CN106928348B

CN106928348B - Fully human monoclonal antibody for regulating and controlling human innate immunity and preparation method and application thereof

Info

Publication number: CN106928348B
Application number: CN201710128502.6A
Authority: CN
Inventors: 张凤民; 翟爱霞; 宋武琦; 考文萍; 吴静; 郭彩玲; 卜桐
Original assignee: Harbin Medical University
Current assignee: Harbin Medical University
Priority date: 2017-03-06
Filing date: 2017-03-06
Publication date: 2020-08-21
Anticipated expiration: 2037-03-06
Also published as: CN106928348A

Abstract

The invention discloses a fully human monoclonal antibody for regulating and controlling human innate immunity, a preparation method and application thereof. The invention also discloses a complete gene and an amino acid sequence for coding the antibody. The invention screens monoclonal antibody for regulating and controlling human body inherent immunity from fully human antibody hybridoma cell bank, collects cell culture supernatant through large-scale culture, and obtains the monoclonal antibody through affinity column purification. The antibody cDNA sequence is obtained by sequencing the antibody gene, and is cloned into a eukaryotic expression vector, and the antibody is obtained by large-scale culture through a human cell expression system and purification through an affinity column. Research shows that the fully human monoclonal antibody can regulate and control human body innate immunity, activate an I-type IFN signal system and inhibit virus proliferation, so that the fully human monoclonal antibody can be used for preventing and treating infectious diseases, tumors and immune system diseases.

Description

Fully human monoclonal antibody for regulating and controlling human innate immunity and preparation method and application thereof

Technical Field

The invention relates to a fully human monoclonal antibody, a preparation method and application thereof, in particular to a fully human monoclonal antibody for regulating and controlling human innate immunity, a preparation method and application thereof in regulating and controlling human innate immunity, belonging to the technical field of medicines.

Background

Monoclonal antibodies (monoclonal antibodies) are the most important biotechnological products after vaccines and recombinant proteins, have definite action sites and high affinity with target sites, and have been successfully applied to treatment of tumors, autoimmune diseases, infectious diseases, transplant rejection and the like. Monoclonal antibody technology has evolved over 40 years, through four stages of murine (murine), chimeric (chimeric), humanized (humanize) and fully human (full human) (fig. 1). The mouse-derived monoclonal antibody is secreted by mouse hybridoma cells, has very strong immunogenicity, can induce to generate human anti-mouse antibody, and has obvious toxic and side effects; the chimeric monoclonal antibody is obtained by reserving a Fab section of a mouse-derived monoclonal antibody, and an Fc section is humanized; humanized antibodies refer to antibodies in which the constant region portions (i.e., the CH and CL regions) are encoded by human antibody genes; fully human monoclonal antibodies refer to monoclonal antibodies all encoded by human antibody genes. The fully human monoclonal antibody has small adverse reaction, long half life and good curative effect, and is the direction of future research and development. The fully human monoclonal antibody has strong targeting property, high specificity and low toxic and side effects, and is effectively popularized in the fields of disease mechanism research, disease diagnosis and treatment.

The human monoclonal antibody Tanibirumab has the function of resisting vascular endothelial growth factor (vascular endothelial growth factor) 2 by intravitreal injection, and can partially inhibit laser-induced choroidal neovascularization of a rat model. Placental cadherin (P-cadherin) mediates adhesion, proliferation and invasion of tumor cells, and the fully human anti-P-cadherin antibody PF-03732010 inhibits growth and metastasis of primary tumors by interfering with the P-cadherin signaling pathway.

