant, MLeg1 represents wild-type mice salivary gland cell culture supernatant), whether cultivate HepG2 cells 10 hours or 20 minutes, All it is significantly higher than with the phosphorylation level of the Akt of the HepG2 cells of wild type salivary gland cell supernatant culture and uses mLeg1^Δ/ΔOn The cell cultivated clearly, and mLeg1 can induce the phosphorylation of Akt in short 20 minutes, it was demonstrated that wild-type mice saliva Liquid glandular secretion object can actually promote Akt phosphorylation, and after mLeg1 is knocked out, the ability that salivary gland secretion activates Akt is aobvious It writes and declines, it was demonstrated that the mLeg1 of salivary gland secretion can be direct or indirect carries out Active Regulation to Akt.

Embodiment 15

The factor that salivary gland cell is secreted into supernatant can induce mLeg1^Δ/ΔThe phosphorylation of mouse liver Akt

Above-mentioned experiment in vitro proves that wild type salivary gland cell secretion can promote the phosphorylation of the Akt of liver cancer cells. Further, the present inventor to these secretion the phosphorylation level of internal liver Akt can be regulated and controled into Row research.Experimental method is as follows.

15.1 are respectively adopted intraperitoneal injection and tail vein injection method by wild type and mLeg1^Δ/ΔMouse salivary glands are primary The supernatant of culture cell secretion is injected into mLeg1^Δ/ΔIn mouse.

1 hour sudden death mouse, collects liver, and by Western Blot, use Akt phosphorylation antibody after 15.2 injections Whether the phosphorylation level of Akt changes in detection liver.As a result as shown in (a) in Figure 15.

Known to (a) in Figure 15 (in (a) of Figure 15：WT represents wild-type mice salivary gland cell culture supernatant, mLeg1^Δ/ΔRepresent mLeg1^Δ/ΔMouse salivary glands cells and supernatant, lumbar represent intraperitoneal injection, and vein represents tail vein note Penetrate), whether the salivary gland cell secretion of the wild type of intraperitoneal injection or tail vein injection can promote mLeg1^Δ/ΔMouse The phosphorylation of liver Akt.Result above proves that the salivary gland secretion containing mLeg1 equally can be to the Akt phosphorus in internal liver Acidification is regulated and controled, and is made in addition, the result also implies that salivary gland secretion can be eventually arrived at liver by blood transportation and be played With.

Embodiment 16

From the phosphorylation of the protein induced Akt of mLeg1 of the various concentration of salivary gland purifying gained

Wild type and mLeg1^Δ/ΔMouse salivary gland cell most directly the difference is that can they express mLeg1, then, Wild type and mLeg1^Δ/ΔWhether Akt phosphorylation difference caused by mouse salivary glands cell secreta is to be directly contributed by mLeg1 , i.e., whether mLeg1 albumen can directly induce the phosphorylation of Akt.Method carries out the present inventor through the following experiment Research.

The phosphorylation level of the protein induced Akt of mLeg1 of 16.1 column chromatographic isolation and purifications.Experimental method is as follows.

16.1.1 the salivary gland for taking two to three wild-type mices is placed in the PBS buffer solution of precooling and rinses, used after taking-up Scissors is cut into tiny fragment, is transferred to later in tissue homogenizer.4ml lysates (Tris-Hcl of 50mM, PH is added 8.0,150mM NaCl, the complete of 0.5% NP40,2x), fully homogenate on ice.Taken out repeatedly with 23G syringe needles later it is broken, 4 DEG C of vertical shaking tables are incubated 30min, and 4 DEG C of centrifuge 12000g centrifuge 15min, take supernatant.

16.1.2 by supernatant in 4 DEG C at the uniform velocity by sephalose 6B molecular sieves, wherein elution PBS buffer solution.With 4ml/ pipes collect different elution fractions.

16.1.3 the content of mLeg1 in each component and by Western blot is detected.Take the highest pipe of mLeg1 contents For the mLeg1 of purifying, and it is control with the mLeg1 albumen recombinantly expressed in Escherichia coli, estimates the concentration of mLeg1, and be used for Subsequent experimental.

16.1.4 it (is respectively 3.14x10 the mLeg1 albumen of purifying to be diluted to different concentration^-2ng/μl、0.314ng/μ L and 3.14ng/ μ l) it is separately added into HepG2 medium cultures HepG2,37 DEG C are incubated after twenty minutes, then extract the total egg of cell (extracting method refers to step 13.2), and the phosphorylation level (reference of the Akt under each concentration is detected by Western blot in vain Step 14.3, corresponding antibodies select anti-p-Akt antibody (S473, Cell signalling#4060P), and dilution ratio is when use 1:1000).As a result as shown in (b) in Figure 15.

Known to (b) in Figure 15 (in (b) of Figure 15：A represents 3.14ng/ μ l, B represents 0.314ng/ μ l, C representative 3.14x10^-2Ng/ μ l, "-" representative are not added), mLeg1 albumen can induce the phosphorylation of Akt, and the mLeg1 of nanogram level is It can induce the Akt phosphorylation of HepG2 cells.

16.2 come from wild-type mice and mLeg1^Δ/ΔThe phosphorylation level of the component induction Akt of mouse salivary glands.Experiment Method is as follows.

16.2.1 wild-type mice and mLeg1 are extracted respectively^Δ/ΔMouse salivary glands are rich in the component of mLeg1 albumen.

16.2.2 it is added separately to the 16.2.1 components extracted to cultivate HepG2 in HepG2 culture mediums, 37 DEG C are incubated 20 points Zhong Hou, then (extracting method can refer to step 13.2) to the total protein of the cell after extraction culture.

16.2.3 the phosphorylation level that the Akt under each concentration is detected by Western blot (specifically refers to step 13.2, corresponding antibodies select anti-p-Akt antibody (S473, Cell signalling#4060P), and dilution ratio is 1 when use: 1000).As a result as shown in (a) in Figure 16.

Known to (a) in Figure 16 (in (a) of Figure 16："-" represents mLeg1^Δ/ΔMouse salivary glands total protein, "+" represent Wild-type mice salivary gland total protein), the wild-type mice salivary gland Akt phosphorylation of component induction containing mLeg1 is significantly stronger than mLeg1^Δ/ΔMouse salivary glands respective components.

