CN106916813A - With the molecular labeling SVhd3 of millet breeding time gene close linkage - Google Patents

With the molecular labeling SVhd3 of millet breeding time gene close linkage Download PDF

Info

Publication number
CN106916813A
CN106916813A CN201510998518.3A CN201510998518A CN106916813A CN 106916813 A CN106916813 A CN 106916813A CN 201510998518 A CN201510998518 A CN 201510998518A CN 106916813 A CN106916813 A CN 106916813A
Authority
CN
China
Prior art keywords
millet
molecular labeling
breeding time
seq
breeding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510998518.3A
Other languages
Chinese (zh)
Inventor
倪雪梅
蔡雪梅
雷雪静
黄聪
刘小菊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHENZHEN BGI AGRICULTURE AND CYCLE ECONOMIC TECHNOLOGY Co Ltd
BGI Shenzhen Co Ltd
Original Assignee
SHENZHEN BGI AGRICULTURE AND CYCLE ECONOMIC TECHNOLOGY Co Ltd
BGI Shenzhen Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHENZHEN BGI AGRICULTURE AND CYCLE ECONOMIC TECHNOLOGY Co Ltd, BGI Shenzhen Co Ltd filed Critical SHENZHEN BGI AGRICULTURE AND CYCLE ECONOMIC TECHNOLOGY Co Ltd
Priority to CN201510998518.3A priority Critical patent/CN106916813A/en
Publication of CN106916813A publication Critical patent/CN106916813A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to biology field, it is related to a kind of molecular labeling, in particular it relates to a kind of and millet breeding time gene close linkage molecular labeling, its nucleotide sequence such as SEQ ID NO:Shown in 1, or it is containing SEQ ID NO in millet genome:The DNA fragmentation of nucleotide sequence shown in 1.Purposes in the millet breeding time assignment of genes gene mapping or millet genetic breeding of primer, the molecular labeling the invention further relates to the molecular labeling, a kind of millet breeding time gene positioning method and a kind of Millet Breeding method.Present invention finds the molecular labeling SVhd3 with millet breeding time gene close linkage, millet genomic dna sequence is got up with millet breeding time genetic link, be more beneficial for the foundation of millet molecular mark system.