Innate immunity is the first line of defense against pathogenic microorganisms, and type I Interferons (IFNs) induced after viral infection are important mediating factors of the human body's antiviral innate immune response. Viruses, bacteria or other IFN-inducing agents are activated by interaction with the cell membrane, causing the type I IFN gene to be de-repressed, begin to transcribe the mRNA forming IFN- α and IFN- β, and are further translated on the cytoplasmic ribosomes into a precursor for type I IFN, which is transported to the cell membrane and eventually cleaved into mature type I IFN. The classic pathway for type I IFN signaling, the JAK/STAT (janus kinases/signal transmitters and activators of transcription) pathway: after IFN-alpha and IFN-beta are coupled with corresponding receptors, the phosphorylation of tyrosine residues of the type I IFN receptor is caused, JAK tyrosine kinase coupled with the receptors in cells is activated, and the activation of JAK further causes STAT phosphorylation to form homodimers or heterodimers. The activated dimer combines with the binding protein to form trimer, and further transfers into cell nucleus to cause the expression of a series of antiviral protein (AVP) genes, thereby exerting various biological activities of the type I IFN.

The invention obtains the fully human antibody clone library by the human hybridoma technology, provides a good technical platform for preparing and screening the antibody, and the screened antibody is the antibody naturally generated in the human body, avoids human processing factors introduced in the humanization process, better accords with the natural physiological process in the human body, and has wide application prospect.

Disclosure of Invention

The invention aims to provide a fully human monoclonal antibody which can be used for regulating and controlling human innate immunity and activating an I-type IFN signal system and a preparation method thereof.

In order to achieve the purpose, the invention adopts the following technical means:

(1) a human hybridoma cell strain capable of promoting the expression of the type I IFN to be increased is obtained by screening from a fully human antibody library.

(2) Amplifying and purifying the fully human monoclonal antibody, and evaluating the safety of the antibody to normal liver cells.

(3) The biological function identification and comparison of the obtained monoclonal antibody and tumor cell effects show that the fully human monoclonal antibody can promote the increase of type I IFN mRNA expression, inhibit the expression of Hepatitis B Virus (HBV) HBeAg, and combine with HepG2.215 cells (derived from HepG2 cells, wherein two complete HBV complete genes are transfected).

(4) Performing antibody gene sequencing on hybridoma cells producing the antibody;

(5) cloning the heavy chain sequence and the light chain sequence of the monoclonal antibody in the step (4) to a eukaryotic expression vector, transfecting host cells, and comparing the affinity and other biological functions of the obtained monoclonal antibody.

On the basis of the research, the fully human monoclonal antibody capable of regulating and controlling the innate immunity of the human body is obtained by screening, and consists of a light chain and a heavy chain, wherein the amino acid sequence of a variable region of the light chain is shown as SEQ ID NO.6, and the amino acid sequence of a variable region of the heavy chain is shown as SEQ ID NO. 8.

In the present invention, preferably, the amino acid sequence of the light chain is shown as SEQ ID NO.3, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 4.

One skilled in the art will appreciate that conservative amino acid substitutions in an antibody, particularly those occurring at the constant region, do not materially affect the affinity and structure of the antibody. Therefore, if the amino acid changes occur in the constant region and the biological activity of the antibody is not affected after the changes, the antibody is also within the scope of the present invention.

Further, the present invention also provides single domain antibodies, chimeric antibodies, antibody fusion protein antibodies, antibody/antibody fragment-factor fusion proteins or antibody/antibody fragment-chemical conjugates comprising a single heavy chain and/or a single light chain of said fully human monoclonal antibody. And

an antigen-binding fragment of the fully human monoclonal antibody, wherein the antigen-binding fragment is selected from the group consisting of Fab, Fab ', F (ab')₂scFv, Fv, dsFv, diabody, Fd and Fd' fragments.

Still further, the present invention also provides an isolated DNA molecule which is a nucleotide sequence encoding said antibody or said antigen binding fragment, preferably said nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO.5 and/or SEQ ID NO.6, more preferably said nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO.1 and/or SEQ ID NO. 2.

The recombinant DNA expression vector containing the nucleotide sequence or the combination thereof and the host cell containing the nucleotide sequence or the recombinant DNA expression vector are also within the protection scope of the invention, preferably, the host cell is selected from prokaryotic cells, yeast or mammalian cells, and more preferably, the host cell is selected from HEK293F cells, CHO cells or NSO cells.