Embodiment 17

MLeg1 activates Akt to rely on PI3K accesses

It since mLeg1 is a cell secretory protein, and is cultivated with mLeg1 in the experiment of HepG2 cells, mLeg1 is suitable In an extracellular protein, while the phosphorylation of Akt is therefore an intracellular important signal transduction process relates to here And extracellular signal is converted into the process of signal in active cell.The Akt phosphorylation of known extracellular signal induction is made a general survey of, it is main PI3K phosphorylation PIP2 are depended on, and are translated into PIP3, to further induce the phosphorylation of Akt.Therefore, mLeg1 The Akt phosphorylation of induction may be also relied on PI3K accesses.The present inventor selects the specific inhibitor of PI3K LY290004 inhibit PI3K signal paths, and observe PI3K accesses be suppressed after, whether mLeg1 changes Akt activation capabilities Become.Experimental method is as follows.

17.1 processing before, 0.1% serum starved overnight of HepG2 cells, with 0.25% pancreatin (EDTA-free, Sigma Cat.NO.T4549) digestion in due course, take appropriate cell to be placed in centrifuge tube,

17.2 use wild type (containing mLeg1) and mLeg1^Δ/Δ(be free of mLeg1) mouse salivary glands cell primary culture it is upper Clear liquid culture HepG2 cells, and in the culture supernatant of wild type mouse salivary gland cell be added various concentration (it is low to high according to Secondary is 10 μM, 20 μM and 40 μM) PI3K inhibitor LY290004 (cell signaling) inhibit PI3K accesses.

17.3 detect the phosphorylation level of the Akt under each concentration by Western blot, and concrete operations can refer to step 18.2.2.Shown in (b) in testing result such as Figure 16.

17.4, in addition, after step 17.1, HepG2 are cultivated with mLeg1 and 10 μM of the LY290004 that column chromatography is purified Cell, 15min is cultivated in cell incubator, and 1000g centrifugations 5min removes supernatant.SDS lysate lytic cells are added and extract albumen (concrete operations can refer to step 13.2).

17.5 detect the phosphorylation level of the Akt of HepG2 cells by Western blot.In testing result such as Figure 16 (c) shown in.

Known to (b) in Figure 16 (in (b) of Figure 16：It is thin that WT media represent wild-type mice salivary gland original cuiture Born of the same parents' culture supernatant, "-" representative are not added, and A representatives are added a concentration of 10 μM, and B, which is represented, is added a concentration of 10 μM, and it is dense that C represents addition Degree is that 10 Μ m, CK media represent mLeg1^Δ/ΔMouse salivary glands cells and supernatant), the primary training of wild-type mice salivary gland The ability for supporting cells and supernatant (WT media) activation Akt is significantly stronger than mLeg1^Δ/ΔMouse salivary glands cells and supernatant (CK media) can very significantly press down when various concentration PI3K inhibitor LY29004 are added inside WT media The phosphorylation of Akt caused by the salivary gland ingredient of wild-type mice processed.Illustrate, when LY290004 is added, the culture containing mLeg1 Liquid no longer can induce the phosphorylation of Akt, and intracellular Akt phosphorylation is maintained at extremely low level.And the phosphoric acid of PTEN Change the horizontal addition raising there is no with LY290004, it was demonstrated that the inhibition of this Akt phosphorylation level is not due to PTEN It is caused.

Meanwhile known to (c) in Figure 16 (in (c) of Figure 16："-" in upper row represents mLeg1^Δ/ΔMouse salivary glands, "+" represents wild-type mice salivary gland；"-" in lower row, which represents, is added LY29004, and LY29004 is not added for "+" representative), this hair MLeg1 and 10 μM of LY290004 of column chromatography purifying is added in bright inventor in HepG2 culture mediums, finds LY290004 energy Enough complete inductions for inhibiting mLeg1 to Akt phosphorylation.Therefore, the Akt phosphorylation of mLeg1 inductions is logical dependent on PI3K signals Road.

Embodiment 18

MLeg1 activates Akt by RTK

Extracellular signal is transmitted to be needed through cell membrane into the cell, and connects extracellular signal and intracellular PI3K signals A kind of memebrane protein, that is, receptor tyrosine kinase (Receptor tyrosine kinase, RTK).RTK is combined with respective ligand After can autophosphorylation and phosphorylation stream substrates, and this phosphorylation is happened on tyrosine residue, therefore, Ke Yitong Cross the level difference of the intracellular total tyrosine phosphorylation of detection screen mLeg1 inductions Akt phosphorylation whether be by RTK come It realizes.Experimental method is as follows.

18.1 mLeg1 is added into HepG2 cell culture mediums and cultivates HepG2 cells, then extracts total protein of cell.

18.2 check intracellular total tyrosine by tyrosine phosphorylation antibody 4G10 (Millipore, 05-321) The level of phosphorylation.As a result as shown in (d) in Figure 16.

Known to (d) in Figure 16 (in (d) of Figure 16：CK is that mLeg1 is not added), after mLeg1 albumen is added, into the cell Tyrosine phosphorylation level be significantly larger than control group.In addition, Western results also indicate that, the egg of tyrosine phosphorylation occurs White molecular weight is all larger, this is all larger very identical with the molecular weight of RTK.Further imply the phosphoric acid that mLeg1 promotes Akt Change is realized possibly via RTK.

Embodiment 19

MLeg1 activates EGFR

In human genome, a total of 58 gene code RTK, therefore, the present inventor determine that research mLeg1 is Signal is transmitted especially by which RTK is activated, the present inventor has chosen the RTK screening systems of R＆D here.This is System, will be corresponding in cell pyrolysis liquid by these antibody by being crosslinked respectively the antibody of 49 RTK on same film RTK albumen is pulled down and is attached on film.Phosphorylation characteristic can occur on the tyrosine of itself based on RTK activation, can pass through The RTK tyrosine phosphorylation levels of each attachment of tyrosine phosphorylation antibody test, to indicate the activation situation of RTK.Experiment Method is as follows.

The screening of 19.1 receptor tyrosine kinases passes through RTK assay kit (Proteome Profiler Human Phospho-RTK Array Kit, R＆D Cat.no.ARY001B) it is operated according to specification.The kit can detect 58 in total 49 in a RTK, operating procedure handles cell (covering in 10cm culture dishes) respectively in brief, with mLeg1 and control, uses 500 μ l lysis buffer17 lytic cells.RTK screens film after Assay buffer1 are closed 1 hour, applies cell cracking Liquid combines overnight, is washed 3 times, 10 minutes every time, is added with 1X Array Buffer2 with 1 by 1X Wash Buffer：5000 Diluted Anti-Phospho-Tyrosine-HRP Detection Antibody again are incubated at room temperature 2 hours.1X Wash Buffer is washed 3 times, every time after ten minutes, is applied Chemi Reagent Mix developments, is passed through fluorogenic chemiluminescence imager (Clinx Science Instruments Cat.No.3400) is inner to be imaged collecting signal.Shown in result figure 17.