Description

With the molecular labeling SVhd3 of millet breeding time gene close linkage
Technical field
The invention belongs to biology field, it is related to a kind of molecular labeling, specifically, It is related to a kind of and millet breeding time gene close linkage molecular labeling.The invention further relates to The primer of the molecular labeling, the molecular labeling are lost in the millet breeding time assignment of genes gene mapping or millet Purposes, a kind of millet breeding time gene positioning method and a kind of millet in biography breeding Breeding method.
Background technology
Millet originates from China, is that traditional dominant crop, staple food crop and drought resisting are resistance to lean Crop.The resistance to lean, Water use efficency of millet drought resisting is high, wide adaptability, not only current Played an important role in the dry farming ecological agriculture, and for increasingly serious shortage of water resources, Millet or important strategic reserves crop.German millet nutrition after millet is shelled is abundant and each Ingredient balance is planted, is the cereal crops with nutrition health-care functions, there is important work to human body Edible crude fibre is 5 times of rice, is the worldwide coarse cereals heat of rising in recent years Chief crop.Millet straw crude protein content is 8% or so simultaneously, and forage grass millet stalk is thick Protein content is top quality forage grass in grass family, in animal husbandry development more than 15% In play an important role.
Therefore, accelerate Millet Breeding process particularly important.Make because millet belongs to small grain class Thing, lags behind the cereal crops such as corn, wheat, millet in terms of theory of heredity research. How to instruct Millet Breeding using the research meanses of advanced science is a problem for sternness. With the development of molecular biology, the appearance of molecular marking technique is that the heredity of millet is ground Study carefully and breeding opens new thinking and method.Exploitation and important character gene close linkage Molecular labeling and carry out molecular marker assisted selection breeding, China millet can be significantly improved Breeding level.
Millet breeding time is closely related with kind and yield.But there is presently no document report The Position Research of millet breeding time related gene.
The content of the invention
The present inventor's foundation whole genome sequence, by substantial amounts of experiment and unremitting effort, It is tight with millet (Setaria italica L.Beauv.) breeding time gene there is provided one kind Close chain molecular labeling SVhd3, and thus provide following inventions:
One aspect of the present invention is related to a kind of dividing for and millet breeding time gene close linkage Son mark SVhd3, its nucleotide sequence such as SEQ ID NO:Shown in 1.
109bp:
GCTAAATCGCGAGACGAATCTATTAAGCCTAATTATTTGACAATGTGGTGCT ACAGTGAACATATGTTAATGATGGATTAATTAGGCTTAATAGATTCGTCTCGCGAT T(SEQ ID NO:1)
In the present invention, term " molecular labeling with millet breeding time gene close linkage " Refer to such molecular labeling, in genetic linkage mapses, the molecular labeling resists with millet The genetic linkage distance of herbicide resistance gene is less than 2cM or less than 3cM.
Further aspect of the invention is related to the primer of molecular labeling of the invention, its nucleotides Sequence such as SEQ ID NO:2 and SEQ ID NO:Shown in 3:
Forward primer:CCTTTGCTTTCTTGCTCGCT(SEQ ID NO:2)
Reverse primer:CAGCTTGGTTCGGCATCAGC(SEQ ID NO:3)
Molecular labeling of the invention can also be to contain SEQ ID NO:Nucleotides sequence shown in 1 The DNA fragmentation of row;The length of the DNA fragmentation is suitable length, but is not particularly limited, For example, less than 10,000bp, less than 5,000bp, less than 2,000bp, less than 1,500bp, Less than 1,200bp, less than 1,000bp or less than 800bp.
In one embodiment of the invention, the molecular labeling (contains SEQ ID NO: The DNA fragmentation of nucleotide sequence shown in 1) it is SEQ ID NO in millet genome:1 institute Show the DNA fragmentation of nucleotide sequence, that is, the SEQ ID NO for being included:15 ' end and/ Or 3 ' the nucleotide sequence beyond end is also sequence in millet genome, it is preferable that be SEQ ID NO in millet genome:15 ' ends and/or the upstream and downstream sequence at 3 ' ends. As long as it will be understood by those skilled in the art that in amplification or detection millet genomic DNA The molecular labeling, necessarily can detect or expand in breeding time millet long and be contained SEQ ID NO:Sequence shown in 1, or can not detect or expand in short breeding time millet Increasing obtains containing SEQ ID NO:Sequence shown in 1.SEQ ID NO:15 ' end and / or 3 ' end upstream and downstream sequences length be suitable length, be not particularly limited, for example, Meet the length of molecular labeling less than 10,000bp, less than 5,000bp, less than 2,000bp, Less than 1,500bp, less than 1,200bp, less than 1,000bp or less than 800bp.