The HEK293F cells were human embryonic kidney 293F cells (human embryo kidney 293F cells); the CHO cell is a Chinese hamster ovary cell (Chinese hamster ovary cell); the NSO cells are mouse NSO thymoma cells (mouse thymoma NSO cells).

Furthermore, the invention also provides the application of the antibody, the antigen binding fragment, the nucleotide sequence, the vector or the host cell in preparing a medicament for regulating and controlling human innate immunity and activating an I-type IFN signal system, wherein the medicament is used for preventing and treating infectious diseases, tumors and immune system diseases.

Among them, preferably, the infectious diseases include, but are not limited to, HIV virus infection, hepatitis a, b and c virus infection, herpes virus infection, influenza virus infection, coxsackie virus infection, respiratory syncytial virus infection, human papilloma virus infection, EB virus infection, enterovirus type 71 infection; the tumors include but are not limited to glioma, hodgkin lymphoma, follicular lymphoma, melanoma, acute or chronic leukemia, lung cancer, breast cancer, liver cancer, stomach cancer, pancreatic cancer, kidney cancer, prostate cancer, bladder cancer, ovarian cancer, skin cancer, squamous cell carcinoma, bone cancer, head and neck cancer, colorectal cancer, solid tumor; the immune system diseases include but are not limited to systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, myasthenia gravis, multiple sclerosis, autoimmune hemolytic anemia, autoimmune hepatitis, scleroderma, polyarteritis nodosa, Wegener's granulomatosis.

Furthermore, the invention also provides a method for preparing the fully human monoclonal antibody for regulating the innate immunity of the human body, which comprises the following steps:

(1) providing an expression vector comprising a DNA molecule encoding an antibody or antigen-binding fragment, and an expression control sequence operably linked to the DNA molecule;

(2) transforming a host cell with the expression vector;

(3) culturing a host cell containing said expression vector under conditions suitable for expression of said antibody;

(4) separating and purifying to obtain the monoclonal antibody;

wherein, preferably, the expression vector is a eukaryotic expression vector pcDNA3.4 containing an antibody secretion signal peptide sequence, and the host cell is HEK293F cell.

The monoclonal antibody provided by the invention can prevent and treat diseases by regulating and controlling the innate immunity of a human body and activating an I-type IFN signal system, is fully human, has greatly reduced immunogenicity caused by species differences compared with other animal-derived (such as murine-derived) monoclonal antibodies, has good specificity and high affinity, and greatly reduces side effects if used clinically. Has good application prospect in the prevention and treatment of diseases.

Drawings

FIG. 1 shows four stages of monoclonal antibody technology development;

FIG. 2 is a graph showing the effect of fully human monoclonal antibodies on type I IFN expression in human hepatoma cell lines HepG2 cells (human liver cancer cell lines);

each group was compared to the control group mock,. P <0.01,. P < 0.001;

FIG. 3 is a graph showing the effect of fully human monoclonal antibodies on type I IFN expression in HepG2.215 cells;

each group was compared to the control group mock,. P < 0.001;

FIG. 4 is a graph showing the effect of fully human monoclonal antibodies on proliferation of human normal hepatocyte LO2 cells (human normal liver cells);

FIG. 5 is an electrophoresis diagram of proteins identified by fully human monoclonal antibodies;

a: SDS-PAGE electrophoresis; b: western blot experiment;

FIG. 6 is a plasmid map of pcDNA3.4;

FIG. 7 is a graph of the effect of fully human monoclonal antibodies on HBeAg expression;

3B5 group compared to control group mock, { P } 0.001;

FIG. 8 shows the binding of fully human monoclonal antibodies to HepG2.215 cells.

Detailed Description

The detailed implementation method of the invention refers to the examples, experimental methods and reagents described in the examples, and all the experimental methods and reagents are conventional unless otherwise specified. The following examples are intended only to illustrate and explain the invention and are not intended to limit the invention in any way.

