CN106880714B

CN106880714B - Traditional Chinese medicine composition for treating asthma and preparation method and application thereof

Info

Publication number: CN106880714B
Application number: CN201510946521.0A
Authority: CN
Inventors: 贯剑; 宋红普; 郑杭生; 张若曦; 张彤; 张晓晓; 陈慧娟; 吕嵘; 王微; 岑怡; 冯茜
Original assignee: Shanghai Qixuan Health Management Consultation Co ltd
Current assignee: Shanghai Qixuan Health Management Consultation Co ltd
Priority date: 2015-12-16
Filing date: 2015-12-16
Publication date: 2020-06-16
Anticipated expiration: 2035-12-16
Also published as: CN106880714A

Abstract

The invention discloses a traditional Chinese medicine composition for treating asthma, which comprises the following components in parts by weight: 15-20 parts of roasted astragalus membranaceus, 9-12 parts of ginger processed pinellia tuber, 9-12 parts of scutellaria baicalensis, 9-12 parts of raw liquorice, 9-12 parts of roasted ephedra and 9-12 parts of dark plum. The invention further discloses a preparation method of the traditional Chinese medicine composition extracting solution and the liposome aerosol inhalant for treating asthma. In addition, the invention also discloses the medical application of the traditional Chinese medicine composition for treating asthma. The test proves that the traditional Chinese medicine composition has the functions of freeing lung and benefiting qi, relieving asthma and desensitizing, tonifying kidney and consolidating the constitution, has the efficacies of diminishing inflammation and relieving asthma in pharmacodynamics, and is mainly used for treating chronic duration and remission stage of asthma clinically.

Description

Traditional Chinese medicine composition for treating asthma and preparation method and application thereof

Technical Field

The invention relates to a traditional Chinese medicine composition for treating asthma, and in addition, the invention also relates to a preparation method and medical application of the traditional Chinese medicine composition.

Background

Bronchial asthma, abbreviated as asthma, is a common disease and frequently-occurring disease, and is a chronic inflammatory disease of an airway involving various cells and cell components, the chronic inflammation is related to airway hyperresponsiveness, and wide and variable reversible airflow limitation usually occurs, so that symptoms such as repeated wheezing, short breath, chest distress and/or cough and the like are caused, and the symptoms are usually caused and aggravated at night and/or in the early morning. Asthma has great harm to physical and mental health of people, the daily work and daily life of patients can be affected by poorly controlled asthma, the problems of maloperation and misclassification can be caused, even activity and motion limitation can be caused, the life quality is reduced, economic burden is brought, the life of the family is negatively affected, and if the patients have serious acute attack, the patients can be fatal if not timely treated. The current methods for treating asthma are mainly to take control drugs and relief drugs. The control medicine mainly maintains the clinical control of asthma through the anti-inflammatory effect, and the relieving medicine mainly relieves the asthma symptoms through quickly relieving bronchospasm. These drugs mainly control the clinical symptoms of asthma, cannot cure asthma radically, have great side effects and have high cost for controlling asthma.

Chinese patent CN101549015A in 2009-10-07 discloses a medicine for treating asthma, which consists of roasted ephedra herb, dioscorea nipponica makino, earthworm, schisandra chinensis and liquorice, wherein the raw material medicines are 5-10G of roasted ephedra herb, 5-15G of dioscorea nipponica makino, 5-15G of earthworm, 5-9G of schisandra chinensis and 5-15G of liquorice. The medicine for treating asthma provided by the invention belongs to a traditional Chinese medicine preparation, and pharmacodynamic experiments and clinical experiments prove that the medicine has the characteristics of treating both symptoms and root causes, quick response, good curative effect, no toxic or side effect, and convenient taking and carrying.

Chinese patent CN102580020A in 2012-07-18 discloses a traditional Chinese medicine composition for treating asthma, which solves the problems of unreasonable compatibility, poor curative effect, long treatment course and the like of the traditional Chinese medicine for treating asthma, and comprises 10-25 parts of semen brassicae, 12-25 parts of rhizoma corydalis, 10-15 parts of asarum, 8-12 parts of euphorbia kansui, 6-10 parts of cicada slough, 8-13 parts of rhizoma pinellinae praeparata, 10-20 parts of salvia miltiorrhiza and 30-50 parts of ginger, wherein the medicines are respectively ground into powder and then mixed to obtain medicinal powder, and then the medicinal powder is cleaned, peeled off, squeezed and filtered to prepare ginger juice, and then the medicinal powder is added into the ginger juice to prepare paste. The medicine has no stimulation to skin, no side effect, application to acupuncture points, lung warming, phlegm reducing, cough and asthma relieving, qi tonifying and yin nourishing, and obvious curative effect, quick response and high cure rate in treating respiratory diseases such as chronic bronchitis, emphysema and bronchial asthma.

Chinese patent CN101985031A in 2011-03-16 discloses a Chinese medicinal composition for treating asthma. The traditional Chinese medicine composition is prepared from the following raw materials, by weight, 5-15 parts of radix bupleuri, 10-20 parts of radix paeoniae alba, 15-25 parts of rhizoma gastrodiae, 15-25 parts of chrysanthemum, 25-35 parts of ruddle, 25-35 parts of raw dragon and oyster respectively, 10-20 parts of inula flower, 15-25 parts of semen raphani, 25-35 parts of radix cyathulae, 45-55 parts of fructus trichosanthis, 10-20 parts of fructus arctii, 15-25 parts of rhizoma sparganii, 15-25 parts of rhizoma zedoariae, 80-120 parts of fructus aurantii immaturus, 25-35 parts of fructus citri sarcodactylis, 70-90 parts of cortex magnoliae officinalis, 6-10 parts of rhizoma zing.

The invention strictly selects the components according to the cognition mechanism of the traditional Chinese medicine theory on asthma, and the prepared traditional Chinese medicine has good curative effect, short course of treatment, convenient material acquisition of the selected medicinal materials, low price and extremely high cost performance for patients.

The original formula also contains a part of insect traditional Chinese medicines with antiallergic and antiasthmatic effects, so that the possibility of asthma caused by inhalation is avoided, and the curative effect is possibly influenced. The currently selected formula has the main effects of tonifying lung and relieving asthma, takes the principal and subordinate symptoms into consideration, can better relieve the attack of asthma and reduce relapse, but has slight deficiency in tonifying kidney from the perspective of traditional Chinese medicine, so patients should be ordered to take the Chinese patent medicine for tonifying kidney in flat time during clinical application.

Disclosure of Invention

In view of the above-mentioned deficiencies in the prior art, according to the embodiment of the present invention, it is desirable to provide a traditional Chinese medicine composition for treating asthma, which has advantages of good curative effect, short treatment course, convenient material selection of selected medicinal materials, low price, and extremely high cost performance for patients. The invention also provides a preparation method and medical application of the traditional Chinese medicine composition for treating asthma.

According to the embodiment, the traditional Chinese medicine composition for treating asthma provided by the invention has the innovation points that the traditional Chinese medicine composition comprises the following components in parts by weight: 15-20 parts of roasted astragalus membranaceus, 9-12 parts of ginger processed pinellia tuber, 9-12 parts of scutellaria baicalensis, 9-12 parts of raw liquorice, 9-12 parts of roasted ephedra and 9-12 parts of dark plum.

According to one embodiment, the traditional Chinese medicine composition for treating asthma is any one of pharmaceutically acceptable dosage forms.

According to one embodiment, the traditional Chinese medicine composition for treating asthma is an extracting solution or liposome aerosol inhalant.