As shown in Figure 17, whether the activity of major part RTK all keeps not by mLeg1 being added being influenced in HepG2 cells In lower level, and only EGFR (as shown in the point that circle is irised out in Figure 17) is after mLeg1 incorporations, tyrosine phosphorylation It dramatically increases, it is meant that mLeg1 is added, and has activated EGFR, one-step activation downstream Akt signals of going forward side by side.

Further, the present inventor detects mLeg1 to intracellular by the phospho-specific antibody of EGFR The influence of the activation level of EGFR is also shown by the result of (a) of Figure 18 (in (a) of Figure 18："-" representative is not added, "+" generation Table is added), the incorporation of mLeg1 can very rapidly activate EGFR receptors, and activate Akt signals later.

Embodiment 20

MLeg1 activates the activation of Akt EGFR dependents

MLeg1 is shown likely via the activation of EGFR by the selection result of the RTK of embodiment 21 to induce the phosphoric acid of Akt Change, it, will be further if inhibiting the phosphorylation of the active Akt that mLeg1 can be blocked to induce of EGFR by the inhibitor of EGFR Confirm that mLeg1 is to activate Akt by EGFR.Here the present inventor chooses the specific inhibitor AG1478 of EGFR To inhibit the activity of EGFR.Experimental method is as follows.

20.1 HepG2 cell culture, specifically refer to step 18.1.

20.2 are separately added into additive (BSA, mLeg1, AG1478) into cell culture fluid, are handled, and cultivate 15 points Zhong Hou, extraction total protein (refer to step 13.2), and carry out Western blot detect in each processing group each albumen (p-Akt, Akt, P-EGFR) it is horizontal (with reference to step 2.2).As a result as shown in (b) in Figure 18.

By (b) in Figure 18 it is found that when the mLeg1 of column chromatography for separation is added in the culture medium of HepG2 cells, can lure Akt phosphorylation is led, and the BSA control groups of bovine serum albumin(BSA) are added, Akt phosphorylation is substantially unaffected.When into culture medium When adding 1 μM of AG1478 inhibition activity of EGFR, the inventors found that the Akt phosphorylation of mLeg1 inductions is blocked. Meanwhile phosphorylation level to EGFR the study found that mLeg1 processing induction of EGFR phosphorylation, and after AG1478 is added, The activation of EGFR is then suppressed.Therefore, activation of the phosphorylation of mLeg1 inductions Akt dependent on the EGFR receptors of cell membrane surface.

Embodiment 21

There are the interactions between albumen and albumen for mLeg1 and EGFR receptors

Above result shows that mLeg1 can activate PI3K signals by EGFR, to induce the phosphorylation of Akt.EGFR It is a receptor protein of cell membrane surface, and mLeg1 is a secretory protein, therefore mLeg1 may be combined directly with EGFR, Downstream signal is directly activated as a signaling molecule.Therefore, the present inventor is then detected by co-immunoprecipitation It whether there is interaction between mLeg1 and EGFR.

Since the above results show that mLeg1 can influence the function of liver, the present inventor is by dividing column chromatography MLeg1 albumen from purifying goes to be incubated the isolated cell of liver homogenate.Since mLeg1 activates the reaction of EGFR very fast Speed, and the EGFR after activating moves towards to degrade quickly, therefore, the present inventor is incubated liver cell with mLeg1 at 4 DEG C, simultaneously The interaction that cross liner DS P stablizes mLeg1 and its potential interaction albumen is added, then mLeg1 is cleaned and is split by NP40 It solves liquid cracking liver cell and carries out co-immunoprecipitation.Experimental method is as follows.

21.1 is antibody linked：Take 30 μ l proteinA/G (beyotime Cat.NO.P2012), low speed (500~ 1000g) supernatant is removed in centrifugation.Antibody (20 μ g antibody are dissolved in 100 μ l PBS of 1X) is added in the PBS cleanings of 4 DEG C of precoolings afterwards twice, It is incubated at room temperature 30min.Supernatant is removed in centrifugation.Clean 3 pearls with 300 μ l PBS, be added 50 μ l DSS solution (5 μ l 10x PBS, 36 μ l H2O, 9 μ l 2.5mM DSS (Thermo, Cat.No.21655) are incubated at room temperature 50 minutes.After supernatant is removed in centrifugation, with 50 μ L 100mM PH2.2 glycine cleans pearl 3 times, and PBS cleanings of the 300 μ l containing 1%NP40 is twice, finally clear with 300 μ l PBS It washes primary.The pearl of cross-linking antibody keeps moistening, and most supernatant is abandoned using preceding centrifugation.

21.2, by column chromatography for separation, obtain the component and mLeg1 containing mLeg1 of wild type salivary gland^Δ/ΔMouse saliva Liquid gland is free of the component of mLeg1.

21.3 are incubated the isolated cell of liver homogenate, 4 DEG C of incubation liver cells with said components respectively, while friendship is added Join the interaction that agent DSP stablizes mLeg1 and its potential interaction albumen.

21.4 co-immunoprecipitations：Tissue or cell by NP40 lysates (Tris-Hcl of 50mM, PH 8.0,150mM's The complete of NaCl, 1% NP40,2Mm EDTA, 1mM PMSF, 2x) fully it is homogenized, 4 DEG C of vertical shaking tables fully crack 15min, 12000g centrifuges 15min at 4 DEG C, takes supernatant for subsequent operation.It is added into supernatant and has been crosslinked the pearl of antibody, 4 DEG C be incubated overnight after.The PBST (0.1%Tween 20) being pre-chilled with 4 DEG C is cleaned 3 times, then is cleaned twice with precooling PBS.It is added 50 The albumen combined on μ l 100mM PH2.2 glycine elution pearls, be added 2 μ l 1M PH9.5 glycine in and PH after in- 20 DEG C of preservations or direct subsequent analysis.

21.5 detect the albumen that mLeg1 antibody pulls down by Western Blot.As a result as shown in (c) in Figure 18.

