CN106893771B - Human fructose diphosphate aldolase B gene detection kit and detection method thereof - Google Patents
Human fructose diphosphate aldolase B gene detection kit and detection method thereof Download PDFInfo
- Publication number
- CN106893771B CN106893771B CN201710014355.XA CN201710014355A CN106893771B CN 106893771 B CN106893771 B CN 106893771B CN 201710014355 A CN201710014355 A CN 201710014355A CN 106893771 B CN106893771 B CN 106893771B
- Authority
- CN
- China
- Prior art keywords
- gene
- detection kit
- probe
- polymorphic sites
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a human fructose diphosphate aldolase B gene kit and a detection method, wherein the detection kit comprises a Taqman probe for specifically identifying 3 polymorphic sites on a human fructose diphosphate aldolase B gene and a primer pair corresponding to a gene segment where the polymorphic sites are amplified, the 3 polymorphic sites are A150P, A175D and N335K respectively, the probe comprises a wild-type probe and a mutant-type probe, and the primer pair comprises an upstream primer and a downstream primer. The kit provided by the invention is used for carrying out the six-fold fluorescence quantitative PCR reaction on a sample, can be used for quickly and efficiently detecting the genotypes of 3 polymorphic sites of the human fructose diphosphate aldolase B gene, and is a quick, simple, convenient, economic and efficient genetic fructose intolerance gene detection kit.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a human fructose diphosphate aldolase B gene detection kit and a detection method thereof.
Background
Hereditary Fructose Intolerance (HFI) is one of Fructose metabolic diseases, is an autosomal recessive Hereditary disease, and is caused by the deficiency or activity reduction of B-type aldolase due to the mutation of aldolase B gene (ALDOB gene), so that the Fructose metabolism of a patient is abnormal.
At present, the main technology for detecting the human fructose diphosphate aldolase B gene is gene sequencing, and has the defects of low flux, complex operation, long time consumption and the like.
The fluorescent quantitative PCR technology is a mature nucleic acid detection method. The advantages are that: the operation is simple, the pollution can be reduced due to the pipe closing operation, and the result analysis is quick. The Taqman probe technology is a gene detection technology for distinguishing allele types by detecting a fluorescent signal generated in a Polymerase Chain Reaction (PCR) process. Aiming at a gene locus to be detected, a pair of Taqman probes and corresponding upstream and downstream primers thereof are designed, wherein the probes are used for respectively detecting two alleles of a target locus. The 5 'end of each probe is marked with a fluorescent reporter group, and the 3' end is marked with a quenching group. In the PCR amplification process, the activity of the nuclease at the 5' end of Taq enzyme is utilized to degrade the probe which is combined on the single strand due to the complete complementarity with the target sequence, so that the fluorescent group is separated from the quenching group to generate fluorescence. If the probe is mismatched with the target sequence, it cannot bind to the single strand and does not produce fluorescence. Therefore, the genotype of the detected sample can be distinguished by collecting the change of the fluorescence signal during the PCR amplification by the fluorescent quantitative PCR instrument. The most outstanding advantage of the Taqman probe technology is that PCR post-treatment processes such as separation or elution are not required, the operation flow is simplified, and the detection speed is improved.
Disclosure of Invention
The invention aims to provide a high-accuracy, low-cost, high-throughput and rapid detection kit which can be used for detecting whether the human fructose diphosphate aldolase B gene has mutation.
The technical scheme adopted by the invention is as follows:
a detection kit for human fructose diphosphate aldolase B gene comprises a wild-type probe and a mutant-type probe which specifically identify polymorphic sites A150P, A175D and N335K on the human fructose diphosphate aldolase B gene, wherein the wild-type probe and the mutant-type probe corresponding to 3 polymorphic sites are shown in the following table:
TABLE 1 Probe sequences for the respective polymorphic sites
W represents a wild-type specific probe, and M represents a mutant-type specific probe.