According to the embodiment, the preparation method of the traditional Chinese medicine composition extracting solution for treating asthma provided by the invention comprises the following process steps:

● weighing the raw materials in parts by weight;

● soaking the above materials except Scutellariae radix in 6-10 times of water, heating to boil, adding Scutellariae radix, decocting for 1-3 hr, filtering, and collecting filtrate; adding 4-8 times of water into the residue, heating to boil, decocting for 0.5-2 hr under boiling, filtering, and collecting filtrate;

● mixing the filtrates, and concentrating; adding ethanol into the concentrated solution to make the alcohol content reach 70%, and refrigerating;

● vacuum filtering the medicinal liquid after ethanol precipitation, recovering ethanol from the filtrate, and concentrating; adding ethanol into the concentrated solution to make the alcohol content reach 85%, and refrigerating; filtering the ethanol precipitation solution, rotary evaporating to recover ethanol, and concentrating.

According to the embodiment, the preparation method of the traditional Chinese medicine composition liposome aerosol inhalant for treating asthma provided by the invention comprises the following process steps:

placing the prescription dose of soybean phospholipid (sbPC), Cholesterol (CH) and Vitamin E (VE) into an eggplant-shaped bottle, adding a dichloromethane-methanol mixed solvent with the volume concentration of 5:2 to dissolve, carrying out reduced pressure rotary evaporation at the temperature of 45 ℃ and the rotating speed of 40r/min to remove the solvent to prepare a dry film, blowing a nitrogen gas to remove residual solvent, diluting the extracting solution prepared by the method with distilled water, pouring into the eggplant-shaped bottle, shaking to hydrate the dry film, and extruding to pass through a polycarbonate film with a proper pore diameter after the dry film is completely hydrated. The following examples and experimental examples will prove that the traditional Chinese medicine composition for treating asthma (also called a root-securing asthma-relieving prescription) has the effects of freeing lung, tonifying qi, relieving asthma, desensitizing, tonifying kidney and strengthening the root, has the efficacies of diminishing inflammation and relieving asthma in pharmacodynamics, and is mainly used for treating chronic duration and remission stage of asthma clinically.

Drawings

FIG. 1 is a graph showing the pathological changes of lung tissues in test example 4 of the present invention (group A: pulmonary artery wall thickening X200);

FIG. 2 is a graph showing pathological changes in lung tissues in test example 4 of the present invention (group A: mild thickening of pulmonary artery wall, mild interstitial pneumonia X200);

FIG. 3 is a graph showing the pathological changes of lung tissues in test example 4 of the present invention (group B: thickening of pulmonary artery wall, filling of bronchiole with inflammatory secretion X200);

FIG. 4 is a graph showing pathological changes in lung tissue in test example 4 of the present invention (group B: thickening of pulmonary artery wall, proliferation of pulmonary interstitial fiber tissue, and filling of bronchioles with inflammatory secretions);

FIG. 5 is a graph showing the pathological changes observed in lung tissue in test example 4 of the present invention (group C: small infiltration of inflammatory cells into the bronchioles and the periphery of the lung, and small secretion in the lung X100);

FIG. 6 is a graph showing the pathological changes observed in lung tissue in test example 4 of the present invention (group C: destruction of small focal lung tissue structure with partial proliferation of granulation tissue X200);

FIG. 7 is a graph showing the pathological changes of lung tissues in test example 4 of the present invention (group D: thickening of pulmonary artery wall, small amount of secretion in bronchiole lumen. times.200);

FIG. 8 is a graph showing pathological changes in lung tissues in test example 4 of the present invention (group D: thickening of pulmonary artery wall, small amount of secretion in bronchiole lumen, and interstitial pneumonia locally X200);

FIG. 9 is a graph showing the pathological changes of lung tissues in test example 4 of the present invention (group E: pulmonary artery wall thickening, mild interstitial pneumonia X200);

FIG. 10 is a graph showing the pathological changes observed in lung tissue in test example 4 of the present invention (group E: structural destruction of a large piece of lung tissue with proliferation of a part of granulation tissue, thickening of pulmonary artery wall X200);

FIG. 11 is a graph showing the pathological changes of lung tissues in test example 4 of the present invention (group F: pulmonary artery wall thickening, mild interstitial pneumonia X200);

FIG. 12 is a graph showing the pathological changes of lung tissues in test example 4 of the present invention (group F: multiple focal lung tissue destruction with inflammatory cell infiltration, pulmonary artery wall thickening X200).

Detailed Description

The invention is further illustrated with reference to the following figures and specific examples. These examples are to be construed as merely illustrative and not limitative of the remainder of the disclosure in any way whatsoever. After reading the description of the invention, one skilled in the art can make various changes and modifications to the invention, and such equivalent changes and modifications also fall into the scope of the invention defined by the claims.

The reagents, materials and instruments involved in the following examples and experimental examples of the present invention are (the manufacturers, models, lot numbers and series of the reagents, materials and instruments are not listed in the specific examples and experimental examples):

LC-2130 high performance liquid chromatograph (Shanghai Tianmei Co.);

LC-2030 ultraviolet detector (Shanghai Tianmei Corp.);

laser scattering particle size analyzer (Malvern, uk);

agilent-1100 series high performance liquid chromatograph (Agilent corporation);

ALLTECH 3300E-ELSD (ALLTECH Corp.);

rotary evaporators (R series, shanghai shengsheng technologies ltd);

an electric heating constant temperature water bath (XMTF-6000, Shanghai Shensheng science and technology Co., Ltd.);

an SHB-IIIA circulating water type multipurpose vacuum pump (Zhengzhou great wall science, industrial and trade Co., Ltd.);

refrigerated centrifuge (5417R, EPPENDOF, Germany);

a Homoex-25 high pressure film extruder (Hermeis electromechanical technologies, Inc.);

BK1301 biomicroscopes (chongqing optical instrument factory);

BS 124S electronic balance (sartorius, germany);

a pH meter (model: PHS-3C, Shanghai precision scientific instruments Co., Ltd.);

SIL C18 column (4.5 mm. times.250 mm,5 μm packing, CNW Corp.);

cholesterol (CH, batch No. F20041228, chemical Co., Ltd., national drug group);

vitamin E (V)_EThe batch number is: 082K1382, Sigma corporation);

soya lecithin (sbPC, injection grade, PC content greater than 70%, lot number 050602, Shanghai Taiwei pharmaceutical Co., Ltd.);

vertical membrane ultrafiltration centrifuge tubes (Vivaspin500, MWCO: 100k, Sadoris, Germany);

polycarbonate Track Etched Membranes (Nuclecore Track-Etched Polycarbonate Membranes, Wichman, UK);

dichloromethane (analytically pure, lot number: T20100913, national drug group chemical Co., Ltd.);

methanol (analytically pure, batch number: T20101029, chemical reagents of national drug group, Ltd.);

HPLC with methanol (chromatographically pure, batch: K3LG2H, Honeywell Burdick & Jackson);

the HPLC water was ultrapure water.

Ethanol (Synthesis grade, batch No. 20100927, national drug group chemical Co., Ltd.)

Phosphoric acid (analytically pure, batch number: T20100903, national drug group chemical reagents Co., Ltd.)

Baicalin (Baicalin) reference (batch number: 110715-201016 China institute for biological products of drugs)

Astragaloside IV reference substance (batch number: 110781-

Radix astragali Preparata: batch number: 110725 and 110808, Shanghai Kangqiao herbal pieces Limited;

ginger processed pinellia: batch number: 110304 Shanghai Kangqiao Chinese herbal pieces Limited;

scutellaria baicalensis: batch number: 110715, Shanghai Kangqiao Chinese medicinal decoction pieces Limited;

raw licorice root: batch number: 110805, Shanghai Kangqiao Chinese medicinal decoction pieces Limited;

roasting ephedra: batch number: 110622, Shanghai Kangqiao Chinese medicinal decoction pieces Limited;

dark plum: batch number: 101028 Shanghai Kangqiao Chinese medicinal decoction pieces Co. Example 1 (extraction Process of the extract of the prescription for consolidating the constitution and relieving asthma)

Through research and study of literature, volatile components and water-soluble high molecular weight components (such as starch, polysaccharide and protein) in the traditional Chinese medicine prescription for strengthening the foundation and relieving asthma are not effective components for treatment, so a water extraction and alcohol precipitation method is adopted by adopting a common extraction and purification process of the traditional Chinese medicine prescription, and the conventional process parameters are adopted.