Known to (c) in Figure 18 (in (c) of Figure 18：Input represents the albumen for co-immunoprecipitation experiment；"-" generation Table is the control group of gavage mLeg1 albumen；"+" represents the experimental group of gavage mLeg albumen；IP:α-mLeg1 represent mLeg1 antibody In conjunction with and pull down mLeg1 albumen and its interaction protein), the EGFR not being added in the liver cell of mLeg1 can not be by mLeg1 Antibody pull down, and after mLeg1 is added, mLeg1 antibody is co-precipitated in component other than containing mLeg1 albumen, also contains EGFR Therefore, between mLeg1 and EGFR albumen is implicitly present in interaction.

Embodiment 22

It is above-mentioned research shows that mLeg1 adjust the active functions of liver Akt by conjunction with and activate EGFR and realize, This needs mLeg1 that can reach liver and be combined with EGFR.The present inventor knows that mLeg1 is expressed in salivary gland, And it is secreted into saliva.Whether the mLeg1 in so this oral cavity can reach liver and phase interaction occurs with the EGFR in liver WithIn order to simulate this case, method is studied through the following experiment.

The mLeg1 of column chromatography purifying is entered mLeg1 by 22.1 by every gram of mouse weight mLeg1 of 50ng from oral cavity gavage^Δ/ΔIn mouse.

Different time points after 22.2 gavages (0,10,20,40,60min) mouse is died suddenly and collects liver specimens, pass through The antibody of mLeg1 mLeg1 albumen that may be present to liver carries out immunoprecipitation experiment, with mLeg1 after detection process^Δ/ΔMouse MLeg1 albumen is with EGFR interactions as a result, specifically referring to step 21.2-21.5.

The mLeg1 that salivary gland secretion is simulated by the above method enters the behavior after alimentary canal.

Based on the above theory, mLeg1 needs play a role in liver, then the liver of mouse ought to exist after gavage MLeg1 albumen.As a result as shown in (d) in Figure 18.

By (d) in Figure 18 it is found that intragastric administration on mice can detect mLeg1 albumen in its liver after ten minutes, and Protein content reaches maximum value after twenty minutes in gavage, the gavage 40 minutes and mLeg1 in liver starts to reduce after sixty minutes.Together When, the present inventor observes gavage after ten minutes, and the EGFR that mLeg1 is combined is most, the EGFR protein contents combined later It is constantly reduced with the continuity of time.This may be caused by mLeg1 and EGFR is quickly combined and transmits downstream signal rapidly： MLeg1 can activate EGFR, EGFR phosphorylation levels within 3 minutes to begin to reduce within 1 minute in experiment in vitro. Meanwhile the present inventor also has checked activation situation of the mLeg1 albumen to downstream Akt of this gavage.After mLeg1 gavages After ten minutes, the Akt phosphorylation in liver just increased, and after this increase gavage 40 minutes to 60 minutes it is more bright It is aobvious.Based on the above results, salivary gland secretion expression mLeg1 can be absorbed by the blood by alimentary canal, and eventually arrive at it is dirty simultaneously EGFR in activation liver finally regulates and controls the physiological function of liver cell to activate Akt.

In conclusion when to the food of normal mouse fed continuous high fat content (10%), the weight of the mouse will Lasting weightening, eventually leads to a series of generation of obesity and obesity syndromes.And when knocking out mLeg1 genes, that is, inhibit When the function of mLeg1, even if fed continuous high fat content food, it is apparent poor that mouse weight growth has no with feeding normal diet Not, fat symptom is not developed.This means that the function inhibitio of mLeg1, can inhibit the obesity caused by excessive diet. The function of mLeg1 is to play regulation and control Fatty synthesis by EGFR-Akt-Srebp1c signal shafts, it is meant that interference mLeg1, Any one in EGFR, Akt, Srebp1c is possible as development and inhibits fertilizer caused by diet because of the compound of subfunction Fat drug.Therefore, the effect for inhibiting mLeg1-EGFR-Akt-Srebp1c signal shafts blocks the synthesis of new fat, and having can The new tool for the treatment of obesity can be become.And Leg1 homologous genes are knocked out in agricultural animal or are lowered by specific compound The expression of Leg1 or activity, it is possible to reduce Fat Accumulation.

In addition, mLeg1 albumen can promote Fatty synthesis, therefore, mLeg1 by EGFR-Akt-Srebp1c signal shafts It can be used for preparing the medicament for promoting Fatty synthesis, be on the one hand used to treat the disease that fat lacks, including fat caused by chemotherapy Fat lacks, on the other hand can be used for getting fat effect, include for thin and weak crowd getting fat, raise animal getting fat etc..

In addition, mLeg1 albumen can activate Akt signals by interacting with EGFR.Meanwhile glycosuria is pointed out in forefathers' research A pathogenetic important mechanisms are that liver resists insulin signaling so that insulin cannot activate Akt to believe well Number, to which the GLUT2 albumen in liver cell endochylema can not be made to transport cell membrane surface, cause blood glucose that can not be conveyed into liver It is converted, final blood-sugar content is excessively high.And mLeg1 albumen can not be by cells activated by insulin Akt, it means that mLeg1 eggs White is a kind of drug of potential treatment diabetes simultaneously.

Exist since mLeg1 (Leg1) albumen is all conservative in all vertebrates, the Leg1 eggs in these species In vain, including hLeg1 albumen in the mankind, will have similar function.Therefore, the Leg1 albumen in these species and about The function of Leg1-EGFR-Akt-Srebp1c signal shafts and application are all within the protection domain of patent of the present invention.

Result of study in summary, Main Conclusions of the invention are as follows：

(1)mLeg1^Δ/ΔMouse body fat content is reduced, and generates resistance to obesity caused by feeding high in fat.

(2)mLeg1^Δ/ΔWeakening since Akt is active in mouse liver leads to the decrease of Fatty synthesis ability.

(3) mLeg1 can promote the Akt phosphorylation of human liver cancer cell HepG2 and mouse liver.

(4) mLeg1 activates EGFR, then through EGFR/PI3K signal activation shafts Akt by interacting with EGFR.Work as inhibition In EGFR or PI3K signals one of them when, mLeg1 then can no longer activate Akt.

(5) in Mice Body, the exogenous mLeg1 of liver participates in regulation and control liver Akt activity levels.Salivary gland expression MLeg1 is secreted into saliva, and enters blood circulation by alimentary canal, and is eventually arrived at liver and played a role.External gavage It can enter blood within ten minutes into the mLeg1 albumen in alimentary canal and reach liver, and be combined activation downstream with EGFR Akt signals.