In one embodiment of the invention, the molecular labeling (contains SEQ ID NO: The DNA fragmentation of nucleotide sequence shown in 1) the SEQ ID NO that are included:15 ' ends And/or 3 ' end be operably connected and have artificial sequence and/or control sequence, for example start Son, enhancer, terminator, restriction enzyme site, primer sequence etc..Wherein, term " can A kind of following conformation operatively " is defined as in the present invention, in the conformation, controls sequence Row such as promoter is appropriately placed SEQ ID NO:On 1 position, so that should Control sequence instructs SEQ ID NO:The generation of the polypeptide of 1 coding.
Another aspect of the present invention is related to a kind of recombinant vector, and it contains molecule of the invention Mark.The recombinant vector can be the expression vector for being inserted with molecular labeling of the invention Or cloning vector.Further aspect of the invention is related to a kind of recombinant cell, and it contains this Recombinant vector.
Further aspect of the invention is related to the preparation method of molecular labeling of the invention, including Following step:Using the genomic DNA of breeding time millet long as template, drawn with above-mentioned Thing enters performing PCR amplification, and the amplified production for obtaining contains the molecular labeling;Preferably, Also include the step of being purified pcr amplification product.In one embodiment of the present invention In case, the breeding time millet long is WD-2 (late-maturing, breeding time long, 116 days).
To those skilled in the art, it is possible to understand that, it is also possible to DNA chemical syntheses Method obtains molecular labeling of the invention.
Further aspect of the invention is related to the detection method of the molecular labeling, including following Step:
(1) the nucleotide sequence design primer of molecular labeling of the invention;
(2) expanded as template using being detected the genomic DNA of millet;
(3) judge to whether there is the molecular labeling in amplified production.
For example, can be template to be detected the genomic DNA of millet, with above-mentioned primer (SEQ ID NO:2 and SEQ ID NO:3) enter performing PCR amplification, obtain amplified production. The amplified production that will can be obtained is sequenced or gel electrophoresis.
Further aspect of the invention is related to molecular labeling of the invention in millet breeding time gene Purposes in positioning or detection.
Further aspect of the invention is related to a kind of method of the millet breeding time assignment of genes gene mapping, bag The step of including using molecular labeling of the invention.
Further aspect of the invention is related to molecular labeling of the invention in millet assistant breeding Purposes.
Further aspect of the invention is related to a kind of millet auxiliary breeding means, including detection is originally The step of molecular labeling of invention.
Molecular labeling of the invention can be used in molecular mark from now on, ability Field technique personnel are appreciated that such as by detecting whether there is molecular labeling of the invention To screen the millet of breeding time long or short breeding time.The detection can be PCR detections Method, specifically, it is possible to use above-mentioned molecular labeling primer of the invention.The inspection Survey can also be carried out by sequence measurement.The millet auxiliary breeding means have easy, fast Fast, high-throughout advantage.
The beneficial effect of the invention
The invention provides the molecular labeling with millet breeding time gene close linkage, and will Millet genomic DNA gets up with millet breeding time genetic link, is more beneficial for millet molecule The foundation of marker-assisted breeding system;The molecular labeling is tight with the heredity of breeding time gene Close linkage distance is 1cM.Molecular labeling of the invention can be with easy, quick, with high throughput It is applied to millet assistant breeding.
Brief description of the drawings
Fig. 1:Molecular labeling primer (SEQ ID NO:2 and SEQ ID NO:3) to 215 The partial results of individual RIL RIL strains (F6 generations) individual plant amplification.Wherein:
Swimming lane 1-5 is the pcr amplification product of breeding time individual plant long in RIL strains;Swimming lane 7-11 is the pcr amplification product of short breeding time individual plant in RIL strains.Swimming lane 6 is Marker, its molecular weight includes:2000bp、1000bp、750bp、500bp、250bp、 And 100bp.Result shows:Breeding time individual plant amplified production band long is in RIL strains Short breeding time individual plant amplified production band is 406bp in 515bp, RIL strain.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but It will be understood to those of skill in the art that the following example is merely to illustrate the present invention, without Should be regarded as limiting the scope of the present invention.Unreceipted actual conditions person in embodiment, according to normal Rule condition or the condition of manufacturer's suggestion are carried out.Agents useful for same or instrument, material are unreceipted Production firm person, be can by city available from conventional products.
Embodiment 1:The structure of millet RIL colonies
Male parent:Ningxia morning paddy, precocious (short breeding time, 104 days).It is maternal:Crow is when 2 Number (WD-2), late-maturing (breeding time long, 116 days).Male parent and hybridization of female parent obtain F1, F1 generation obtains 215 RIL RIL strains (F6 generations) by single seed descent.Rather Morning in summer paddy and WD-2 can be purchased from Shenzhen Huada Agriculture & Circular Economy Technology Co., Ltd. .
Embodiment 2:The extraction of genomic DNA
For the millet RIL colonies obtained in embodiment 1, father is extracted respectively with CTAB methods The genomic DNA of maternal and RIL colonies individual plant, specific method is as follows:
(1) the fresh blades of 1.0g are weighed, is shredded and is put into mortar, added with after liquid nitrogen grinding Enter 1.5 × CTAB of 3mL, grind to form homogenate and be transferred in the centrifuge tube of 15mL, it is then past to grind Add 1.5 × CTAB of 1mL to rinse in alms bowl to be transferred in centrifuge tube again.Mix after 65 DEG C of water Bath 30min, period slowly shakes up frequently.
Wherein 1.5 × CTAB formulas are following (1L):
CTAB 15g
The Tris.Cl (pH is 8.0) of 1mol/L 75mL
The EDTA of 0.5mol/L 30mL
NaCl 61.4g
Plus deionized water is settled to 1L, add final concentration of 0.2% (2ml's) using preceding Mercaptoethanol.
(2) room temperature is cooled to, isometric chloroform/isoamyl alcohol (24 is added:1), gently It is light to mix, it is changed into bottle green to subnatant.
(3) 4200rpm centrifugations 10min, new 15mL centrifugations are moved on to by upper strata aqueous phase Pipe, plus 2 times of absolute ethyl alcohols of volume precooling, mix static 5min.In -20 DEG C of placements 30min precipitates DNA.
(4) 4200rpm centrifugations 10min, discards supernatant, adds the ethanol of 1mL 75% to wash Wash precipitation 1 time, be inverted centrifuge tube dry DNA, add 200 μ L TE dissolving DNAs.
(5) genomic DNA is detected with 0.8% Ago-Gel.
(6) Parent and the genomic DNA of RIL colonies individual plant that will be obtained are stored in -20 DEG C It is standby.
Embodiment 3:The assignment of genes gene mapping and molecular markers development
(1) genetic map construction
For the individual genomic DNAs of the RIL obtained in embodiment 2, based on RAD-seq Genotyping technique (http://www.bioon.com.cn/server/show_produ ct.aspId=12291) individuality to RIL colonies carries out Genotyping, obtains RIL groups The genotype data of body.
With the softwares of MapMaker 3.0 (Constructing genetic maps with MAPMAKER/EXP 3.0, S Lincoln, M Daly, E Lander-Cambridge, MA:Whitehead Institute, 1992, by referring to being incorporated by herein) Genetic linkage mapses drafting is carried out, genetic linkage map is obtained.
(2) assignment of genes gene mapping
For the RIL colonies obtained in embodiment 1, by the individual phenotype of RIL colonies, Similar to male parent type proterties is designated as a, and similar to maternal type proterties is designated as b, and proterties is occupied H is designated as between male parent and female parent.The phenotypic data of all individualities is obtained, by individuality Phenotypic data is compared with the genotype data for obtaining before, so as to by millet breeding time The assignment of genes gene mapping is on genetic linkage mapses.Result shows that the millet breeding time assignment of genes gene mapping is 2 In number chromosome 39053453bp to 39098769bp is interval, length is about 45316bp.
(3) molecular markers development
Male parent and the maternal full-length genome that carries out respectively are resurveyed sequence (10X), then basis The sequencing result of RAD-seq, sequencing reads, Ran Houyong are compared using SOAP softwares SOAPsv finds the molecular labeling that Parent genomic fragment differs greatly, and is easy to use gel Electrophoresis is distinguished and differentiated.