Example 1 screening of monoclonal antibodies that modulate human innate immunity

And (3) establishing a fully human monoclonal antibody library by adopting a human B cell cloning technology. Inoculating HepG2 cells into a 96-well plate, adding antibodies in a fully human monoclonal antibody library into cultured HepG2 cells respectively, acting for 48 hours, collecting the cells by a TRIzol reagent, extracting RNA, and carrying out RT-PCR to obtain cDNA. The Real-time PCR primers were designed by Genrunner and reference foreign literature, and the primers were amplified by SYBR kit (TaKaRa) and Roche quantitative PCR instrument. The analysis method comprises the following steps: according to the cyclic number Cp value, 2 is used^-△△CpThe method analyzes mRNA expression. The results represent the fold change in expression of the gene of interest in the experimental group relative to the control group.

The formula is △△ Cp ═ Cp target gene-Cp housekeeping gene_{Experimental group}- (Cp target Gene-Cp housekeeping Gene)_{Control group}

Detecting the expression level of type I IFN mRNA, thereby analyzing the effect of the antibody on type I IFN expression of HepG2 cells.

A human hybridoma cell strain capable of promoting the expression of the type I IFN to be increased is finally obtained by screening from a fully human antibody library through the method and is named as 3B5, and the fully human monoclonal antibody can promote the generation of type I IFN mRNA (figure 2). Similar results were obtained with HepG2.215 cells, which are fully human monoclonal antibodies capable of promoting expression of IFN- α and IFN- β mRNA (FIG. 3).

Example 2 evaluation of safety of fully human monoclonal antibody 3B5 against LO2 cells

MTT assay the effect of fully human monoclonal antibody 3B5 on LO2 cell proliferation was investigated. After the monoclonal antibody had acted on LO2 cells for 24h, 48h, and 72h, 20 μ L of MTT solution (5mg/mL in PBS, pH 7.4) was added to each well. Incubation was continued for 4h, the culture was terminated and the culture supernatant in the wells was carefully aspirated off. Add 150. mu.L DMSO into each well, shake for 10min to fully melt the crystals. Selecting 490nm wavelength, measuring the light absorption value of each well on an enzyme linked immunosorbent assay, recording the result, and drawing a cell growth curve by taking time as an abscissa and the light absorption value as an ordinate. The results are shown in FIG. 4, and the results in FIG. 4 indicate that the antibody has no inhibitory effect on LO2 cells, indicating that the concentration of the fully human monoclonal antibody used has no effect on the proliferation of normal hepatocytes.

Example 3 purification of monoclonal antibodies that modulate human innate immunity

The hybridoma cell line 3B5 which regulates human innate immunity positive obtained in example 1 was expanded and cultured, and serum-free cell culture supernatant was collected and protein electrophoresis was performed to detect antibody expression, as shown in fig. 5. Purifying by a protein A affinity column, desalting, concentrating, vacuumizing and freeze-drying to obtain the purified monoclonal antibody.

Example 4 construction and expression of antibody DNA recombinant plasmid

Sequencing the whole gene of the antibody of the hybridoma 3B5 which regulates the positive innate immunity of the human body and is obtained from the sequence of the gene of the light chain and the heavy chain of the antibody: the nucleotide sequence of the light chain (1G3-L1) is SEQ ID NO.1, the amino acid sequence is shown as SEQ ID NO.3, the nucleotide sequence of the heavy chain (1G3-H1) is SEQ ID NO.2, and the amino acid sequence is shown as SEQ ID NO. 4.

Wherein, the nucleotide sequence of the light chain variable region is SEQ ID NO.5, and the corresponding amino acid sequence is SEQ ID NO. 6. The nucleotide sequence of the heavy chain variable region is SEQ ID NO.7, and the corresponding amino acid sequence is SEQ ID NO. 8.

The light chain and heavy chain genes are cloned into eukaryotic expression vector pcDNA3.4 (FIG. 6) with antibody secretion signal peptide sequence. HEK293F cells were transiently transfected for whole antibody expression and protein electrophoresis was used to detect antibody expression, as shown in FIG. 5. Antibody protein was obtained by purification using protein a affinity column.