This research was to never reporting that the mLeg1 of correlation function had carried out full and accurate research.Research points out that mLeg1 albumen is A fat metabolism regulatory factor of naturally occurring in body.It is mainly enriched with table by mLeg1 gene codes in salivary gland It reaches, the mLeg1 albumen after transcription and translation can be transported to liver, be combined by the EGFR receptors with liver surface, activation PI3K-Akt-Srebp1c signal paths regulate and control de novo synthesis fatty in liver, to the fat to entire body Metabolism is regulated and controled.

This research points out that mLeg1 albumen is mainly enriched with expression in salivary gland, therefore mLeg1 albumen can be used as salivary gland Morphosis and a molecular labeling of medical diagnosis on disease.

This research points out that mLeg1 is mainly expressed by salivary gland, therefore the promoter of mLeg1 can be used for preparing in salivary gland The transgenic animals of certain specific expressed gene outcome, including it is used to prepare the tool mouse etc. of the specific expressed Cre of salivary gland.

In short, the present invention is based on the mLeg1 genes that the prior art was not studied, with mLeg1 knock out mice For research object, using science of heredity, molecular biology, biochemistry, the means of cell biology to the functions of mLeg1 genes into It has gone and has comprehensively studied very much, result of study shows that mLeg1 albumen can regulate and control the signal of internal Akt by EGFR, and then adjusts The Fatty synthesis in body is controlled, it should be the result shows that mLeg1 genes and albumen and the Fatty synthesis in body be closely related, also into one It is related to obesity that step shows that the hLeg1 genes of the mankind or hLeg1 albumen can be used as target gene or target point protein to be used to prepare Drug in, the result of study be the later stage artificially to the constitution after the treatment or prevention of human obesity, cancer patients undergoing chemotherapy Restore or the medicament research and development in the fields such as getting fat, treating diabetes supplied a completely new drug target and new treatment means and Thinking.

The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, any made by repair Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.