1.1 decoction and alcohol precipitation of herbs of formula for consolidating foundation and relieving asthma

The method comprises the following operation steps:

weighing the medicinal materials: weighing radix astragali Preparata 25g, rhizoma Pinelliae Preparada 15g, Scutellariae radix 15g, Glycyrrhrizae radix 15g, herba Ephedrae 15g, mume fructus 15g (total 100g) according to the proportion

Decocting the medicinal materials for the first time: adding 8 times of water (800ml) into the other medicinal materials except Scutellariae radix, soaking for 30min, heating to boil, adding Scutellariae radix, decocting under boiling for 1.5 hr, filtering, and collecting filtrate.

Decocting the medicinal materials for the second time: adding 6 times of water (600ml) into the residue, heating to boil, decocting for 1 hr, filtering, and collecting filtrate.

Concentration: the filtrates from the first two decoctions were combined and concentrated to 100ml (rotary evaporation). (conditions: water bath temperature 70 ℃ C., rotation speed 40 rpm)

Alcohol precipitation: adding 280ml ethanol into 100ml concentrated solution to make the ethanol content reach 70%, and refrigerating for 24 h.

1.2 purification of decoction of medicinal herbs for consolidating body resistance and relieving asthma

The method comprises the following operation steps:

and (3) recovering ethanol: filtering the medicinal liquid obtained by the above steps, recovering ethanol from the filtrate, and concentrating in water bath to 60ml (conditions: water bath temperature 60 deg.C, rotation speed 40r/min)

Alcohol precipitation: adding 510ml ethanol into the above 60ml concentrated solution to make the ethanol content reach 85%, and refrigerating for 24 h.

Concentration: filtering the ethanol precipitation solution, rotary evaporating to recover ethanol (conditions: 60 deg.C, 40r/min), and concentrating the water bath solution to 50mL (2g/mL) for use.

Remarking: the detection shows that the transfer rate of baicalin is 31.2 percent and the transfer rate of astragaloside IV is 48.3 percent in the extraction and purification process, and basically meets the requirements.

Example 2 (preparation of liposome aerosol inhalant for consolidating foundation and relieving asthma)

2.1 selection of the Process)

According to the previous study of liposomal formulations in this subject group, the following formulations were tentatively set: 0.3g of sbPC, 0.05g of CH, 0.005g of VE0, 7.5mL of extract of Guben Pingchuan, and 7.5mL of distilled water.

The preparation process is tentatively as follows: placing sbPC, CH and VE in a prescription amount into an eggplant-shaped bottle, adding a dichloromethane-methanol (5:2) mixed solvent for dissolving, performing reduced pressure rotary evaporation (45 ℃, 40r/min), removing the solvent to obtain a dry film, blowing a film with nitrogen for several minutes to remove residual solvent, diluting the extract of the root-strengthening asthma-relieving prescription with distilled water, pouring the diluted extract into the eggplant-shaped bottle, shaking the hydrated dry film, and extruding the extract to pass through a polycarbonate film with a proper aperture after the hydrated completely.

Observing the finished product under a microscope, a large number of vesicle-shaped structures can be seen, which indicates that the liposome is prepared and shaped, the vesicle has uniform particle size and is approximately round, but is aggregated into a cluster.

2.2 investigation of Process influencing factors

The encapsulation efficiency is taken as an index, and the influence of the dosage and the particle size of the factors on the quality of the liposome finished product is examined.

2.2.1 lipid dosage

According to the provisional recipe under item "2.1", the recipe amount of the extract solution of the root-strengthening and asthma-relieving prescription is 7.5mL, the recipe amount of distilled water is 7.5mL, sbPC 0.3g, CH 0.05g and VE0.005g are defined as 1 unit of lipid amount, five levels of lipid amounts of 1, 2,3, 4 and 5 are set to obtain recipes of five different lipid amounts, liposomes are prepared by the process under item "2.1", respectively, and the encapsulation efficiency is measured by passing through a polycarbonate membrane with a pore size of 0.2 μm, respectively, and as a result, see table 2-1 below, it can be seen that the encapsulation efficiency is superior to that of the recipe of other lipid amounts in the case of a small lipid amount for the recipe of 2 unit of lipid amount for different lipid amounts, and 2 units are the optimum level of lipid amount.

TABLE 2-1 encapsulation efficiency measurements for samples of different lipid dosages

2.2.2 particle size

According to the table 1, the encapsulation efficiency of the liposome is higher under the dosage levels of three lipids, namely 2, 4 and 5, two parts of the liposome at the three levels are prepared again according to the process under the item '2.1', the encapsulation efficiency is respectively measured by polycarbonate membranes with the pore diameters of 0.2 mu m and 0.4 mu m, and the results are shown in the table 2-2, and the influence of different particle diameters on the drug encapsulation efficiency is smaller. Therefore, the particle size of the liposome is set to be 0.4 μm in consideration of the convenience of the filtration through the carbonate membrane.

TABLE 2-2 encapsulation efficiency measurements for samples of different particle sizes

2.3 optimal Process determination

According to the prescription process selection and the influence factor test result, the optimal prescription is determined as sbPC 0.6g, CH0.1g, VE 0.01g, the extract of the root-strengthening asthma-relieving prescription is 7.5mL, and the distilled water is 7.5 mL.

The preparation process comprises the following steps: placing sbPC, CH and VE in prescription amount into an eggplant-shaped bottle, adding dichloromethane-methanol (5:2) mixed solvent for dissolving, performing rotary evaporation under reduced pressure (45 ℃, 40r/min), removing solvent to obtain a dry film, blowing a film with nitrogen for several minutes to remove residual solvent, diluting the extract of the root-strengthening asthma-relieving prescription with distilled water, pouring into the eggplant-shaped bottle, shaking to hydrate the dry film, and extruding to pass through a 0.4 mu m polycarbonate film after complete hydration to obtain the product.

2.4 Process verification and amplification

2.4.1 sample preparation

The sample preparation was carried out according to the prescription process under item "2.3", and the following three batches of samples were prepared according to the 1-fold prescription: lot numbers 110908, 110910, 110918, respectively; sample lot number 110928 was prepared in 133 prescription amounts.

2.4.2 sample encapsulation efficiency determination

Collecting root-strengthening asthma-relieving liposome samples (with lot numbers of 110908, 110910, 110918 and 110928 respectively), and centrifuging and ultrafiltering (measuring process: collecting liposome suspension sample to be measuredShaking, precisely measuring 200 μ L, placing in an ultrafiltration centrifuge tube, performing refrigerated centrifugation (relative centrifugal force: 15000g, temperature: 5 deg.C), collecting all external water phase, transferring into a 25mL measuring flask, adding methanol to desired volume, shaking, and subjecting to specified chromatographic conditions (chromatographic column: octadecylsilane bonded silica gel as filler (CNW, 250 mm. times.4.6 mm,5 μm), methanol-phosphoric acid water solution [ water-phosphoric acid (53:0.2) ]](58:42) is a mobile phase; the detection wavelength was 280 nm. Under the condition, baicalin can be completely separated from other components (R is more than or equal to 1.5), the number of theoretical plates is not less than 2500 according to the baicalin peak), 10 mu L of sample injection is carried out for determination, the drug content in the external water phase is calculated according to a standard curve, and the encapsulation efficiency is calculated according to the following formula: EE ═ W_S-W_EA)/W_SX 100%, wherein EE is the encapsulation efficiency; w_SThe content (mg) of baicalin in the sample amount is obtained; w_EAIs baicalin content (mg) in external water phase. Triplicate determinations were made for each sample and averaged. ) The results of the measurements are shown in tables 2-3.