Example 5 Regulation of viral proliferation by fully human monoclonal antibodies

The fully human monoclonal antibody 3B5 acts on HepG2.215 cells for 48h, the influence of the antibody on HBeAg is detected by an ELISA method, the used antigen is diluted to a proper concentration by using a coating diluent, 5% calf serum is sealed at 37 ℃ for 40min, and the wells are washed 3 times by washing liquid, wherein each time is 3 min. Adding sample to be detected, standing at 37 deg.C for 60min, and washing with washing solution for 3 times (each time for 3 min). Adding enzyme labeled antibody, and heating at 37 deg.C for 1 h. Adding substrate solution, standing at 37 deg.C in dark for 3-5min, adding stop solution, developing, and detecting with 490nm wavelength. The results showed that the fully human monoclonal antibody significantly inhibited the expression of HBeAg (fig. 7).

Example 6 intracellular binding assay of monoclonal antibodies that modulate human innate immunity

The fluorescence distribution of the fully human monoclonal antibody 3B5 was analyzed using hepg2.215 cells as substrate and normal human serum as Negative Control (NC). Culturing cells on 4% polylysine pretreated coverslips (coverslips placed in 6-well culture plates), washing with pre-cooled 0.1M PBS, fixing with 4% paraformaldehyde for 30min, and blocking with goat serum for 30min (37 deg.C); primary antibody incubation, overnight at 4 ℃, negative control with 0.1M PBS instead of primary antibody; 0.1M PBS 3 times; FITC-labeled anti-human IgG, incubated at 37 ℃ for 1 h; PBS was washed 3 times and observed under a fluorescent microscope. The results are shown in FIG. 8, which illustrates the binding of the fully human monoclonal antibody 3B5 to HepG2.215 cells.

It is obvious to those skilled in the art that the specific embodiments are only exemplary descriptions of the present invention, and it is within the scope of the present invention that the present invention is not limited to the above-mentioned embodiments, as long as various insubstantial modifications of the method concept and technical scheme of the present invention are made, or the concept and technical scheme of the present invention are directly applied to other occasions without modifications.

Sequence listing

<110> Harbin university of medicine

<120> fully human monoclonal antibody for regulating and controlling human innate immunity, and preparation method and application thereof