Sequence table

<110>Zhejiang University

<120>A kind of hLeg1 albumen and its application and drug

<160> 8

<170> PatentIn version 3.5

<210> 1

<212> PRT

<213>Homo sapiens（Homo sapiens）

<400> 1

Met Ala Phe Leu Pro Ser Trp Val Cys Val Leu Val Gly Ser Phe Ser

1 5 10 15

Ala Ser Leu Ala Gly Thr Ser Asn Leu Ser Glu Thr Glu Pro Pro Leu

20 25 30

Trp Lys Glu Ser Pro Gly Gln Leu Ser Asp Tyr Arg Val Glu Asn Ser

35 40 45

Met Tyr Ile Ile Asn Pro Trp Val Tyr Leu Glu Arg Met Gly Met Tyr

50 55 60

Lys Ile Ile Leu Asn Gln Thr Ala Arg Tyr Phe Ala Lys Phe Ala Pro

65 70 75 80

Asp Asn Glu Gln Asn Ile Leu Trp Gly Leu Pro Leu Gln Tyr Gly Trp

85 90 95

Gln Tyr Arg Thr Gly Arg Leu Ala Asp Pro Thr Arg Arg Thr Asn Cys

100 105 110

Gly Tyr Glu Ser Gly Asp His Met Cys Ile Ser Val Asp Ser Trp Trp

115 120 125

Ala Asp Leu Asn Tyr Phe Leu Ser Ser Leu Pro Phe Leu Ala Ala Val

130 135 140

Asp Ser Gly Val Met Gly Ile Ser Ser Asp Gln Val Arg Leu Leu Pro

145 150 155 160

Pro Pro Lys Asn Glu Arg Lys Phe Cys Tyr Asp Val Ser Ser Cys Arg

165 170 175

Ser Ser Phe Pro Glu Thr Met Asn Lys Trp Asn Thr Phe Tyr Gln Tyr

180 185 190

Leu Gln Ser Pro Phe Ser Lys Phe Asp Asp Leu Leu Lys Tyr Leu Trp

195 200 205

Ala Ala His Thr Ser Thr Leu Ala Asp Asn Ile Lys Ser Phe Glu Asp

210 215 220

Arg Tyr Asp Tyr Tyr Ser Lys Ala Glu Ala His Phe Glu Arg Ser Trp

225 230 235 240

Val Leu Ala Val Asp His Leu Ala Ala Val Leu Phe Pro Thr Thr Leu

245 250 255

Ile Arg Ser Tyr Lys Phe Gln Lys Gly Met Pro Pro Arg Ile Leu Leu

260 265 270

Asn Thr Asp Val Ala Pro Phe Ile Ser Asp Phe Thr Ala Phe Gln Asn

275 280 285

Val Val Leu Val Leu Leu Asn Met Leu Asp Asn Val Asp Lys Ser Ile

290 295 300

Gly Tyr Leu Cys Thr Glu Lys Ser Asn Val Tyr Arg Asp His Ser Glu

305 310 315 320

Ser Ser Ser Arg Ser Tyr Gly Asn Asn Ser

325 330

<210> 2

<211> 337

<212> PRT

<213>Mouse（Mus musculus）

<400> 2

Met Ala Val Leu Ala Ser Trp Val Trp Val Leu Ala Gly Cys Phe Cys

1 5 10 15

Ala Ala Val Ala Glu Val Ser Asp Ser Ser Asp Pro Tyr Pro Pro Leu

20 25 30

Trp Glu Asp Ser Pro Glu Gln Leu Ser Asp Tyr Met Met Glu Asp Gly

35 40 45

Asn Tyr Ile Ile Asn Pro Trp Val Tyr Thr Asp Arg Met Gly Met Tyr

50 55 60

Arg Ile Leu Leu Glu Glu Thr Ala Met Tyr Phe Ala Lys Tyr Gly Pro

65 70 75 80

Glu Asn Glu Gln Asn Leu Leu Trp Gly Leu Pro Leu Gln Phe Gly Trp

85 90 95

Gln Tyr Gln Ser Gly Arg Leu Ala Asp Pro Thr Gly Met Thr Asp Cys

100 105 110

Gly Asn Glu Leu Asn Glu Ser Leu Cys Val Ser Val Asp Ser Trp Trp

115 120 125

Ala Asp Ile Asn Tyr Tyr Leu Ser Val Ile Pro Phe Leu Ala Ala Val

130 135 140

Asp Ser Gly Ile Thr Gly Ile Ser Pro Asn Gln Ile Thr Ile Leu Pro

145 150 155 160

Pro Pro Lys Asp Gln Met Arg Phe Cys Tyr Asn Val Ser Asp Cys Gln

165 170 175

Ser Ala Val Pro Gly Thr Met Asn Arg Trp Arg Asp Phe Phe Gln Tyr

180 185 190

Met Gln Leu Asn Ser Ser Asp Phe Asp Gly Leu Leu Asn Tyr Leu Trp

195 200 205

Glu Ala His Ala Ser Ser Leu Asp Tyr Pro Thr Ser Ala Phe Gly Asp

210 215 220

Arg Tyr Asn Phe Tyr Ser Glu Lys Glu Ala Asn Phe Glu Glu Asn Trp

225 230 235 240

Ala Ile Ala Val Asn Tyr Leu Ala Ala Ala Arg Leu Pro Thr Thr Gln

245 250 255

Asn Arg Thr Tyr Ser Phe Gln Arg Gly Leu Pro Pro Arg Val Leu Val

260 265 270

Asp Thr Asp Ile Ala Pro Phe Ile Pro Asp Phe Thr Pro Leu Gln Asn

275 280 285

Glu Val Leu Val Ser Leu Lys Leu Leu Gly Asp Thr Asp Arg Asn Ser

290 295 300

Gly Ser Leu Ser Leu Thr Leu Trp Glu Asn Leu Met Ser Thr Lys Leu

305 310 315 320

Ala Arg Thr Leu Phe Leu Lys Ala Phe Glu Glu Phe Leu Ala Thr Ser

325 330 335

Ser

<210> 3

<211> 49

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 3

atggcttttc ttccttcctg ggtttgtgta ctagttggtt ccttttctgc ttccttagca 60

gggacttcca atctctcaga gacagagccc cctctgtgga aggagagtcc tggtcagctc 120

agtgactaca gggtggagaa cagcatgtac attattaatc cctgggtata ccttgagaga 180

atggggatgt ataaaatcat attgaatcag acagccaggt attttgcaaa atttgcacca 240

gataatgaac agaatatttt atgggggttg cctctgcagt atggctggca atataggaca 300

ggcagattag ctgatccaac ccgaaggaca aactgtggct atgaatctgg agatcatatg 360

tgcatctctg tggacagttg gtgggctgat ttgaattatt ttctgtcttc attacccttt 420

cttgctgcgg ttgattctgg tgtaatgggg atatcatcag accaagtcag gcttttgccc 480

ccacccaaga atgagaggaa gttttgttat gatgtttcta gctgtcgttc atccttccct 540

gagacaatga acaagtggaa caccttttac cagtatttgc agtcaccttt tagtaagttt 600

gatgatctgt tgaagtactt atgggctgca cacacttcaa ccttggcaga taatatcaaa 660

agttttgaag acagatatga ttattattct aaagcagaag cgcattttga gagaagttgg 720

gtactggctg tggatcattt agctgcagtc ctctttccta caaccttgat tagatcatat 780

aagttccaga agggcatgcc accacgaatt cttcttaata ctgatgtagc ccctttcatc 840

agtgacttta ctgcttttca gaatgtagtc ctggttcttc taaatatgct tgacaatgtg 900

gataaatcta taggttatct ttgtacagaa aaatctaatg tatatagaga tcattcggaa 960

tctagctcta gaagttatgg aaataactcc tga 993

<210> 4

<211> 1132

<212> DNA

<213>Mouse（Mus musculus）

<400> 4

atggctgtcc tggcttcctg ggtctgggta ctggctggct gcttctgtgc agctgtagca 60