TABLE 2-3 encapsulation efficiency measurement results of samples

2.4.3 measurement of sample particle size

The root-strengthening asthma-relieving square liposome samples (lot numbers are 110908, 110910, 110918 and 110928 respectively) were taken, diluted by an appropriate amount with a hydration solution, and measured with a laser scattering particle size analyzer, and the results are shown in tables 2 to 4.

Tables 2-4 results of particle size measurement of samples

2.4.4 measurement of Zeta potential of sample

The root-strengthening asthma-relieving square liposome samples (lot numbers 110908, 110910, 110918 and 110928 respectively) were taken and measured by a laser scattering particle size analyzer, and the results are shown in tables 2 to 5.

TABLE 2-5 Zeta potential measurement results of samples

2.4.5 results of content measurement of sample

Taking a root-securing asthma-relieving square liposome sample (the batch numbers are 110908, 110910, 110918 and 110928 respectively), and determining by an HPLC method (determination process: taking 1mL of a sample to be determined, placing the sample into a 25mL measuring flask, adding methanol for dissolving, diluting and fixing the volume, shaking up, taking 2mL of the obtained solution, placing the solution into a 10mL measuring flask, adding methanol for diluting and fixing the volume, shaking up to obtain a sample solution, injecting 10 mu L of the sample for HPLC determination, quantifying and calculating the content of the sample by a standard curve method, parallelly determining three parts of each sample, and calculating the average value), wherein the results are shown in tables 2-6.

TABLE 2-6 results of content determination of samples

Test examples 1 to 6

The traditional Chinese medicine compound root-strengthening and asthma-relieving prescription (comprising radix astragali preparata, ginger processed pinellia tuber, radix scutellariae, raw liquorice, herba ephedrae preparata and dark plum) is optimally compatible by combining modern research progress on the basis of empirical prescription, and has the effects of tonifying qi, relieving asthma, desensitizing and detoxifying. The traditional Chinese medicine aerosol inhalation has a good effect on treating asthma, but the mode is simple aerosol inhalation, most clinical observation only stays in the experience level, the mechanism of experimental research is unclear, and deep mechanism research is lacked. The medicine is prepared into a proper nano carrier, so that the medicine can be selectively adhered to tracheal and bronchial mucosa when the medicine is atomized and inhaled, the local inflammation of the respiratory mucosa is directly relieved, a medicine storage is formed locally, and the action time is prolonged, so that the bioavailability is greatly improved, and the medicine effect is improved. Therefore, the extract of the solid foundation asthma-relieving prescription is prepared by adopting an extraction and purification process, namely a water extraction and alcohol precipitation method, then the nano liposome of the solid foundation asthma-relieving prescription is prepared by adopting a film hydration method, and is diluted into the liposome aerosol inhalant of the solid foundation asthma-relieving prescription, and the guinea pig is inhaled through the aerosol inhalant to objectively observe and evaluate the treatment effect of the liposome aerosol inhalant, discuss the action mechanism at the cell and gene level, study the pharmacodynamics and toxicology of the liposome aerosol inhalant, and lay a foundation for clinical popularization and application.

Test example 1 (Effect of the Liposome Aerosol inhalant for consolidating constitution and relieving asthma on asthma Guinea pig symptoms and blood routine)

1. Experimental Material

1.1 medicaments

1.1.1 therapeutic medications: the liposome aerosol inhalant for strengthening body resistance and relieving asthma comprises: contains crude drug 1g per ml, and is provided by Chinese academy of medicine of Shanghai university of medicine.

1.1.2 Positive control: xiaoqinglong mixture, produced by Hubeifu pharmaceutical Co Ltd, is in the Chinese medicine standard Z42021495. The main functions are relieving exterior syndrome and resolving fluid retention, relieving cough and asthma, and treating cold and water retention, aversion to cold, fever, no sweat, cough and asthma with thin phlegm. Each bottle is filled with 10 ml. Dexamethasone acetate tablets, produced by Shanxi Henry pharmaceutical Co., Ltd, national Standard H14022127, Specification: 0.75 mg/tablet.

1.2 Experimental animals

39 healthy England species of UK, with weights of 250-300 g, were provided by the laboratory animal center of Shanghai medical university, and the certification number of the laboratory animal of the general grade, SYXK 2004-

1.3 devices and reagents

1.3.1 apparatus

The Bellis ultrasonic atomizer (model BSW-2A) is manufactured by Bellis electronics, Inc., Anshan. A fully automatic hemocyte analyzer (Xismen (XE-2100) manufactured by SYSMEX CORPORATION, Japan.

1.3.2 reagents

Egg albumen powder (OVA), produced by national drug group chemical reagents Co., Ltd. (batch No.: F20110811)

2 method

2.1 molding method:

the guinea pigs were normally kept for 1 week before being sensitized. On day 1, after the local skin was disinfected with 75% ethanol solution, 1.6ml (6ml/Kg, with 0.1ml loss) of 10% egg protein physiological saline solution was injected into the abdominal cavity of each guinea pig in the asthma model group, the high dose group, the low dose group, the traditional Chinese medicine control group, and the western medicine control group for sensitization. The blank control group was treated with 0.9% physiological saline. On day 8, sensitization was re-injected, and the doses and methods were the same for each group. On day 14, the onset of asthma was initiated and guinea pigs were placed in a 4L glass bell and inhaled by nebulization with 1% egg protein for 15-30S, and 20-30S observed to induce asthma attacks (indicating model success). For example, a guinea pig may have convulsions and be removed immediately. Asthma induction was performed 1 time every other day until the end of the experiment. Meanwhile, from day 14 onward, each group was treated accordingly 1 hour after the onset of asthma. By day 28, each group of animals was sacrificed and samples were taken.

2.2 grouping and treatment methods:

a normal control group: sensitization, stimulation and treatment were replaced with 0.9% saline.

Asthma model group B: after the molding is successful, 1% OVA solution is inhaled for excitation 1 time each day.

C traditional Chinese medicine control group: atomizing and inhaling the small Qinglong mixture for 1 g/time.

D, the root-strengthening asthma-relieving formula liposome aerosol inhalant small-dose group comprises: 1 g/time of the aerosol inhalant.

E, constitution consolidating and asthma relieving formula liposome aerosol inhalant large dose group: the inhalant is atomized 3 g/time.

And F, western medicine control group: dexamethasone was inhaled by nebulization at 1 g/time.

2.3 detection method, adopting a full-automatic blood cell analysis device to automatically analyze the blood routine complete set.

2.4 statistical methods

All measurements were averaged. + -. standard deviation

Mode representation, mean comparison between groups is performed by analysis of variance, P<0.05 indicates that the difference is statistically significant. Statistical analysis was performed using the sps 12.0 statistical software.

3 results

3.1 general case Change:

the symptoms of all groups are different after being stimulated, normal control guinea pigs in the group A show mental activity, sensitive reaction, stable respiration and no obvious tachypnea, difficulty and asthmatic sound, the guinea pigs in the model group and all the drug groups show restlessness, scratching face and the like shortly after the OVA is inhaled, and part of the guinea pigs show tachypnea, abdominal respiration, even asthmatic sound and the like. At the last challenge, the guinea pigs in the group D were treated with small doses without wheezing and dyspnea, and 2-3 guinea pigs in each of the other treatment groups had mild tachypnea, wheezing, etc.