<130>KLPI170019

<160>8

<170>PatentIn 3.5

<210>1

<211>645

<212>DNA

<213>3B5-L1

<400>1

atggaaatag tgatgacgca gtctccagcc accctgtctg tgtctccagg ggaaagagcc 60

accctctcct gcagggccag tcagagtgtt agcagcaact tagcctggta ccagcagaaa 120

cctggccagg ctcccaggct cctcatctat ggtgcatcca ccagggccac tggtatccca 180

gccaggttca gtggcagtgg gtctgggaca gagttcactc tcaccatcag cagcctgcag 240

tctgaggatt ttgcagttta ttactgtcag cagtataata actggcctcg gacgttcggc 300

caagggacca aggtggaaat caaacgaact gtggctgcgc catctgtctt catcttcccg 360

ccatctgatg agcagttgaa atctggaact gcctctgttg tgtgcctgct gaataacttc 420

tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc gggtaactcc 480

caggagagtg tcacagagca ggacagcaag gacagcacct acagcctcag cagcaccctg 540

acgctgagca aagcagacta cgagaaacac aaagtctacg cctgcgaagt cacccatcag 600

ggcctgagct cgcccgtcac aaagagcttc aacaggggag agtgt 645

<210>2

<211>1408

<212>DNA

<213>3B5-H1

<400>2

atggagttgg ggctgcgctg ggttttcctt gttgctgttt tagaaggtgt ccagtgtgag 60

gtgcagctgg tggagtctgg gggaggcttg gtacagcctg gagggtccct gagactctcc 120

tgtgcggcct ctggattcac cttcagtagt tatgaaatga actgggtccg ccaggctcca 180

gggaaggggc tggagtgggt ttcatacatt agtatgagtg gtagttccat atactatgga 240

gactctgtga agggccgatt caccatctcc agagacaacg ccaagaactc actgtttctg 300

gaaatgaaca gcctgagagc cgaggacacg gctgtttatt actgtgcggg agcgcctgag 360

atcggggtgt ggggtcctga ctactggggc cagggaaccc tggtcaccgt ctcctcagcc 420

tccaccaagg gcccatcggt cttccccctg gcaccctcct ccaagagcac ctctgggggc 480

acagcggccc tgggctgcct ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 540

aactcaggcg ccctgaccag cggcgtgcac accttcccgg ctgtcctaca gtcctcagga 600

ctctactccc tcagcagcgt ggtgaccgtg ccctccagca gcttgggcac ccagacctac 660

atctgcaacg tgaatcacaa gcccagcaac accaaggtgg acaagaaagt tgagcccaaa 720

tcttgtgaca aaactcacac atgcccaccg tgcccagcac ctgaactcct ggggggaccg 780

tcagtcttcc tcttcccccc aaaacccaag gacaccctca tgatctcccg gacccctgag 840

gtcacatgcg tggtggtgga cgtgagccac gaagaccctg aggtcaagtt caactggtac 900

gtggacggcg tggaggtgca taatgccaag acaaagccgc gggaggagca gtacaacagc 960

acgtaccgtg tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa tggcaaggag 1020