Preferably, the 5 'and 3' ends of each probe are labeled with a fluorescent reporter group and a quencher group, respectively. The fluorescent reporter group may be one of FAM, TET, HEX, NED, TAMRA or ROX, and the quencher group may be BHQ-1 or BHQ-2.
Further, the kit also comprises primer pairs corresponding to 3 polymorphic sites on the gene for amplifying the human fructose bisphosphate aldolase B, wherein the primer pairs comprise an upstream primer and a downstream primer, and the upstream primer and the downstream primer corresponding to the 3 polymorphic sites are shown in the following table:
TABLE 2 primer sequences for respective polymorphic sites
F represents an upstream primer, and R represents a downstream primer.
The human fructose diphosphate aldolase B gene detection kit further comprises a homozygote standard substance and a heterozygote standard substance. A single polymorphic site has 3 types of typing, two homozygous types and one heterozygous type. Aiming at a group of systems, the method is applied to two homozygote standard products and one heterozygote standard product. The homozygote standard simultaneously corresponds to homozygotes of 3 polymorphic sites, and the heterozygote standard corresponds to heterozygotes of 3 polymorphic sites. The standard substance consists of plasmids containing polymorphic site amplification fragments.
The homozygote standard of one set of systems consists of 1 plasmid, and the heterozygote standard consists of 2 plasmids. The wild type homozygote standard 1 of the system consists of plasmids containing A150P-G type, A175D-C type and N335K-C type, the corresponding detection fluorescence reporter groups are FAM, HEX and TAMRA respectively, the mutant homozygote standard 2 consists of plasmids containing A150P-C type, A175D-A type and N335K-G type, the corresponding detection fluorescence reporter groups are NED, ROX and TET respectively, the heterozygote standard 3 consists of mixed plasmids of the wild type homozygote standard 1 and the mutant homozygote standard 2, and the detection fluorescence reporter groups are FAM, NED, HEX, ROX, TAMRA and TET respectively. The plasmid of wild-type homozygous standard 1 comprises the following sequence:
TCAGTGTTGTGATTAATGCTGATATGCTTGGCTGTTTTCAATCCTCAAGCACAGTGGATTGAAAGCTAAGCAAAGGGAGAACTCCTTCCCTTTATTAGAAGCCCCATGGATCAGGTACAAAGGTACAAAGAAGCCTTTCTCTCTTTTGTGACTTGCAGGGCTTGATGGCCTCTCAGAGCGCTGTGCTCAGTACAAGAAAGATGGTGTTGACTTTGGGAAGTGGCGTGCTGTGCTGAGGATTGCCGACCAGTGTCCATCCAGCCTCGCTATCCAGGAAAACGCCAACGCCCTGGCTCGCTACGCCAGCATCTGTCAGCAGGTGCTCTGCCTTCCCCTTGGGCTGAAAAAGAGTAGGCTAGAGTTTTCTTCAGAGCTTTTCTTTTCAATTATACTATAACTACAAATGGACCTCCTTTTCCCTCACCAGTATATCCTAGTGGCATTTTTCACAACTTTTGCTATAGCCAACTGTGGTAGGGAAAGATTTGGTAGAAGGGGATGGTATCCCCAGCAATATTCAGCAACATTGCTGTAAAAAGAAGAAAATCTGAGTGAAGGTTTGACTGGTTTCCCATGAGAGGCAGACAGGGTCAAGGTGGGGTCACATTTACTCTAACCAGTCTCCTCTCTCATATTTGTCTTCTAGGCTAACTGCCAGGCGGCCAAAGGACAGTATGTTCACACGGGTTCTTCTGGGGCTGCTTCCACCCAGTCGCTCTTCACAGCCTGCTATACCTACTAGGGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGAGCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTT(SEQ ID NO.13)。
the sequence of the mutant homozygote standard substance is as follows:
TCAGTGTTGTGATTAATGCTGATATGCTTGGCTGTTTTCAATCCTCAAGCACAGTGGATTGAAAGCTAAGCAAAGGGAGAACTCCTTCCCTTTATTAGAAGCCCCATGGATCAGGTACAAAGGTACAAAGAAGCCTTTCTCTCTTTTGTGACTTGCAGGGCTTGATGGCCTCTCAGAGCGCTGTGCTCAGTACAAGAAAGATGGTGTTGACTTTGGGAAGTGGCGTCCTGTGCTGAGGATTGCCGACCAGTGTCCATCCAGCCTCGCTATCCAGGAAAACGCCAACGCCCTGGCTCGCTACGACAGCATCTGTCAGCAGGTGCTCTGCCTTCCCCTTGGGCTGAAAAAGAGTAGGCTAGAGTTTTCTTCAGAGCTTTTCTTTTCAATTATACTATAACTACAAATGGACCTCCTTTTCCCTCACCAGTATATCCTAGTGGCATTTTTCACAACTTTTGCTATAGCCAACTGTGGTAGGGAAAGATTTGGTAGAAGGGGATGGTATCCCCAGCAATATTCAGCAACATTGCTGTAAAAAGAAGAAAATCTGAGTGAAGGTTTGACTGGTTTCCCATGAGAGGCAGACAGGGTCAAGGTGGGGTCACATTTACTCTAACCAGTCTCCTCTCTCATATTTGTCTTCTAGGCTAAGTGCCAGGCGGCCAAAGGACAGTATGTTCACACGGGTTCTTCTGGGGCTGCTTCCACCCAGTCGCTCTTCACAGCCTGCTATACCTACTAGGGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGAGCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTT(SEQ ID NO.14)。
the copy number of the same plasmid in the standard is consistent. The standard can be prepared by conventional T-A cloning method according to the gene sequence of human fructose diphosphate aldolase B disclosed in NCBI.
Further, the detection of the sample was achieved by six-fold fluorescent quantitative PCR, and 6 probes in the same set were labeled with different fluorescent colors. The fluorescent group of the probe is selected from FAM, TET, HEX, NED, TAMRA and ROX. FAM and NED probes are used for detecting the polymorphic site A150P, HEX and ROX probes are used for detecting the polymorphic site A175D, and TAMRA and TET probes are used for detecting the polymorphic site N335K.
The human fructose diphosphate aldolase B gene detection kit further comprises a PCR buffer solution, a hot start HS-Taq enzyme, ultrapure water, a homozygote standard substance and a heterozygote standard substance.
The invention also provides a detection method using the human fructose diphosphate aldolase B gene detection kit, which comprises the steps of carrying out amplification on 3 polymorphic sites of the human fructose diphosphate aldolase B gene in a sample by adopting a six-fold fluorescent quantitative PCR reaction, collecting a fluorescent signal in the reaction process by adopting a fluorescent quantitative PCR instrument, analyzing experimental data by using SDS software, and comparing the experimental data with a standard product to obtain a genotyping result.
Wherein, the amplification procedure of the six-fold fluorescence quantitative PCR reaction is as follows: initial denaturation, 10 min at 95 ℃; thermal cycling was carried out 40 times, each time at 95 ℃ for 15 seconds and then at 60 ℃ for 1 minute; and (5) preserving the heat at 16 ℃ after the circulation is finished.
The invention has the beneficial effects that:
(1) based on polymerase chain reaction, the template amount of polymorphic site detection is improved, and false positive is greatly reduced;
(2) the Taqman probe can detect the genotyping of at most 3 sites under one six-fold fluorescent quantitative PCR by being provided with different fluorescent reporter groups, and has the characteristics of high efficiency and saving;
(3) the six-fold fluorescent quantitative PCR reaction is completed within 2 hours, the specificity of the Taqman probe is high, and the detection method has the characteristics of less time consumption, rapidness and high accuracy;
(4) and the closed tube detection reduces artificial and environmental pollution and improves the accuracy.