3.2 blood routine changes:

compared with other groups, the WBC and EO levels of the model group are obviously increased, and the difference is statistically significant. The normal group had a lower average EO level than the other groups, and the differences were statistically significant. D. The BA level in E, F group was significantly increased compared to the model group, and there was also a difference in D, F group compared to C group. The PMNs of group A and group B were statistically significant, and the remaining groups were indistinguishable. Group B was significantly different from group a in Ly, and group D, E, F was statistically different from group B. See Table 1 for details

TABLE 1 Effect of the liposome aerosol inhalant for consolidating body constitution and relieving asthma on the general effects of asthmatic guinea pig blood (x 10)⁹/L)

Note that P <0.05 and P <0.01 in group A, △ P <0.05 and △△ P <0.01 in group B, and P <0.05 and △ # # P <0.01 in group C

Discussion 4

Bronchial asthma is a chronic airway inflammatory disease, allergic inflammation caused by repeated allergen exposure is the basic mechanism of most asthma attacks, White Blood Cells (WBC) increase is the main expression of bacterial inflammation, but increased peripheral blood WBC is also found in asthma animal experiments, the traditional Chinese medicine compound can significantly reduce rat peripheral blood WBC compared with model group [ the experiment research on asthma rat airway remodeling and inflammatory mediators by Xiongh, lung antiasthmatic prescription [ J ], Hubei academy of China, 2009, 5, 30: 10 ] the characteristic marker of asthma inflammation is Eosinophil (EOS) infiltration, Eosinophil Cationic Protein (ECP), basic protein (ECP), eosinophil-derived neurotoxin (EDN), eosinophil peroxidase (LY) and other special protein particles such as multiple inflammatory mediators, cytokines and eoS release histamine (generating hyper-responsiveness (EOR), therefore the hyper-responsiveness is the cause of asthma attack, the transient response, the clinical pathogenesis of asthma, the acute respiratory dysfunction of asthma, acute respiratory dysfunction of leukemia, acute respiratory dysfunction of leukemia, acute dysfunction of leukemia, acute stroke, acute dysfunction of leukemia, acute dysfunction of asthma, acute dysfunction of leukemia, acute dysfunction of asthma, acute dysfunction of leukemia.

Test example 2 (Effect of the Liposome Aerosol inhalant for consolidating constitution and relieving asthma on the immunology of asthma guinea pig)

1. Experimental Material

1.1 medicaments

1.1.2 Positive control: xiaoqinglong mixture, produced by Hubeifu pharmaceutical Co Ltd, is in the Chinese medicine standard Z42021495. The main functions are relieving exterior syndrome and resolving fluid retention, relieving cough and asthma, and treating cold and water retention, aversion to cold, fever, no sweat, cough and asthma with thin phlegm. Each bottle is filled with 10 ml. Dexamethasone acetate tablet Shanxi Henry pharmaceutical Co., Ltd, national Standard H14022127, Specification: 0.75 mg/tablet.

1.2 Experimental animals

1.3 devices and reagents

1.3.1 apparatus

The Bellis ultrasonic atomizer (model BSW-2A) is manufactured by Bellis electronics, Inc., Anshan. A general microplate reader (model ELX 800) manufactured by Bio-Tek, USA. A plate washer (model ELX 50) was manufactured by Bio-Tek, USA. Adjustable multi-channel pipette (200ul) produced by GILSON, france. A pipette (P20\ P200\ P1000) produced by French GILSON. A water-proof constant temperature box (PYX-DHS type) is manufactured by jumping into a factory of medical instruments.

1.3.2 reagents

Egg albumen powder (OVA), produced by national drug group chemical reagents, Inc. (batch number: F20110811), Guinea Pig interleukin-4 (Guinea Pig IL-4) ELISA kit, Guinea Pig interleukin-5 (Guinea Pig IL-5) ELISA kit, Guinea Pig interleukin-12 (Guinea Pig IL-12) ELISA kit, Guinea Pig interleukin-25 (Guinea Pig IL-25) ELISA kit, Guinea Pig interferon-gamma (Guinea Pig IFN-gamma) ELISA kit were provided by Shanghai Kanu Biotechnology Inc.

2 method

2.1 molding method:

2.2 grouping and treatment methods:

2.3ELISA reagent detection method:

2.3.1 sample Collection, processing and preservation methods

(1) Serum: using a tube without pyrogen and endotoxin, any cell irritation was avoided during the procedure, and after collecting blood, serum and erythrocytes were rapidly and carefully separated by centrifugation at 3000 rpm for 10 minutes.

(2) Plasma: EDTA, citrate or heparin anticoagulation. The supernatant was centrifuged at 3000 rpm for 30 minutes.

(3) Cell supernatant: the particles and polymer were removed by centrifugation at 3000 rpm for 10 minutes.

(4) Tissue homogenization: mashing the tissue with proper amount of normal saline. The supernatant was centrifuged at 3000 rpm for 10 minutes.

(5) And (3) storage: if the sample cannot be detected in time after being collected, the sample is required to be subpackaged according to the dosage of one time, frozen and stored at the temperature of minus 20 ℃, repeated freezing and thawing is avoided, the sample is thawed at room temperature, and the sample is ensured to be uniformly and fully thawed.

2.3.2 preparation of reagents

20 × dilution of wash buffer: distilled water is added according to the weight ratio of 1: 20 dilutions, i.e. 1 part of 20 × wash buffer plus 19 parts of distilled water.

2.3.3 working step

(1) The desired panel was removed from the aluminum foil bag after equilibration for 20min at room temperature, and the remaining panels were sealed with a zip-lock bag and placed back at 4 ℃. (2) Setting standard substance holes and sample holes, wherein 50 mu L of standard substances with different concentrations are added into the standard substance holes respectively; (3) firstly adding 10 mu L of sample to be detected into the sample hole, and then adding 40 mu L of sample diluent; blank wells were not added. (4) In addition to blank wells, 100. mu.L of detection antibody labeled with horseradish peroxidase (HRP) was added to each of the standard wells and the sample wells, the reaction wells were sealed with a sealing plate film, and incubated in a 37 ℃ water bath or incubator for 60 min. (5) Discarding liquid, drying on absorbent paper, filling each hole with cleaning solution, standing for 1min, throwing off cleaning solution, drying on absorbent paper, and washing the plate for 5 times (or washing the plate with plate washing machine). (6) 50. mu.L of substrate A, B was added to each well and incubated at 37 ℃ for 15min in the absence of light. (7) Add stop solution 50. mu.L per well, measure OD value of each well at 450nm wavelength within 15 min.

2.3.4 determination of results

Drawing a standard curve: and in an Excel worksheet, drawing a linear regression curve of the standard substance by taking the concentration of the standard substance as an abscissa and taking the corresponding OD value as an ordinate, and calculating the concentration value of each sample according to a curve equation.

2.4 statistical methods

All the measurement data are expressed in the mode of mean plus or minus standard deviation (X plus or minus S), the mean comparison among multiple groups adopts variance analysis, and P <0.05 represents that the difference has statistical significance. Statistical analysis was performed using the sps 12.0 statistical software.