As a result, the mark SVhd3 (SEQ of the section where millet breeding time gene are selected ID NO:Nucleotide sequence shown in 1) as candidate.
The nucleotide sequence of SVhd3 is following (109bp):
GCTAAATCGCGAGACGAATCTATTAAGCCTAATTATTTGACAATGTGGTGCT ACAGTGAACATATGTTAATGATGGATTAATTAGGCTTAATAGATTCGTCTCGCGAT T(SEQ ID NO:1).
Embodiment 4:The breeding time relevance verification of molecular labeling
To millet breeding time related molecular marker SVhd3 (the SEQ ID determined in embodiment 3 NO:Nucleotide sequence shown in 1) verified, it is specific as follows:
Primer is designed for above-mentioned molecular labeling, primer sequence is as follows:
Forward primer:5’-CCTTTGCTTTCTTGCTCGCT-3’(SEQ ID NO: 2);
Reverse primer:5’-CAGCTTGGTTCGGCATCAGC-3’(SEQ ID NO: 3)。
Using above-mentioned primer, expand with agarose gel electrophoresis detection to verify by PCR The polymorphism and amplification stability of the mark.
Specifically, with the base of the male parent of extraction, female parent, RIL colonies individual plant in embodiment 2 Because group DNA is template, enters performing PCR using above-mentioned amplimer and expand, wherein,
PCR reaction systems are as follows:
Sterilized water 20.2μl
10*Buffer (contains Mg2+) 2.5μl
dNTPs(25mM) 0.15μl
Taq enzyme (5U/ μ l) 0.15μl
Forward primer (10 μM) 0.5μl
Reverse primer (10 μM) 0.5μl
Template 1.0μl
Cumulative volume 25μl
PCR response procedures are as follows:
94 DEG C of predegenerations 5 minutes;94 DEG C are denatured 30 seconds, and 60 DEG C are annealed 30 seconds, 72 DEG C Extend 40 seconds, run 35 circulations;Last 72 DEG C extend 3 minutes.PCR amplifications are produced Thing is purified after preservation at 4 DEG C.
Then, each pcr amplification product is taken into part carries out 1% agarose gel electrophoresis detection, Result is shown in Fig. 1.As shown in figure 1, the individual plant of breeding time long amplifies the band of 515bp, The individual plant of short breeding time amplifies the band of 406bp.Thus, it was demonstrated that the molecular labeling SVhd3(SEQ ID NO:Nucleotide sequence shown in 1) there is polymorphism between Parent, The molecular labeling and millet Growth period traits close linkage.
Then, each amplified production is sequenced using 3730 sequenators, is as a result shown, Breeding time individual plant amplified production long is 515bp, its sequence such as SEQ in maternal and RIL colonies ID NO:Shown in 4:
CCTTTGCTTTCTTGCTCGCTGTTTGCAAACAGCCATGCGAGGCAGATGTGACAG GCTTGGATTGGAGAGGAGGCTGCTGGTCCAGTCCAGTGTGGTGTATGTAAAAAGATCTC ACGAGACAAGATGAGGGCTAAACTTTAGTCCTGTCTTCGGATACTAATTAGGAGGACTA AATATAAGCTAATTACAAAACTAATTGTAGAATCCCTAGGCTAAATCGCGAGACGAATC TATTAAGCCTAATTATTTGACAATGTGGTGCTACAGTGAACATATGTTAATGATGGATT AATTAGGCTTAATAGATTCGTCTCGCGATTTAGCCTAGGGGTTGTGCAATTAGTTTTGT AATTAGACTATGTTTAATACTCCTAATTAGTGTCCAAACATTCGATGTGACGGGGGCTA AAATTTAGCCCCCTCCTCCCAAACACCCTGGAAGAAACAAACGAGTGTCGAGTGTAGGT GTGTGATTGAAGGACCACCCTCCAGTCTGCTGATGCCGAACCAAGCTG(SEQ ID NO: 4);
Above-mentioned underlined sequences are molecular labeling SEQ ID NO of the invention:1.
Short breeding time individual plant amplified production is 406bp in male parent and RIL colonies, and its sequence is such as SEQ ID NO:Shown in 5:
CCTTTGCTTTCTTGCTCGCTGTTTGCAAACAGCCATGCGAGGCAGATGTGACAG GCTTGGATTGGAGAGGAGGCTGCTGGTCCAGTCCAGTGTGGTGTATGTAAAAAGATCTC ACGAGACAAGATGAGGGCTAAACTTTAGTCCTGTCTTCGGATACTAATTAGGAGGACTA AATATAAGCTAATTACAAAACTAATTGTAGAATCCCTAGTAGCCTAGGGGTTGTGCAAT TAGTTTTGTAATTAGACTATGTTTAATACTCCTAATTAGTGTCCAAACATTCGATGTGA CGGGGGCTAAAATTTAGCCCCCTCCTCCCAAACACCCTGGAAGAAACAAACGAGTGTCG AGTGTAGGTGTGTGATTGAAGGACCACCCTCCAGTCTGCTGATGCCGAACCAAGCTG (SEQ ID NO:5)
Breeding time individual plant long and short fertility in male parent and RIL colonies in maternal and RIL colonies Compared to increased some sequences, the sequence is molecular labeling SVhd3 to phase individual plant amplified band (SEQ ID NO:Nucleotide sequence shown in 1).
Additionally, using above-mentioned amplimer (SEQ ID NO:2 and SEQ ID NO:3) Expand other the millet colonies containing breeding time site or kind, the individual plant of breeding time long The band of 515bp is amplified, the individual plant of short breeding time amplifies the band of 406bp. Thus prove the molecular labeling be used in other the millet colonies containing breeding time site or Kind.
Although specific embodiment of the invention has obtained detailed description, this area skill Art personnel will be understood that.According to disclosed all teachings, those details can be entered The various modifications of row and replacement, these change within protection scope of the present invention.This hair Bright four corner is given by appended claims and its any equivalent.