(5) The operation and result judgment are simple: the whole PCR amplification process can be detected in real time through computer software, and the PCR amplification condition can be mastered at any time; the PCR amplification result is directly displayed on a computer without the steps of electrophoresis, dyeing and the like, thereby avoiding the subjectivity of using toxic reagents and judging the result by naked eyes.
Drawings
FIG. 1 is a detection map of a homozygote standard 1 in the kit, cross (FAM) represents A150P wild type, square (HEX) represents A175D wild type, Triangle (TAMRA) represents N335K wild type;
FIG. 2 is a detection map of homozygote standard 2 in the kit, diamond (NED) for the A150P mutant, cross (ROX) for the A175D mutant, and round (TET) for the N335K mutant;
FIG. 3 is a detection map of heterozygote standard 3 in the kit, cross (FAM) represents A150P wild type, diamond (NED) represents A150P mutant type, square (HEX) represents A175D wild type, cross (ROX) represents A175D mutant type, Triangle (TAMRA) represents N335K wild type, round (TET) represents N335K mutant type;
FIG. 4 is the detection map of example 1, in which crosses (FAM) represent the wild type A150P, squares (HEX) represent the wild type A175D, Triangles (TAMRA) represent the wild type N335K, indicating that the sample was a wild type homozygote;
FIG. 5 is a detection map of example 2, in which crosses (FAM) represent the wild type A150P, diamonds (NED) represent the mutant type A150P, squares (HEX) represent the wild type A175D, Triangles (TAMRA) represent the wild type N335K;
FIG. 6 is a test pattern of example 3, the cross (FAM) represents the wild type A150P, the square (HEX) represents the wild type A175D, the cross (ROX) represents the mutant type A175D, and the Triangle (TAMRA) represents the wild type N335K;
FIG. 7 is the detection profile of example 4, curves of different shape markers represent polymorphisms of different fluorophores and corresponding gene loci: diamonds (NED) represent mutant A150P, squares (HEX) represent wild type A175D, Triangles (TAMRA) represent wild type N335K.
Detailed Description
The present invention will be described in further detail with reference to the following detailed description and accompanying drawings. It will be understood by those skilled in the art that the following examples are illustrative of the present invention only and should not be taken as limiting the scope of the invention. The examples do not show the specific techniques or conditions, and the techniques or conditions are described in the literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, written by J. SammBruker et al, Huang Petang et al) or according to the product instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1: composition and using method of human fructose diphosphate aldolase B gene detection kit
The detection kit comprises a Taqman probe for specifically identifying 3 polymorphic sites on a human fructose diphosphate aldolase B gene detection and a primer pair corresponding to a gene segment where the polymorphic sites are amplified, and the primer pair is specifically shown in the following table:
TABLE 3 composition of the assay kit
The use method of the human fructose diphosphate aldolase B gene detection kit comprises the following steps:
1. extraction of sample DNA
According to the actual situation of the sample, selecting a proper method to extract the DNA of the sample, wherein the common methods comprise a magnetic bead method, an anion exchange resin method, an alkali cracking method and the like;
2. fluorescent quantitative PCR reaction
The amplification system of the fluorescent quantitative PCR reaction is as follows:
TABLE 4 fluorescent quantitative PCR reaction System
The amplification procedure for the fluorescent quantitative PCR reaction was as follows:
TABLE 5 fluorescent quantitative PCR amplification procedure
3. Software analysis to obtain results
The results data were analyzed using software SDS 2.4.
Example 2: establishing a standard map:
the homozygote standard substance and the heterozygote standard substance in the kit for detecting the gene for human fructose diphosphate aldolase B were detected by the method used in example 1, and the detection patterns of the homozygote standard substance and the heterozygote standard substance as shown in FIGS. 1 and 2 and FIG. 3 were obtained.