3 results

Research results show that the IL-4, IL-5 and IL-12 model groups and each drug treatment group have difference compared with a control group, and each treatment group has obvious difference compared with the model group; IL-25 and IFN-gamma are different in each drug treatment group and model group, IL-25 of B group, E group and F group is different in comparison with A group of control group, and IFN-gamma of B group is obviously different from A group. The method comprises the following specific steps:

TABLE 1 Effect concentration of the root-consolidating asthma-relieving formulation liposome Aerosol inhalation formulation on asthma guinea pig immunology (pg/mL)

Discussion 4

The clinical results show that the immune imbalance allergic diseases involving inflammatory cells and cytokines are caused by eosinophils, mast cells, T lymphocytes and other inflammatory cells involved in chronic inflammation of airways in comparison with IFN-macrophage-induced immune response, such as immune-induced macrophage-immune response, such as immune-induced macrophage-induced macrophage-induced-macrophage-induced macrophage-induced macrophage-induced-macrophage-induced-macrophage-induced-macrophage-induced-macrophage-induced-macrophage-inflammatory-macrophage-inflammatory-induced-macrophage-inflammatory-macrophage-induced-macrophage-inflammatory-induced-macrophage-induced-macrophage-inflammatory-macrophage-inflammatory-induced-macrophage-inflammatory-macrophage-cell-induced-inflammatory-cell-inflammatory-macrophage-inflammatory-macrophage-inflammatory-macrophage-induced-macrophage-inflammatory-macrophage-induced-inflammatory-macrophage-induced-inflammatory-macrophage-inflammatory-macrophage-inflammatory-induced-inflammatory-cell-macrophage-inflammatory-macrophage-induced-inflammatory-macrophage-inflammatory-macrophage-induced-macrophage-inflammatory-macrophage-inflammatory-induced-macrophage-inflammatory-macrophage-inflammatory-induced-macrophage-induced-inflammatory-macrophage-induced-macrophage-induced-macrophage-inflammatory-induced-macrophage-inflammatory-induced-macrophage-induced-inflammatory-macrophage-inflammatory-induced-inflammatory-macrophage-inflammatory-macrophage-inflammatory-induced-inflammatory-macrophage-inflammatory-induced-macrophage-induced-macrophage-inflammatory-macrophage-induced-inflammatory-induced-macrophage-cell-inflammatory-induced-inflammatory-macrophage-inflammatory-induced-macrophage-inflammatory-macrophage-inflammatory-induced-macrophage-inflammatory-macrophage-inflammatory-macrophage-inflammatory-macrophage-inflammatory-macrophage-inflammatory-induced-inflammatory-induced-inflammatory-induced-macrophage-induced-inflammatory-macrophage-induced-inflammatory-induced-inflammatory-induced-inflammatory-induced-macrophage-inflammatory-induced-human-induced-macrophage-human-inflammatory-induced-human-macrophage-human-inflammatory-induced-inflammatory-macrophage-inflammatory-induced-inflammatory-macrophage-human-macrophage-human-inflammatory-macrophage-inflammatory-human-inflammatory-induced-inflammatory-macrophage-inflammatory-macrophage-induced-macrophage-human-induced-human-macrophage-human-induced-macrophage-human-inflammatory-macrophage-human-induced-human-inflammatory-induced-macrophage-inflammatory-macrophage-human-inflammatory-induced-inflammatory-human-inflammatory-induced-human-inflammatory-human-macrophage-human-induced-human-induced-inflammatory-induced-human-inflammatory-induced-human-induced-human-induced-human-induced-human-induced-inflammatory-human-induced-human-macrophage-human-induced-inflammatory-human-induced-human-induced-human-induced-human-induced-human-induced-human-induced-human-induced-human-inflammatory-induced-human-induced-human-induced-human-induced-inflammatory-human-induced-human-inflammatory-induced-inflammatory-human-inflammatory-induced-human-inflammatory-human-induced-human-inflammatory-human-induced-human-induced-human-.

Test example 3 (Effect of the Liposome Aerosol inhalant for consolidating foundation and relieving asthma on asthma-related genes in guinea pig)

1. Experimental Material

1.1 medicaments

1.2 Experimental animals

1.3 devices and reagents

1.3.1 apparatus

A bell's ultrasonic atomizer (BSW-2A type) manufactured by bell's electronics ltd, san francisco; the Rotor gene3000 real-time fluorescent quantitative PCR instrument is produced by Australian Rotor gene; a high speed refrigerated centrifuge (centrifuge-5417R) low temperature refrigerator (MDF-292) manufactured by EPPENDOF corporation, Germany, is manufactured by SANYO CO.; high pressure steam sterilizer (YXQ. SGH.280) produced by Shanghai medical nuclear instrument factories; ice maker (SIM-F124) SANYO co; 752 ultraviolet spectrophotometer is produced by Shanghai third analytical instrument factory.

1.3.2 reagents

Egg albumen powder (OVA), Sybr green (batch number: F20110811) produced by national drug group chemical reagent limited company, produced by TAKARA company; DEPC, manufactured by Bosey Biotech corporation; trizol, M-MuLV (200U/ul), RNAsin (40U/ul) invitrogen; dNTP (each 10mM) Bocous Biotech; random primers 100uM, Bo Cai Biotech; the primers were synthesized by Shanghai Jun Biotechnology Ltd.

2 method

2.1 molding method:

2.2 grouping and treatment methods:

E, constitution consolidating and asthma relieving formula liposome aerosol inhalant large dose group: the inhalant is atomized 3 g/time. And F, western medicine control group: dexamethasone was inhaled by nebulization at 1 g/time.

2.3RT-PCR detection method:

2.3.1 Experimental procedure for RNA extraction (Trizol kit, Invitrogen Co.)

(1) About 50mg of the tissue was taken, and 1ml of Trizol solution was added thereto, followed by sufficient homogenization. (2) Standing at 22 deg.C for 5 min; (3) adding chloroform 0.2ml, and reversing for 15 s; (4) standing at 22 deg.C for 3 min; (5) centrifuging: 4 ℃ x 14000 r/min x 15 min; (6) taking 0.5ml of supernatant; (7) adding 0.5ml of isopropanol, and uniformly mixing; (8) standing at 22 deg.C for 10 min; (9) centrifuging: 4 ℃ x 14000 r/min x 10 min; (10) discarding the supernatant; (11) adding 1ml of 75% ethanol with the temperature of 4 ℃; (12) centrifuging: 4 ℃ multiplied by 10000 r/min multiplied by 5 min; (13) discarding the supernatant, and vacuum drying for 5 min; (14) dissolving with 40ul DEPC water, and storing at-80 deg.C.

2.3.2RT-PCR Experimental procedures

(1) Spectrophotometric detection of RNA concentration

5ul of the sample is added into a quartz cuvette, and 1ml of double distilled water is added and mixed fully. Control with double distilled water. The values measured at 260nm and 280nm are read, and when the ratio of 260nm to 280nm is between 1.8 and 2.0, the RNA purity of the sample is higher. And (6) recording.

And (3) calculating:

OD₂₆₀at 1, 40ug RNA, so the calculation is as follows:

total RNA content (ug/ul) ═ OD₂₆₀X dilution factor x 40/1000

The RNA content (ug/ul) of the sample was OD260nm X200X 40/1000-OD₂₆₀×8

(2) Reverse transcription

(3) PCR amplification

2.3.3 data processing method:

the relative expression level of the target gene can be analyzed by the Δ Δ CT method. Normal or negative samples are usually used as control samples.

CT value-n: amplification cycle

Delta CT is the target gene CT-internal reference CT (after the same reverse transcription product is amplified)

Δ Δ CT-observation sample Δ CT-control sample Δ CT

Arginia canescens (CT-CT of target gene of observation sample-CT of internal reference of observation sample) - (CT of target gene of contrast sample-CT of internal reference of contrast sample)

Relative expression of samples: 2 ═ 2^－ΔΔCT

2.3.4 primer sequences:

name (R)	Primer sequences	Length of product
			actin-F	gatctggcaccacacctttt	138
actin-R	ggggtgttgaaagtctcgaa
			stat6-F	ttggcttcatcagcaaacag	117
stat6-R	ggatgacatgagcaatggtg
			TNFa-F	atcaagagtccctgccagaa	180
TNFa-R	ggcaatgaccccaaagtaga

2.4 statistical methods

3 results

The results of experiments show that the expressions of STAT6 and TNF- α in group A are lower than those of other groups, and the difference is significant, STAT6 in the treatment group E, D is lower than that in the model group, and lower than that in group C, both of which have statistical differences, and group D and group F also show statistical differences, TNF- α treatment group E, D is lower than that in the model group B and group C, both of which have statistical differences, and D, E group and group F also show statistical differences, as shown in Table 1 below.