gaggtttctg atagctcaga tccatatcct cctttatggg aagacagccc tgagcagttg 120

agtgactaca tgatggagga tgggaactac ataattaatc cttgggtata cactgacaga 180

atggggatgt acagaatctt actggaagag acagctatgt attttgcaaa atatggtcca 240

gaaaatgaac aaaatcttct ttggggattg cctctgcagt ttggctggca gtatcaatca 300

ggtagattag ctgatcccac tggaatgaca gactgtggca atgaacttaa tgagagtctg 360

tgtgtctctg tggacagttg gtgggcagat ataaattatt atctgagtgt gatacctttc 420

cttgctgctg ttgattctgg aataacagga atatcaccaa accaaatcac gatcctgcct 480

ccacccaagg atcagatgag gttttgttat aatgtttctg actgtcaatc tgccgtccct 540

ggaacaatga acagatggag agactttttt cagtacatgc agttgaattc cagtgacttt 600

gatggccttc ttaactactt atgggaagcc catgcctcat ccttggacta tcccaccagt 660

gcctttggag acagatataa tttctattct gaaaaagaag caaattttga ggaaaactgg 720

gctattgctg tgaactattt agcggcagcc cgtcttccta caacccaaaa tagaacatac 780

agctttcaga ggggcctgcc cccacgagtc cttgttgata ctgacatagc cccttttatt 840

cctgacttca ctcctcttca gaacgaagtc ctggtatcac tcaaacttct tggtgatact 900

gacagaaatt caggatcatt atctttgact ctatgggaaa atctcatgag tacaaaactt 960

gcaagaacat tatttctaaa agcctttgaa gagttcctgg caacatcttc ttaa 1014

<210> 5

<211> 364

<212> PRT

<213>Zebra fish（Danio rerio）

<400> 5

Met Ser Glu Met Gly Phe Leu Arg Ser Val Ala Ala Val Leu Leu Leu

1 5 10 15

Ala Val Phe Ser His Ala Ala Val Val Thr Glu Asn Gly Leu Pro Ile

20 25 30

Gln Trp Gly Lys Ala Pro Ser Asp Leu Ser His Leu Pro Ile Ser Asp

35 40 45

Thr Gly Val Gln Val Asn Pro Trp Asp Tyr Ser Gln Arg Met Thr Met

50 55 60

Tyr Lys Met Leu Ile Asn Ala Thr Asn Ala Tyr Met Ser Ser Met Gly

65 70 75 80

Pro Gly Glu Gln Glu Asn Pro Leu Trp Ser Leu Pro Leu Gln Leu Gly

85 90 95

Trp Lys Leu Lys Ser Gly Arg Leu Ala Asp Pro Thr Leu Asp Ser Ser

100 105 110

Ser Thr Cys Gly Ser Glu Ala Ser Asp Pro Val Cys Ile Ser Pro Leu

115 120 125

Ser Trp Phe Ala Cys Val Asn Tyr Tyr Leu Ser Val Leu Pro Phe Leu

130 135 140

Ala Ala Val Glu Thr Gly Val Val Ser Ser Gly Gly His Gln Val Leu

145 150 155 160

Ile Gln Val Pro Ala Glu Val Ala Gln Asp Tyr Cys Ser Ser Tyr Ser

165 170 175

Asp Cys Ser Thr Lys His Pro Asn Ala Met Ala Lys Trp His Leu Phe

180 185 190

Phe Gln Ser Leu Arg Gln Val Ser Gln Ser Glu Asp Ser Asp Phe Asn

195 200 205

Lys Lys Asp Ser Ile Leu Gly Leu Met Trp Ala Ala Glu Glu Glu Ser

210 215 220

Leu Gln Thr Ala Ser Gly Ala Cys Thr Glu Arg Gln Lys Leu Tyr Ser

225 230 235 240

Ser Pro Glu Val Ser Phe Gln Gln Ser Trp Leu Asn Ser Ala Ala Phe

245 250 255

Val Ser Ala Ala His Phe His Ala Asn Ile Glu Arg Ser Glu Lys Phe

260 265 270

Met Ala Pro Leu Pro Ser Arg Val Leu Gln Glu Ala Asp Ser Pro Pro

275 280 285

Asn Ile Ala Asp Leu Ser Thr Glu Glu Asn His Thr Leu Tyr Ile Phe

290 295 300

Gly Trp Met Asn Ser Val Asn Gln Leu Leu Gly Gly Ser Leu Val Asn

305 310 315 320

Leu Trp Arg Lys Ala Met Cys Ser Ala Gln Ala Arg Glu Lys Gly Gln

325 330 335

Ala Leu Leu His Asp Leu Ile Leu Asp Pro Lys Phe Pro Gly Ser Ser

340 345 350

Leu Trp Ser Ile Leu Ser Glu Met Ser Thr Ser Cys

355 360

<210> 6

<211> 364

<212> PRT

<213>Zebra fish（Danio rerio）

<400> 6

Met Ser Glu Met Gly Phe Leu Arg Ser Val Ala Ala Val Leu Leu Leu

1 5 10 15

Ala Val Phe Ser His Ala Ala Val Val Thr Glu Asn Gly Leu Pro Ile

20 25 30

Gln Trp Arg Lys Ala Pro Ser Asp Leu Ser His Leu Pro Ile Ser Asn

35 40 45

Thr Gly Val Gln Val Asn Pro Trp Val Tyr Ser Gln Arg Met Thr Met

50 55 60

Leu Lys Met Val Ile Asn Ala Thr Asn Ala Tyr Met Ser Ser Met Gly

65 70 75 80

Pro Gly Glu Gln Glu Asn Pro Leu Trp Ser Leu Pro Leu Gln Leu Gly

85 90 95

Trp Lys Leu Lys Ser Gly Arg Leu Ala Asp Pro Thr Pro Asp Ser Ser

100 105 110

Ser Thr Cys Gly Ser Glu Ala Ser Asp Pro Val Cys Ile Ser Pro Leu

115 120 125

Ser Phe Phe Gly Cys Val Asn Tyr Tyr Leu Ser Val Leu Pro Phe Leu

130 135 140

Ala Ala Val Glu Thr Gly Val Val Ser Ser Gly Gly His Gln Met Leu

145 150 155 160

Ile Gln Val Pro Ala Glu Val Ala Gln Asp Tyr Cys Ser Ser Tyr Ser

165 170 175

Asp Cys Ser Thr Lys His Pro Asn Thr Met Ala Lys Trp His Leu Phe

180 185 190

Phe Gln Ser Leu Arg Gln Val Ser Gln Ser Lys Glu Ser Asp Phe Asn

195 200 205

Lys Lys Asp Ser Ile Leu Gly Leu Met Trp Ala Ala Glu Glu Glu Ser

210 215 220

Ile Gln Thr Ala Ser Gly Ala Cys Thr Glu Arg Gln Lys Leu Tyr Ser

225 230 235 240

Ser Pro Glu Val Ser Phe Gln Gln Ser Ser Val Asn Leu Gly Ala Phe

245 250 255

Ile Ser Ala Ala His Tyr His Ala Ser Ile Glu Arg Ser Gly Lys Phe

260 265 270

Met Ser His Leu Pro Ser Arg Val Leu Gln Glu Ala Asp Ser Pro Pro

275 280 285

Asn Ile Ala Asp Leu Ser Thr Glu Glu Asn His Ala Leu Tyr Met Leu

290 295 300

Ser Trp Met Asn Ser Ile Asn Gln Leu Leu Gly Gly Ser Leu Val Asp

305 310 315 320

Leu Trp Arg Lys Ala Met Cys Ser Ala Gln Ala Arg Glu Lys Gly Gln

325 330 335

Ala Phe Leu Asp Asp Leu Ile Leu Asp Pro Lys Phe Pro Gly Ser Ser

340 345 350

Leu Trp Ser Ile Ile Cys Val Met Ser Thr Ser Cys

355 360

<210> 7

<211> 355

<212> PRT

<213>Sheep（Ovis aries）

<400> 7

Met Trp Ser Ser Leu Val Ile Pro Thr Phe Leu Phe Leu Ser Phe Ser

1 5 10 15