Example 3: sample detection
The sample No. one was examined according to the method used in example 1, and a map as shown in FIG. 4 was obtained, indicating that the sample No. one was a homozygous wild type.
Example 4: sample II assay
The results of the examination of sample II using the method of example 1 are shown in FIG. 5, and it was found that the mutation occurred at the target gene site A150P in sample II.
Example 5: sample detection of number three
The results of the detection of sample three according to the method used in example 1 are shown in FIG. 6, and it can be seen that the mutation is present at the target gene site A175D in sample three.
Example 6: sample four assay
The results of the detection of sample four using the method of example 1 are shown in FIG. 7, and it can be seen that the sample four has a mutation at the target gene site A150P.
SEQUENCE LISTING
<110> Guangdong Huamei Zhongyuan Biotech Co., Ltd
<120> human fructose diphosphate aldolase B gene detection kit and detection method thereof
<130>2016
<160>14
<170>PatentIn version 3.5
<210>1
<211>24
<212>DNA
<213> Artificial sequence
<400>1
ctttgggaag tggcgtgctg tgct 24
<210>2
<211>24
<212>DNA
<213> Artificial sequence
<400>2
ctttgggaag tggcgtcctg tgct 24
<210>3
<211>26
<212>DNA
<213> Artificial sequence
<400>3
gtgctcagta caagaaagat ggtgtt 26
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<400>4
<210>5
<211>24
<212>DNA
<213> Artificial sequence
<400>5
acagatgctg gcgtagcgag ccag 24
<210>6
<211>25
<212>DNA
<213> Artificial sequence
<400>6
acagatgctg tcgtagcgag ccagg 25
<210>7
<211>19
<212>DNA
<213> Artificial sequence
<400>7
ggaaggcaga gcacctgct 19
<210>8
<211>19
<212>DNA
<213> Artificial sequence
<400>8
catccagcct cgctatcca 19
<210>9
<211>24
<212>DNA
<213> Artificial sequence
<400>9
ttggccgcct ggcagttagc ctag 24
<210>10
<211>24
<212>DNA
<213> Artificial sequence
<400>10
ttggccgcct ggcacttagc ctag 24
<210>11
<211>25
<212>DNA
<213> Artificial sequence
<400>11
agaagaaccc gtgtgaacat actgt 25
<210>12
<211>21
<212>DNA
<213> Artificial sequence
<400>12
agaggcagac agggtcaagg t 21
<210>13
<211>840
<212>DNA
<213> Artificial sequence
<400>13
tcagtgttgt gattaatgct gatatgcttg gctgttttca atcctcaagc acagtggatt 60
gaaagctaag caaagggaga actccttccc tttattagaa gccccatgga tcaggtacaa 120
aggtacaaag aagcctttct ctcttttgtg acttgcaggg cttgatggcc tctcagagcg 180
ctgtgctcag tacaagaaag atggtgttga ctttgggaag tggcgtgctg tgctgaggat 240
tgccgaccag tgtccatcca gcctcgctat ccaggaaaac gccaacgccc tggctcgcta 300
cgccagcatc tgtcagcagg tgctctgcct tccccttggg ctgaaaaaga gtaggctaga 360
gttttcttca gagcttttct tttcaattat actataacta caaatggacc tccttttccc 420
tcaccagtat atcctagtgg catttttcac aacttttgct atagccaact gtggtaggga 480
aagatttggt agaaggggat ggtatcccca gcaatattca gcaacattgc tgtaaaaaga 540
agaaaatctg agtgaaggtt tgactggttt cccatgagag gcagacaggg tcaaggtggg 600
gtcacattta ctctaaccag tctcctctct catatttgtc ttctaggcta actgccaggc 660