TABLE 1 Effect of the fixed-base antiasthmatic formulation liposome aerosol inhalant on the expression of STAT6 and TNF- α genes in asthmatic guinea pigs

Note that P <0.05 and P <0.01 in group A, △ P <0.05 and △△ P <0.01 in group B, P <0.05 and P # 0.01 in group C, ▲ P <0.05 and ▲▲ P <0.01 in group F

Discussion 4

The pathogenesis of asthma is often increased or abnormally expressed by various inflammation genes (including related cytokines, chemokines, etc.) when the asthma airway inflammation occurs, signal transducer and transcriptional activator (STATS) are a novel transcription factor family capable of being combined with target gene regulatory region DNA, the generation of a macrophage inflammatory response is critical in mediating the signal transduction process of various cytokines and chemokines when two pathogenesis genes of asthma are considered as different, the signal transducer and transcriptional activator 6(STAT6) are one of novel transcription factor family members of intracellular signal transducer and gene expression regulation, the critical regulation effect in the development of asthma airway inflammation and airway hyperresponsiveness is more and more important when two pathogenesis genes of asthma are considered as compared with two pathogenesis of asthma, macrophage adhesion promoter of macrophage receptor of mouse-macrophage receptor, macrophage-8, macrophage-7, macrophage-12, macrophage-12-macrophage-12-4-IL-13-type cytokine-13-type cytokine, etc. the pathogenesis of asthma is more important when two pathogenesis of asthma-macrophage-12-macrophage-12-5-rabbit-rat-rabbit-human-rabbit-human-rabbit-human-rabbit-human.

Test example 4 (constitution-consolidating asthma-relieving formulation liposome aerosol inhalant for pathological changes of asthmatic guinea pig tissue)

1. Experimental Material

1.1 medicaments

1.2 Experimental animals

1.3 devices and reagents

1.3.1 apparatus

The Bellis ultrasonic atomizer (model BSW-2A) is manufactured by Bellis electronics, Inc., Anshan. Lycra SP1600 microtomes are manufactured by shanghai lycra instruments ltd. Olympus CX31 microscope.

1.3.2 reagents

2 method

2.1 molding method:

2.2 grouping and treatment methods:

2.3 pathological examination of Lung tissue

Each group of guinea pigs were thoracically opened within 24h after the last challenge with 2% sodium pentobarbital under abdominal anesthesia. Taking the right lung inferior lobe tissue, fixing the right lung inferior lobe tissue by 4 percent formaldehyde, performing alcohol gradient dehydration after 24 hours, carrying out xylene transparency, embedding paraffin, carrying out HE staining on a section, and observing inflammatory lesions around the bronchus under a light microscope.

2.3.1. Lung tissue section preparation

① cuts the tissue of the same part of the specimen, the size is about 2 multiplied by 1 multiplied by lmm, ② is dehydrated by ethanol in a gradient way (80% ethanol is used for 1 time, 95% ethanol is used for 2 times, and 100% ethanol is used for 3 times), ③ is soaked in xylene for 2 times, the specimen is transparent, ④ is soaked in paraffin with low melting point at 58 ℃ for 2 times, ⑤ is used for embedding a wax block, ⑥ 5um conventional slices are mounted on clean glass slides processed by anti-dropping tablets, ⑦ is placed in a 60 ℃ thermostat for 3 hours for standby.

2.3.2 Lung tissue HE staining

① sections were dewaxed with xylene for 2 times, ② gradient dehydration with ethanol (100% ethanol 3 times, 95% ethanol 2 times, 80% ethanol l times), ③ staying in distilled water for 2min, then staining nuclei with hematoxylin solution, ④ tap water washing to remove floating color, ⑤ 1% hydrochloric acid alcohol differentiation, ⑥ distilled water rinsing, staining cytoplasm with 1% eosin alcohol solution, ⑦ gradient dehydration with ethanol (80% ethanol 1 times, 95% ethanol 2 times, 100% ethanol 3 times), ⑧ gradient xylene transparency, resin gel sealing, observation under a light mirror (as shown in fig. 1-12).

3 results and discussion

Lung pathology changes were observed, a normal control group (fig. 1, 2): the bronchial and peripheral lung tissues are clear in structure, the pulmonary artery wall is slightly thickened, and 2 cases are accompanied by mild interstitial pneumonia. Asthma model group B (fig. 3, 4): the pulmonary artery wall was thickened and the bronchioles were filled with inflammatory secretions, with 2 cases accompanied by proliferation of pulmonary interstitial fibrous tissue. C traditional Chinese medicine control group (fig. 5, 6): small inflammatory cell infiltration is seen on the wall of the bronchioles and the periphery of the lung, and small amount of secretion is seen in the cavity. The small focal lung tissue structure is destroyed with partial granulation tissue proliferation. The liposome aerosol inhalant for consolidating the constitution and relieving asthma is small (fig. 7 and 8): the pulmonary artery wall was thickened, small amount of secretion in the lumen of bronchioles, and mild interstitial pneumonia and local interstitial pneumonia appeared in 3 cases. E Guben Pingchuan liposome aerosol inhalant is big (figures 9, 10): 1 thickening of pulmonary artery wall, mild interstitial pneumonia. In 2 cases, local lung tissue destruction was observed with granulation tissue proliferation. Western medicine control group (fig. 11, 12): thickening of pulmonary artery wall, mild interstitial pneumonia. Structural destruction of lung tissue occurred in 2 cases, and local pulmonary hemorrhage in 1 other.

As can be seen from the pathological results, there are cases of pulmonary artery wall thickening and slight inflammation in the normal group due to factors such as fogging. The inflammatory condition was most severe in the asthma model group, with thickening of the arterial wall. The inflammation condition of the traditional Chinese medicine control group is reduced, and granulation tissue hyperplasia is accompanied. Both treatment groups also had pulmonary artery thickening and mild inflammation. The western medicine group has the condition that the lung tissue structure is damaged, and the possibility of external infection is not excluded.

Test example 5 (study of skin irritation test of liposome Aerosol inhalant for improving body resistance and relieving asthma)

1. Test materials

1.1, medicaments, namely a root-strengthening asthma-relieving prescription liposome aerosol inhalant: contains crude drug 1g per ml, and is provided by Chinese academy of medicine of Shanghai university of medicine.

1.2 Experimental animals, 8 pure white New Zealand rabbits are selected, male and female half, 3 months old, and 2-3 kg of body weight. Are purchased from the laboratory animal center of Shanghai pharmaceutical university, general level, and the certification number of the laboratory animal is "the laboratory animal center SYXK (Shanghai) 2004-. The body is healthy, no pathological sign exists, both eyes are normal after examination, conjunctiva is not hyperemic, cornea is transparent, epithelial exfoliation and injury do not exist, and the animal experiment requirements are met.

1.3 raising environment and conditions, laboratory animal room barrier system mouse room. The temperature is 20-25 ℃, and the humidity is 40-70%, and the feed is fed by sterilized complete pellet feed. The single cage is fed with conventional feed and can drink water freely.

2. The experimental method comprises the following steps:

2.1 Primary skin irritation test

2.1.1 with 4 healthy New Zealand white rabbits, the hair on both sides of the dorsal column of the rabbit was removed 24h before the test, and the hair removal range was 3cm x 3cm big and small hair (without damaging the epidermis).

2.1.2 removing hair for 24h, spraying the foundation-fixing asthma-relieving square liposome aerosol inhalant (about 0.5-1m1) on one side of skin with area of 2.5Cm × 2.5Cm, covering with 2 layers of gauze (2.5Cm × 2.5Cm) and one layer of cellophane, fixing with non-irritant adhesive plaster for 6h, removing the application, and removing residual test sample with warm water

2.1.3 spraying distilled water on the other side as a reference;

2.1.44-6 h, washing the applied part with clear water, performing single-dose skin irritation test, and visually observing and recording whether erythema and edema exist at the applied part 45 min, 24, 48 and 72 h after the medicine is removed.

Score 2.1.5.