Ser Val Gly Leu Ala Pro Asp Pro Gly Ser Thr Thr His Glu Asn Asp

20 25 30

Asn Tyr Pro Pro Phe Trp Gly Gln Thr Asp Gly Asp Ile Ala Glu Phe

35 40 45

Pro Val Gln Asn Asn Lys Ile Ile Val Asp Pro Trp Lys Tyr Met Asp

50 55 60

Arg Leu Arg Ile Phe Lys Ile Leu Ile Thr Glu Ser Asn Lys Tyr Phe

65 70 75 80

Ala Ser Phe Gly Lys Asn Asp Thr Gly Asn Val Phe Trp Ala Leu Thr

85 90 95

Leu Leu Tyr Gly Ser Leu Phe Lys Ser Asp Arg Phe Ser Glu Pro Pro

100 105 110

Asn Ser Ser Arg Cys Ala Tyr Glu Ser Gly Val Ser Ser Cys Ile Ser

115 120 125

Ile Asn Ser Gly Trp Gly Gly Ile Ser Tyr Tyr Val Val Ile Met Tyr

130 135 140

Phe Leu Ala Ala Ile Glu Ser Glu Phe Leu Gly Asn Leu Pro Tyr Glu

145 150 155 160

Val Glu Leu Leu Ser Arg Lys Glu Tyr Arg Ser Asn Phe Cys Tyr Ser

165 170 175

Val Glu Glu Cys Arg Ala Ala Tyr Pro Gln Ala Met Asp Ile His Asn

180 185 190

Arg Phe Tyr Lys Tyr Leu Gln Ser Arg Lys Ile Val Ser Thr Thr Ser

195 200 205

Gly Ile Pro Gln Tyr Asn Thr Asp Glu Asp Thr Ala Ile Phe Lys Met

210 215 220

Trp Ala Ala His Gln Ala Ala Leu Asp Val Ala Lys Pro Lys Phe Arg

225 230 235 240

Asp Val Ser Phe Tyr Ser Ser Glu Thr Glu Arg Asp Phe Thr Met Asp

245 250 255

Phe Leu Leu Ala Ala Glu Phe Ile Glu Ala Val Leu Tyr Arg Pro Tyr

260 265 270

Phe Glu Ser Ser Ala Glu Phe Leu Ala Gly Phe Pro His Arg Leu Leu

275 280 285

Thr Asp Gln Asp Arg Asn Val Leu Thr Ser Asn Phe Ser Arg Arg Glu

290 295 300

Lys Ala Leu Ile Thr Val Val Lys Leu Ile Thr Lys Ile Asn Lys Ser

305 310 315 320

Thr Gly Gly Leu Leu Leu Thr Ile Trp Lys Lys Leu Met Thr Ser Lys

325 330 335

Phe Ala Arg Ala Met Gly Arg Phe Phe Ile Lys Arg Leu Leu Leu Ile

340 345 350

Pro Val Glu

355

<210> 8

<211> 317

<212> PRT

<213>Ox（Bos taurus）

<400> 8

Pro Pro Phe Trp Asp Gln Ile Asp Gly Asp Ile Ala Glu Phe Pro Val

1 5 10 15

Gln Asn Asn Lys Ile Ile Val Asp Pro Trp Lys Tyr Met Asp Arg Leu

20 25 30

Arg Ile Phe Lys Ile Leu Ile Thr Glu Ser Asn Lys Tyr Phe Ala Ser

35 40 45

Phe Gly Lys Asn Asn Thr Gly Asn Val Phe Trp Ala Leu Thr Leu Leu

50 55 60

Tyr Gly Arg Leu Phe Lys Thr Asp Arg Phe Ala Glu Pro Pro Asn Ser

65 70 75 80

Ser Arg Cys Ala Tyr Glu Ser Gly Ile Ser Ser Cys Ile Ser Ile Asn

85 90 95

Ser Gly Trp Gly Gly Ile Ser Tyr Tyr Val Val Met Met Tyr Phe Leu

100 105 110

Ala Ala Ile Glu Ser Glu Phe Leu Gly Ser Leu Pro Tyr Glu Val Glu

115 120 125

Leu Leu Ser Arg Glu Glu Tyr Arg Ser Asn Phe Cys Tyr Ser Ile Glu

130 135 140

Glu Cys Arg Ala Ala His Pro Gln Ile Met Asp Ile Ala Asn Arg Phe

145 150 155 160

Tyr Lys Gln Thr Lys Lys Ile Val Ser Thr Thr Ser Gly Ile Pro Gln

165 170 175

Tyr Asp Thr Asp Glu Asp Thr Ala Ile Phe Lys Met Trp Ala Ala His

180 185 190

Gln Ala Ala Ile Asp Val Ala Lys Pro Met Phe Ser Asp Val Ser Phe

195 200 205

Tyr Ser Ser Glu Thr Glu Arg Asp Phe Thr Met Asp Phe Leu Leu Ala

210 215 220

Ala Glu Phe Phe Glu Ala Ala Leu Tyr Arg Pro Tyr Phe Glu Ser Ser

225 230 235 240

Ala Glu Phe Leu Val Gly Phe Pro His Arg Leu Leu Thr Asp Gln Asp

245 250 255

Arg Asn Val Leu Met Ser Asn Phe Ser Arg Arg Glu Lys Ala Leu Ile

260 265 270

Thr Val Ala Lys Leu Thr Thr Lys Ile Asn Lys Ser Thr Gly Gly Leu

275 280 285

Leu Leu Thr Ile Trp Lys Lys Leu Met Thr Ser Lys Phe Ala Arg Ala

290 295 300

Thr Gly Arg Phe Phe Ile Lys Arg Leu Leu Leu Ile Pro

305 310 315

Claims

1.hLeg1 albumen is being prepared for treating the application during fat lacks the drug of disease or getting fat, which is characterized in that described The active constituent of drug is the hLeg1 albumen, and the amino acid sequence of the hLeg1 albumen is as shown in SEQ ID NO.1.

2. a kind of for treating the drug of obesity or weight-reducing, which is characterized in that the drug be using hLeg1 albumen as target spot, Inhibit the drug of the hLeg1 protein levels, wherein the amino acid sequence of the hLeg1 albumen as shown in SEQ ID NO.1, Wherein, inhibition hLeg1 protein levels refer to：Inhibit the expression of hLeg1 albumen；Alternatively, inhibiting the background water of hLeg1 albumen Flat i.e. degradation hLeg1 albumen is to reduce the content of hLeg1 albumen；

Alternatively, the drug is using the hLeg1 albumen as target spot, the hLeg1 albumen is blocked to be combined with EGFR receptor proteins Drug；

Alternatively, the drug is using the hLeg1 albumen as target spot, inhibit the active drug of the hLeg1 albumen.

3. a kind of lacking the drug of disease or getting fat for treating fat, which is characterized in that the active constituent of the drug is HLeg1 albumen, wherein the amino acid sequence of the hLeg1 albumen is as shown in SEQ ID NO.1；

Alternatively, the active constituent of the drug is mLeg1 albumen shown in SEQ ID NO.2.

4. a kind of drug for treating diabetes, which is characterized in that its active constituent is hLeg1 albumen, wherein described The amino acid sequence of hLeg1 albumen is as shown in SEQ ID NO.1 alternatively, the active constituent of the drug is SEQ ID NO.2 institutes The mLeg1 albumen shown.