Claims (10)

1. a kind of molecular labeling of and millet breeding time gene close linkage, its nucleotides sequence Row such as SEQ ID NO:Shown in 1;Or it is to contain SEQ ID NO:Nucleosides shown in 1 The DNA fragmentation of acid sequence.
2. a kind of recombinant vector, it contains the molecular labeling described in claim 1.
3. a kind of recombinant cell, it contains the recombinant vector described in claim 2.
4. the primer of the molecular labeling described in claim 1, its nucleotide sequence such as SEQ ID NO:2 and SEQ ID NO:Shown in 3.
5. the preparation method of the molecular labeling described in claim 1, comprises the steps:
Using the genomic DNA of breeding time millet long as template, with claim 4 institute The primer stated enters performing PCR amplification;Preferably, also the product including PCR is expanded is carried out The step of purifying;Specifically, the breeding time millet long is breeding time millet long for crow works as 2 Number.
6. the detection method of the molecular labeling described in claim 1, comprises the steps:
(1) the nucleotide sequence design primer of molecular labeling according to claim 1;
(2) expanded as template using being detected the genomic DNA of millet;
(3) judge to whether there is the molecular labeling in amplified production.
7. the molecular labeling described in claim 1 is in the millet breeding time assignment of genes gene mapping or detection In purposes.
8. a kind of 1 institute of method of the millet breeding time assignment of genes gene mapping, including usage right requirement The step of molecular labeling stated.
9. purposes of the molecular labeling described in claim 1 in millet assistant breeding.
10. dividing described in a kind of millet auxiliary breeding means, including test right requirement 1 The step of son mark.
CN201510998518.3A 2015-12-28 2015-12-28 With the molecular labeling SVhd3 of millet breeding time gene close linkage Pending CN106916813A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510998518.3A CN106916813A (en) 2015-12-28 2015-12-28 With the molecular labeling SVhd3 of millet breeding time gene close linkage