tacaagtgca aggtctccaa caaagccctc ccagccccca tcgagaaaac catctccaaa 1080

gccaaagggc agccccgaga accacaggtg tacaccctgc ccccatcccg ggatgagctg 1140

accaagaacc aggtcagcct gacctgcctg gtcaaaggct tctatcccag cgacatcgcc 1200

gtggagtggg agagcaatgg gcagccggag aacaactaca agaccacgcc tcccgtgctg 1260

gactccgacg gctccttctt cctctacagc aagctcaccg tggacaagag caggtggcag 1320

caggggaacg tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacgcag 1380

aagagcctct ccctgtctcc gggtaaaa 1408

<210>3

<211>215

<212>PRT

<213>3B5-L1

<400>3

1 MET Glu Ile Val MET Thr Gln Ser Pro Ala Thr Leu Ser Val Ser

16 Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val

31 Ser Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro

46 Arg Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro

61 Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr

76 Ile Ser Ser Leu Gln Ser Glu Asp Phe Ala Val Tyr Tyr Cys Gln

91 Gln Tyr Asn Asn Trp Pro Arg Thr Phe Gly Gln Gly Thr Lys Val

106 Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro

121 Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys

136 Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys

151 Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr

166 Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu

181 Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys

196 Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

211 Asn Arg Gly Glu Cys

<210>4

<211>468

<212>PRT

<213>3B5-H1

<400>4

1 MET Glu Leu Gly Leu Arg Trp Val Phe Leu Val Ala Val Leu Glu

16 Gly Val Gln Cys Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu

31 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly

46 Phe Thr Phe Ser Ser Tyr Glu MET Asn Trp Val Arg Gln Ala Pro

61 Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Ser MET Ser Gly Ser

76 Ser Ile Tyr Tyr Gly Asp Ser Val Lys Gly Arg Phe Thr Ile Ser

91 Arg Asp Asn Ala Lys Asn Ser Leu Phe Leu Glu MET Asn Ser Leu

106 Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Gly Ala Pro Glu

121 Ile Gly Val Trp Gly Pro Asp Tyr Trp Gly Gln Gly Thr Leu Val

136 Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu

151 Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly

166 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

181 Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val

196 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val

211 Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn

226 His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys

241 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu

256 Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

271 Asp Thr Leu MET Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val

286 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr

301 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

316 Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val

331 Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val

346 Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys

361 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro

376 Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu

391 Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser

406 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu

421 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp

436 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val MET

451 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu

466 Ser Pro Gly Lys

<210>5

<211>291

<212>DNA

<213>3B5-L1 variable regions

<400>5

gaaatagtga tgacgcagtc tccagccacc ctgtctgtgt ctccagggga aagagccacc 60

ctctcctgca gggccagtca gagtgttagc agcaacttag cctggtacca gcagaaacct 120

ggccaggctc ccaggctcct catctatggt gcatccacca gggccactgg tatcccagcc 180

aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag cctgcagtct 240

gaggattttg cagtttatta ctgtcagcag tataataact ggcctcggac g 291

<210>6

<211>97

<212>PRT

<213>3B5-L1 variable regions

<400>6

1 Glu Ile Val MET Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro

16 Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser

31 Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg

46 Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Thr Gly Ile Pro Ala

61 Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile

76 Ser Ser Leu Gln Ser Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln

91 Tyr Asn Asn Trp Pro Arg Thr

<210>7

<211>327

<212>DNA

<213>3B5-H1 variable regions

<400>7

gaggtgcagc tggtggagtc tgggggaggc ttggtacagc ctggagggtc cctgagactc 60

tcctgtgcgg cctctggatt caccttcagt agttatgaaa tgaactgggt ccgccaggct 120

ccagggaagg ggctggagtg ggtttcatac attagtatga gtggtagttc catatactat 180

ggagactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgttt 240

ctggaaatga acagcctgagagccgaggac acggctgttt attactgtgc gggagcgcct 300

gagatcgggg tgtggggtcc tgactac 327

<210>8

<211>109

<212>PRT

<213>3B5-H1 variable regions

<400>8

1 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly

16 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser

31 Ser Tyr Glu MET Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

46 Glu Trp Val Ser Tyr Ile Ser MET Ser Gly Ser Ser Ile Tyr Tyr

61 Gly Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala

76 Lys Asn Ser Leu Phe Leu Glu MET Asn Ser Leu Arg Ala Glu Asp

91 Thr Ala Val Tyr Tyr Cys Ala Gly Ala Pro Glu Ile Gly Val Trp

106 Gly Pro Asp Tyr

Claims

1. A fully human monoclonal antibody for regulating and controlling human innate immunity consists of a light chain and a heavy chain, and is characterized in that the amino acid sequence of a variable region of the light chain is shown as SEQ ID NO.6, and the amino acid sequence of a variable region of the heavy chain is shown as SEQ ID NO. 8.

2. The fully human monoclonal antibody for modulating human innate immunity as claimed in claim 1 wherein the amino acid sequence of the light chain is set forth in SEQ ID No.3 and the amino acid sequence of the heavy chain is set forth in SEQ ID No. 4.

3. An isolated DNA molecule, characterized in that said DNA molecule is a nucleotide sequence encoding an antibody according to claim 1 or 2.

4. The isolated DNA molecule according to claim 3, characterized in that the nucleotide sequence of said DNA molecule comprises the nucleotide sequence shown in SEQ ID NO.5 and/or SEQ ID NO. 7.

5. The isolated DNA molecule according to claim 3, wherein said nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO.1 and/or SEQ ID NO. 2.

6. A recombinant DNA expression vector comprising the isolated DNA molecule of any one of claims 3-5, or a combination thereof.

7. A host cell comprising the isolated DNA molecule of any one of claims 3 to 5 or the recombinant DNA expression vector of claim 6.

8. The host cell of claim 7, wherein said host cell is selected from the group consisting of prokaryotic cells, yeast cells, and mammalian cells.

9. The host cell of claim 8, wherein the host cell is selected from the group consisting of a HEK293F cell, a CHO cell, and an NSO cell.

10. Use of the antibody of claim 1 or 2, the isolated DNA molecule of any one of claims 3-5, the vector of claim 6, or the host cell of any one of claims 7-9 in the manufacture of a medicament for the prevention and treatment of hepatitis b virus infection.

11. A method for preparing a fully human monoclonal antibody which modulates innate immunity in a human body, comprising the steps of:

(1) providing an expression vector comprising a DNA molecule encoding the antibody of claim 1 or 2, and an expression control sequence operably linked to said DNA molecule;

(2) transforming a host cell with the expression vector;

(4) separating and purifying to obtain the monoclonal antibody.

12. The method of claim 11, wherein the expression vector is a eukaryotic expression vector pcDNA3.4 comprising an antibody secretion signal peptide sequence and the host cell is HEK293F cell.