ggccaaagga cagtatgttc acacgggttc ttctggggct gcttccaccc agtcgctctt 720
cacagcctgc tatacctact agggtccaat gcccgccagc ctagctccag tgcttctagt 780
aggagggctg aaagggagca acttttcctc caatcctgga aattcgacac aattagattt 840
<210>14
<211>840
<212>DNA
<213> Artificial sequence
<400>14
tcagtgttgt gattaatgct gatatgcttg gctgttttca atcctcaagc acagtggatt 60
gaaagctaag caaagggaga actccttccc tttattagaa gccccatgga tcaggtacaa 120
aggtacaaag aagcctttct ctcttttgtg acttgcaggg cttgatggcc tctcagagcg 180
ctgtgctcag tacaagaaag atggtgttga ctttgggaag tggcgtcctg tgctgaggat 240
tgccgaccag tgtccatcca gcctcgctat ccaggaaaac gccaacgccc tggctcgcta 300
cgacagcatc tgtcagcagg tgctctgcct tccccttggg ctgaaaaaga gtaggctaga 360
gttttcttca gagcttttct tttcaattat actataacta caaatggacc tccttttccc 420
tcaccagtat atcctagtgg catttttcac aacttttgct atagccaact gtggtaggga 480
aagatttggt agaaggggat ggtatcccca gcaatattca gcaacattgc tgtaaaaaga 540
agaaaatctg agtgaaggtt tgactggttt cccatgagag gcagacaggg tcaaggtggg 600
gtcacattta ctctaaccag tctcctctct catatttgtc ttctaggcta agtgccaggc 660
ggccaaagga cagtatgttc acacgggttc ttctggggct gcttccaccc agtcgctctt 720
cacagcctgc tatacctact agggtccaat gcccgccagc ctagctccag tgcttctagt 780
aggagggctg aaagggagca acttttcctc caatcctgga aattcgacac aattagattt 840
Claims (4)
1. A human fructose diphosphate aldolase B gene detection kit is characterized in that: the detection kit comprises a Taqman probe for specifically identifying 3 polymorphic sites on a human fructose diphosphate aldolase B gene and a primer pair corresponding to a gene segment for amplifying the polymorphic sites, wherein the 3 polymorphic sites are A150P, A175D and N335K respectively, the Taqman probe comprises a wild type probe and a mutant type probe, the primer pair comprises an upstream primer and a downstream primer, and the wild type probe, the mutant type probe, the upstream primer and the downstream primer corresponding to the 3 polymorphic sites are shown in the following table:
w represents a wild type probe, M represents a mutant type probe, F represents an upstream primer, R represents a downstream primer, 5' ends of 6 Taqman probes are marked with different fluorescent reporters, the probes with FAM and NED fluorescent reporters are used for detecting the polymorphic site A150P, the probes with HEX and ROX fluorescent reporters are used for detecting the polymorphic site A175D, and the probes with TAMRA and TET fluorescent reporters are used for detecting the polymorphic site N335K.
2. The human fructose bisphosphate aldolase B gene detection kit according to claim 1, wherein: the 3' end of the Taqman probe is marked with a quenching group, and the quenching group is BHQ-1 or BHQ-2.
3. The human fructose bisphosphate aldolase B gene detection kit according to claim 1, wherein: the detection kit also comprises a standard substance, wherein the standard substance comprises 2 plasmids respectively containing the sequences shown as SEQ ID NO.13 and SEQ ID NO. 14.