2.2 multiple skin irritation test

2.2.1 with 4 healthy New Zealand white rabbits, the two side hairs on the spine of the rabbit are removed 24h before the test, and the hair removal range is 3cm multiplied by 3cm respectively.

2.2.2 spray the liposome aerosol inhalant (about 1m1) on one side of the skin, spray distilled water on the other side, spray 1 time per day, and apply continuously for 7 days. The skin reactions were observed daily, and the stimulation responses were scored, and the level of stimulation intensity was rated according to the skin stimulation index.

2.2.3 skin irritation test with multiple administrations, erythema and edema, whether pigmentation, bleeding spots, rough skin or thin skin at the application site, and the occurrence and regression times thereof were observed and recorded 1 hour after each removal of the drug and before the application again, and erythema and edema were scored. After the last application, the coated area was visually observed and recorded for erythema and edema 45 minutes, 24, 48 and 72 hours after the removal of the drug.

2.2.4 score

3. Observations and evaluation

3.1 Observation method

The skin reactions were observed under natural light or full spectrum light. The erythema and edema, whether pigmentation occurred on the applied part, bleeding spots, rough skin or thin skin, and the occurrence time and the regression time of the skin were observed and recorded, and the erythema and edema were evaluated. For animals with moderate or greater skin irritation histopathological examination of the topical administration should be performed at the end of the observation period.

3.2 evaluation criteria [ technical guidelines for the study of irritation and hemolysis of natural drugs in Chinese medicine, subject research group, technical guidelines for the study of irritation and hemolysis of natural drugs in Chinese medicine [ S ]. Beijing, center for drug evaluation by State food and drug administration 2005:11-20 ]

TABLE 1 skin irritation response score Standard irritation response

TABLE 2 evaluation criteria for skin irritation intensity

Score value	Evaluation of
		0-0.49	Has no irritation
0.5-2.99	Mild irritation
		3.0-5.99	Moderate irritation
6.0-8.0	Strong irritation

4. Results

4.1 Single dose skin irritation test

Calculating the average score of the skin reaction scores of the groups of test substances at each observation time point, counting the scores of the treatment side and the control side at each time period, and evaluating the stimulation intensity according to the table 2. According to the evaluation standard of skin irritation intensity, the result belongs to 0-0.49 series, and the medicine is indicated to have no irritation to skin by one-time irritation. Specific results are shown in table 3:

TABLE 3 mean skin Primary irritation test scores

4.2 multiple dose skin irritation test

The mean scores were calculated for each group at each observation time point, and then for each animal per day over the observation period, and the stimulation intensity was evaluated as shown in table 2. Counting the scores of the treatment side and the control side in each time period, wherein the result belongs to 0-0.49 series according to the evaluation standard of skin irritation intensity, and prompting that the medicine has no irritation to the skin after being administrated for many times. See table 4 for details

TABLE 4 average score of multiple dosing skin irritation test

Test example 6 (eye irritation test study of antiasthmatic square liposome Aerosol inhalant)

1. Test materials

1.1 medicaments

The liposome aerosol inhalant for strengthening body resistance and relieving asthma comprises: contains crude drug 1g per ml, and is provided by Chinese academy of medicine of Shanghai university of medicine.

1.2 Experimental animals:

taking 4 white rabbits of pure New Zealand, male and female half, 3 months old, 2-3 kg of body weight. Are purchased from the laboratory animal center of Shanghai pharmaceutical university, general level, and the certification number of the laboratory animal is "the laboratory animal center SYXK (Shanghai) 2004-. The body is healthy, no pathological sign exists, both eyes are normal after examination, conjunctiva is not hyperemic, cornea is transparent, epithelial exfoliation and injury do not exist, and the animal experiment requirements are met.

1.3 feeding environment and conditions:

laboratory animal housing barrier system mouse chamber. The temperature is 20-25 ℃, and the humidity is 40-70%, and the feed is fed by sterilized complete pellet feed. The single cage is fed with conventional feed and can drink water freely.

2. The experimental method comprises the following steps:

the same-body left and right self-contrast method is adopted. Both eyes of each animal were examined 24 hours prior to the trial (including examination with sodium fluorescein). 0.1ml of liposome aerosol inhalant for consolidating constitution and relieving asthma is dripped into the left conjunctival sac, and after the contact is carried out for about 5-8 s, distilled water is dripped into the right eye to serve as a control. The eyelids were then gently closed for about 10 seconds. No rinsing of the eye is required. Single dose eye irritation test, eye examination was performed at 0.5, 1, 2, 4, 24, 48 and 72 hours post dose

3. Observations and evaluation

3.1 Observation method

Eye irritation response examination was performed using a magnifying glass. For each examination, the score for the ocular response should be recorded (in addition to the observations of conjunctival, corneal and iris lesions listed, other lesions observed should also be recorded and reported.

3.2 evaluation criteria

The stimulus response scores for the cornea, iris, conjunctiva, etc. of the eyes of each animal were added at each observation time to obtain a total score, and the total of the scores of one group was divided by the number of animals to obtain the final score according to the requirements of table 5. The degree of irritation was judged according to Table 6.

TABLE 5 eye irritation response score criteria

TABLE 6 evaluation criteria for eye irritation

Score value	Evaluation of
		0-3	Has no irritation
4-8	Mild irritation
		9-12	Moderate irritation
13-16	Severe irritation

4. Results

The eyes are inspected at 0.5 hour, 1 hour, 2 hours, 4 hours, 24 hours, 48 hours and 72 hours after administration, the average value of the reaction integral of each group of the tested substances at each observation time point is calculated, the values of the treatment side and the control side at each time interval are counted, the test strip belongs to 0-3 series according to the evaluation standard of the eye stimulation intensity, and the drug is prompted to have no irritation to the eyes when being administered once. The results are shown in Table 7 below:

TABLE 7 integral average of eye irritation responses of the two groups

	n	0.5h	1h	2h	4h	24h	48h	72h
									Therapeutic side	4	0.25	0	0	0	0	0	0
Control side	4	0.25	0	0	0	0	0	0

Claims

1. A preparation method of a traditional Chinese medicine composition liposome aerosol inhalant for treating asthma is characterized by comprising the following process steps:

(1) weighing the following raw material medicines in parts by weight: 15-20 parts of roasted astragalus membranaceus, 9-12 parts of ginger processed pinellia tuber, 9-12 parts of scutellaria baicalensis, 9-12 parts of raw liquorice, 9-12 parts of roasted ephedra and 9-12 parts of dark plum;

(2) soaking the other materials except Scutellariae radix in 6-10 times of water, heating to boil, adding Scutellariae radix, decocting for 1-3 hr under slight boiling, filtering, and collecting filtrate; adding 4-8 times of water into the residue, heating to boil, decocting for 0.5-2 hr under boiling, filtering, and collecting filtrate;

(3) mixing filtrates, and concentrating; adding ethanol into the concentrated solution to make the alcohol content reach 70%, and refrigerating;

(4) filtering the medicinal liquid after alcohol precipitation, recovering ethanol from the filtrate, and concentrating; adding ethanol into the concentrated solution to make the alcohol content reach 85%, and refrigerating; filtering the ethanol precipitation solution, rotary evaporating to recover ethanol, and concentrating to obtain extractive solution;

(5) placing soybean lecithin sbPC, cholesterol CH and vitamin E into an eggplant-shaped bottle, adding a dichloromethane-methanol mixed solvent with the volume concentration of 5:2 for dissolving, carrying out reduced pressure rotary evaporation at the temperature of 45 ℃ and the rotating speed of 40r/min, removing the solvent to obtain a dry film, blowing a nitrogen film to remove residual solvent, diluting the extracting solution prepared in the step (4) with distilled water, pouring the diluted extracting solution into the eggplant-shaped bottle, shaking the hydrated dry film, and extruding the hydrated dry film to pass through a polycarbonate film with the aperture of 0.4 mu m after the hydration is completed.