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510998518.3A CN106916813A (en) 2015-12-28 2015-12-28 With the molecular labeling SVhd3 of millet breeding time gene close linkage

Publications (1)

Publication Number Publication Date
CN106916813A true CN106916813A (en) 2017-07-04

Family

ID=59454975

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510998518.3A Pending CN106916813A (en) 2015-12-28 2015-12-28 With the molecular labeling SVhd3 of millet breeding time gene close linkage

Country Status (1)

Country Link
CN (1) CN106916813A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101982545A (en) * 2010-11-22 2011-03-02 深圳华大基因科技有限公司 Molecular marker SIsv0053 closely linked with millet plant height genes
CN101985620A (en) * 2010-11-22 2011-03-16 深圳华大基因科技有限公司 Molecular marker SIsv1223 closely linked with millet herbicide-resistant gene
CN102115744A (en) * 2010-11-22 2011-07-06 深圳华大基因科技有限公司 Molecular marker SIsv0204 closely linked with herbicide-resistant gene of millet

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101982545A (en) * 2010-11-22 2011-03-02 深圳华大基因科技有限公司 Molecular marker SIsv0053 closely linked with millet plant height genes
CN101985620A (en) * 2010-11-22 2011-03-16 深圳华大基因科技有限公司 Molecular marker SIsv1223 closely linked with millet herbicide-resistant gene
CN102115744A (en) * 2010-11-22 2011-07-06 深圳华大基因科技有限公司 Molecular marker SIsv0204 closely linked with herbicide-resistant gene of millet

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NCBI GENBANK: "PREDICTED: Setaria italica zinc finger CCCH domain-containing protein 53-like(LOC101755758),XM_004958661.3,3297bp mRNA linear", 《NCBI GENBANK》 *
陈秋玲等: "分子标记技术在禾本科作物基因定位上的研究进展", 《中国农学通报》 *

Similar Documents

Publication Publication Date Title
CN104726552B (en) Chinese cabbage anti-clubroot CRb gene linkage molecular marker, primer and selection method of anti-clubroot plant
BR112017023275B1 (en) METHODS FOR SELECTING A BRACHITICA CORN PLANT OR SEED
CN104498486B (en) The Indel labelling of anti-cucumber powdery mildew gene pm h and its application
CN107090494A (en) The molecular labeling related to millet code grain number character and its detection primer and application
CN103937785B (en) Watermelon female line gene C lWIP1 and chromosome translocation and linked marker
CN106434944A (en) Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica
CN103789419B (en) Co-dominance tag primer group for identifying allele type of rice photo-thermo-sensitive genic male-sterile gene p/tms12-1, and applications thereof
CN102690812B (en) Molecular marker SIsv0067 closely linked with millet Heading date gene
CN106498068A (en) A kind of codominance SSR marker and its application with Nicotiana tabacum L. TMV resistant gene N close linkages
CN106811509A (en) With the molecular labeling SVmc2 of hasked millet color gene close linkage
CN106811508A (en) With the molecular labeling SVmc3 of hasked millet color gene close linkage
CN110527741A (en) A kind of molecular labeling, primer and application with american pumpkin mildew-resistance biological strain 2F gene close linkage
CN105713983B (en) A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage
CN106916813A (en) With the molecular labeling SVhd3 of millet breeding time gene close linkage
CN106916880A (en) With the molecular labeling SVhd1 of millet breeding time gene close linkage
CN106916878A (en) With the molecular labeling SVhd2 of millet breeding time gene close linkage
CN106916876A (en) With the molecular labeling SVhd4 of millet breeding time gene close linkage
CN106811465A (en) With the molecular labeling SVmc4 of hasked millet color gene close linkage
CN106811464A (en) With the molecular labeling SVmc1 of hasked millet color gene close linkage
CN106350515B (en) With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage
CN106350514B (en) With the molecular labeling OSblb-SV4 of Gene For Resistance To Rice Bacterial Blight close linkage
CN109797234A (en) With the molecular labeling R060939-2 of resistance gene of rice blast Pi2 close linkage
CN106086016B (en) A kind of wheat dough stablizes time molecular labeling QSt5B-488 and its application
CN109797235A (en) With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage
CN107177665B (en) Function-linked marker 0707-1 and application thereof in corn germplasm improvement

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170704

WD01 Invention patent application deemed withdrawn after publication