4. The human fructose bisphosphate aldolase B gene detection kit according to claim 1, wherein: the detection kit also comprises 10x fluorescent quantitative PCR reaction buffer solution, dNTPs mixed solution, HS-Taq enzyme and ultrapure water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710014355.XA CN106893771B (en) | 2017-01-09 | 2017-01-09 | Human fructose diphosphate aldolase B gene detection kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710014355.XA CN106893771B (en) | 2017-01-09 | 2017-01-09 | Human fructose diphosphate aldolase B gene detection kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106893771A CN106893771A (en) | 2017-06-27 |
| CN106893771B true CN106893771B (en) | 2020-10-16 |
Family
ID=59198358
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710014355.XA Active CN106893771B (en) | 2017-01-09 | 2017-01-09 | Human fructose diphosphate aldolase B gene detection kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106893771B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104267009A (en) * | 2014-09-16 | 2015-01-07 | 北京金诺美生物技术有限公司 | Six-color real-time fluorescence quantitative PCR (Polymerase Chain Reaction) analyzer |
| CN105087763A (en) * | 2014-05-16 | 2015-11-25 | 北京万泰生物药业股份有限公司 | Multiplex nucleic acid detecting method based on real-time fluorescence PCR (polymerase chain reaction) and probe method melting curve |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2014774A1 (en) * | 2007-07-11 | 2009-01-14 | Pathofinder B.V. | Assay for the simulataneous detection of multiple nucleic acid sequences in a sample |
-
2017
- 2017-01-09 CN CN201710014355.XA patent/CN106893771B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087763A (en) * | 2014-05-16 | 2015-11-25 | 北京万泰生物药业股份有限公司 | Multiplex nucleic acid detecting method based on real-time fluorescence PCR (polymerase chain reaction) and probe method melting curve |
| CN104267009A (en) * | 2014-09-16 | 2015-01-07 | 北京金诺美生物技术有限公司 | Six-color real-time fluorescence quantitative PCR (Polymerase Chain Reaction) analyzer |
Non-Patent Citations (1)
| Title |
|---|
| The spectrum of Aldolase B (ALDOB)mutations and the prevalence of hereditary fructose intolerance in central Europe;René Santer等;《HUMAN MUTATION》;20050510;第25卷(第6期);摘要，第2-4页MATERIALS AND METHODS部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106893771A (en) | 2017-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN116064747A (en) | Method for variant detection | |
| US20210246499A1 (en) | Detection of short homopolymeric repeats | |
| CN108220399B (en) | Fluorescent quantitative PCR method based on universal probe technology | |
| CN112458199B (en) | SNP molecular marker of rice salt-tolerant gene SKC1 and application thereof | |
| CN110628891A (en) | Method for screening embryo for gene abnormality | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| JP2012235777A (en) | Probe for detecting mutation in exon 12 of npm1 gene and use thereof | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN113355453B (en) | Cabbage type rape radish cytoplasm sterility restoring geneRfoSNP molecular marker and application thereof | |
| KR101739876B1 (en) | LAMP based methods and kits for detecting single base changes in target nucleic acids using allele or mutation specific primers | |
| CN110512023B (en) | Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence | |
| CN112442547A (en) | Development and application of SNP molecular marker of rice blast resistance gene Pita | |
| CN106893771B (en) | Human fructose diphosphate aldolase B gene detection kit and detection method thereof | |
| CN116004775A (en) | Primer probe composition, kit and method for quantifying copy number of human motor neurons | |
| CN106906280B (en) | Glucocerebrosidase gene detection kit and detection method thereof | |
| CN110484627B (en) | Method for monitoring genetic quality of A/J inbred line mice, primer set and application thereof | |
| CN105779570B (en) | A method of detection SNP site | |
| KR20120124029A (en) | Probe for detecting polymorphism, method of detecting polymorphism, method of evaluating drug efficacy and reagent kit for detecting polymorphism | |
| CN107400722B (en) | Competitive real-time fluorescent PCR SNP probe for detecting human genome | |
| CN112553349A (en) | Identification primer, probe, kit and method for homozygote and heterozygote of Hulunbel short-tailed sheep | |
| CN106244713B (en) | Method for detecting five-toe characters of Beijing fatty chicken and application thereof | |
| CN112359128A (en) | Detection method for establishing gene-edited rice based on pyrosequencing technology | |
| CN108315396B (en) | Novel method for simply and conveniently detecting SNP | |
| CN108841931B (en) | Primer group and detection kit for detecting STR locus of human chromosome 4 and application of primer group and detection kit | |
| CN111793676A (en) | Method and kit for detecting gene polymorphism and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |