CN106868043B

CN106868043B - Method for constructing zebra fish intervertebral disc injury model

Info

Publication number: CN106868043B
Application number: CN201710074948.5A
Authority: CN
Inventors: 杨德琴; 黄兴; 罗凌飞; 杨其芬; 黄文明
Original assignee: Stomatological Hospital of Chongqing Medical University
Current assignee: Stomatological Hospital of Chongqing Medical University
Priority date: 2017-02-08
Filing date: 2017-02-08
Publication date: 2020-08-04
Anticipated expiration: 2037-02-08
Also published as: CN106868043A

Abstract

The invention discloses a construction method of a zebra fish intervertebral disc injury model, which comprises a DNA polymerase chain reaction and is characterized in that a primer and a sequence used in the DNA polymerase chain reaction are as follows: 5'-GTCGACGTACTGTATCTGTGCTGATTCA C-3', reverse primer: 5'-GACCAGAAGAGATAATTCAAACG T-3' are provided. The invention aims to solve the technical problem of providing a theoretical basis for the intervertebral disc degeneration research and discloses a construction method of a zebra fish intervertebral disc injury model.

Description

Method for constructing zebra fish intervertebral disc injury model

Technical Field

The invention relates to the field of genetic engineering, in particular to a construction method of a zebra fish intervertebral disc injury model.

Background

The intervertebral disc degeneration caused by the growth of age and the accumulation of pressure abrasion is a special ageing disease of the spine, 20 percent of low back pain (L BP) can be caused, the intervertebral disc degeneration is a main cause of the occurrence of chronic low back pain, the occurrence, the degeneration and the regeneration and repair of the intervertebral disc are complex processes, the exact molecular biological mechanism is not clear, and the invention relates to influencing factors in many aspects, and is further researched.

The research on the spine degenerative disease is generally carried out by mainly damaging the lumbar intervertebral disc of a mouse through a surgical mode to establish an animal model of intervertebral disc degeneration, but the defects of the modeling are very obvious, such as great surgical trauma and high economic cost, mouse embryos develop in a female mouse, the research on the early development progress of the spine is not facilitated, the animal model is not suitable for the research on the migration and differentiation processes of cells dynamically labeled in real time on a living body, so the animal model mouse is considered to be the representative of a preferred mammal, Hayes and the like take the zebra fish as an animal model for the research on the aged spine malformation, and the research on the characteristics similar to osteoarthritis accompanying with vertebrae through describing the change of age correlation, particularly vertebral cartilage and bone tissues facilitates the research on the spine Creus in the animal model by screening out a novel experimental animal model, so that the research on the pathological change process of the spine degenerative disease can be better understood, the research on the improvement of the existing clinical treatment scheme provides a firmer foundation for the research on the improvement of the spine developmental process of the spine degeneration process of the spine degenerative disease, the spine genetic model is a novel animal model for the research on the development of the spine mineralization of the spine, particularly the research on the spinal bone and the spinal genetic homology of the spine, the spinal cord of the zebra, the animal model is a novel animal model, the research on the development of the spine, the spine mineralization of the spine, the development of the spine, the development of the spine, the research of the spine, the development of the spine, the research of the development.

The invention takes zebra fish as a model animal, constructs the intervertebral disc degeneration model by damaging the intervertebral disc of the zebra fish, and provides a preliminary theoretical basis for further researching the molecular mechanism of intervertebral disc degeneration and vertebra degeneration.

Disclosure of Invention

The invention aims to solve the technical problem of providing a theoretical basis for the intervertebral disc degeneration research and discloses a construction method of a zebra fish intervertebral disc injury model.

In order to solve the technical problems, the invention provides the following technical scheme: the construction method of the zebra fish intervertebral disc injury model comprises a DNA polymerase chain reaction, wherein primers and sequences used in the DNA polymerase chain reaction are as follows:

a forward primer: 5'-GTCGACGTACTGTATCTGTGCTGATTCAC-3'

Reverse primer: 5'-GACCAGAAGAGATAATTCAAACGT-3' are provided.

Further, the reaction system of the DNA polymerase chain reaction is as follows:

furthermore, the reaction process of the DNA polymerase chain reaction comprises,

a. pre-denaturation at 98 ℃ for 2min

b. Denaturation at 98 ℃ for 10sec

c. Annealing at 58 ℃ for 15sec

d. Extension at 72 ℃ for 5min30sec

b to d repeat 35 cycles

e. Final extension at 72 ℃ for 10 min.

Drawings

FIG. 1 is a diagram showing the result of electrophoresis of a PCR product of a promoter fragment of a zebra fish genomic clone twhh in the present invention;

FIG. 2 is a diagram showing the construction of recombinant plasmid pGEMT-twhh and the result of the rapid enzyme digestion detection of enzyme digestion detection in the present invention;

FIG. 3 is a diagram showing the results of the restriction enzyme detection of the recombinant plasmid pBluescript II-KS-twhh-Dendra2-NTR and the gel electrophoresis of the mass restriction enzyme reaction in the plasmid sequencing;

FIG. 4 is a gel electrophoresis result diagram of the restriction enzyme detection of the recombinant plasmid pBluescript II-KS-twhh-Dendra2-NTR and the rapid restriction enzyme detection in plasmid sequencing;

FIG. 5 is a map schematic of the recombinant plasmid pBluescript II-KS-twhh-Dendra2-NTR prepared based on the sequencing results and known sequence;

FIG. 6 is a diagram showing the development pattern of spinal column of zebra fish obtained in the construction step of transgenic line Tg (twhh: Dendra2-NTR) of zebra fish;

FIG. 7 is a schematic representation of antibody staining of the spinal column cross section of zebra fish;

FIG. 8 is a schematic illustration of a 60dpf zebrafish intervertebral disc and vertebrae;

FIG. 9 is a schematic diagram of a zebrafish intervertebral disc severe injury model obtained in the transgenic line Tg (twhh: Dendra2-NTR) severe injury model construction step;

FIG. 10 is a graphical representation of the results of Micro CT scan analysis of the spine after severe injury to the zebrafish intervertebral discs;

FIG. 11 is a diagram showing the results of testing the effect of no primer on recombinant plasmid construction;

FIG. 12 is a graph showing the results of experiments on the effect of secondary annealing temperature on recombinant plasmid construction.

Detailed Description

The first embodiment is as follows:

the invention relates to a construction method of a zebra fish intervertebral disc injury model, which comprises the following steps:

step one, pBluescriptII-KS-twhh-Dendra2-NTR recombinant plasmid construction

1. Experimental Material

1.1 Experimental animals

The experimental study is carried out in the ecological environment of the three gorges reservoir area in Chongqing city and the national key laboratory breeding base co-constructed with the province of biological resources, and the wild zebra fish (AB line) is bred and raised under the standard experimental conditions according to the regulations of the animal management committee of experiments.

1.2 Experimental reagents

The PCR primer synthesis and sequence determination in this experiment were performed by Shanghai Junjun Biotechnology Co., Ltd;

primer STAR DNA polymerase was from TaKaRa, japan;

l A Taq DNA polymerase was from TaKaRa, Japan;

rTaq DNA polymerase was from TAKARA, Japan;

PCR purification Kit from Qiagen, USA;

t4 DNA L igase enzyme ligase was from Invitrogen, usa;

the DH5 α strain was obtained from Invitrogen, USA.

1.2.1L B liquid Medium preparation:

tryptone (bacto-tryptone),10 g;

5g of yeast extract for bacterial culture (bacto-yeast extract);

sodium chloride (NaCl), 10 g;

adding 950M L distilled water, adjusting pH to 7.0 with 1M NaOH, adding distilled water to 1000ml, diluting the culture medium to constant volume, autoclaving for 20min, cooling, and storing at 4 deg.C.

1.2.2L B solid Medium preparation:

agar powder (agarose),12 g;

tryptone (bacto-tryptone),10 g;

5g of yeast extract for bacterial culture (bacto-yeast extract);

sodium chloride (NaCl), 10 g;

adjusting pH to 7.0 with 1M NaOH, adding distilled water to 1000ml, and autoclaving after completely dissolving; cooled to 55 ℃ and plates were prepared by adding ampicillin (Amp) or kanamycin (Kana) and stored at 4 ℃ after solidification.

1.2.3 microinjection solution

The components and the dosage of the microinjection liquid are shown in the table 1:

TABLE 1

Composition of	Dosage of
		150 ng/. mu. L plasid (plasmid)	1μL
10 × I-Sce I buffer	0.5μL
		I-SceI (restriction endonuclease)	1μL
ddH₂O (deionized water)	2.5μL
		Total volume (Total volume)	5μL

1.3 Experimental instruments

Zeiss stereodissecting microscope from Zeiss, Germany

Eppendorf gradient PCR instruments from Eppendorf, Germany

Eppendorf tabletop vertical high speed centrifuge is from Eppendorf, Germany.

1.4 related plasmids

The pBluescript-KS-eda-Dendra2-NTR plasmid is from the inventory of the national key laboratory cultivation base of the three gorges reservoir area ecological environment and the province co-construction of biological resources in Chongqing city.

2 method of experiment

2.1 Zebra fish genome extraction

1) 10 zebrafish embryos (3dpf, 3 days post fertilization) were placed per 1.5m L EP tube.

2) 500 μ L L ysis buffer (buffer) +5 μ L proteinase K was prepared, mixed well and added to an EP tube of 1.5m L.

3) Placing 1.5m L EP tube into Thermomixer Comfort (constant temperature mixer), first 55 deg.C, 14h, then 95 deg.C, 30min, and finally storing at-20 deg.C.

2.2 purification of Zebra fish genome

1) RNA free water (RNase-free water) was added to the EP tube of the extracted zebrafish genome to a total volume of 630. mu. L, 70. mu. L sodium acetate was added and mixed well.

2) To step 1) EP tube was added 700. mu. L of PCI (Phenol-Chloroform-Isoamylalcohol ) followed by shaking for homogenization, 13000rcf/min, 15 min.

3) The supernatant was pipetted approximately 600. mu. L into a new EP tube, and then the same volume of isopropanol (isopopanol) was added and mixed well at 4 ℃ 13000rcf/min for 40 min.

4) The supernatant was blotted dry and removed to leave a white precipitate, and 1m L concentration 80% ethanol was added followed by 13000rcf/min at 4 ℃ for 7 min.

5) And (4) repeating the step (4), sucking dry and removing the clean liquid, and placing on ice cubes for drying for about 30 min.

6) DNA was dissolved and concentration was measured by adding 40. mu. L RNA free water, and 2.5. mu. L running gel was sampled to verify the integrity of the DNA.

2.3DNA Polymerase Chain Reaction (PCR)

1) The primer sequences are shown in table 2:

TABLE 2

Primer and method for producing the same	Sequence of
		Forward primer sequence	5’-GTCGACGTACTGTATCTGTGCTGATTCAC-3’
Reverse primer sequence	5’-GACCAGAAGAGATAATTCAAACGT-3’

2) Reaction system for DNA polymerase chain reaction (Primer STAR polymerase)

The components and the amounts of the PCR reaction system are shown in Table 3

TABLE 3

Component (Component)	Volume (dosage)
		Genomic DNA (genome)	1μL
Forward primer (10. mu.M) (Forward primer)	1μL
		Reverse primer (10. mu.M) (Reverse primer)	1μL
dNTP (2.5mmol) (deoxynucleoside triphosphate)	4μL
		5 × prime bar buffer	10μL
Primer star NEB (polymerase)	0.5μL
		dd H₂0 (deionized water)	32.5μL

3) Reaction procedure for DNA polymerase chain reaction (Primer STAR polymerase):

the PCR reaction process is shown in Table 4

TABLE 4

4) Twhh promoter agarose gel electrophoresis detection

i. 0.48g of agarose was added to 60m L of 1 × TBE Buffer and placed in a clean flask.

Put the flask into a microwave oven and heat for about 2.5min to dissolve the agarose, destroy the nuclease.

The flask was transferred from the microwave oven, cooled for 3min, and 3 μ L Ethidium Bromide (EB) was added.

And then pouring the completely dissolved glue into a glue groove which is placed into a storehouse at 4 ℃ in advance and cooling for about 15min to fully solidify.

v. add 8. mu. L6 × lodading buffer (loading buffer) to the PCR product of 40. mu. L and mix well.

The mixed PCR product was then spotted into a solidified agarose gel and run at 75V for 40 min.

The correct strip was placed under UV light with a clean blade under gel-cutting into a 1.5m L EP tube and purified for recovery.

5) Recovery and purification of PCR products:

i. the excised gel was weighed, 1mg approximately equal to 1. mu. L, and 200. mu. L/mg of NE buffer (from the PCRdifferentiation Kit purification Kit) was added, heated at 55 ℃ to completely melt the gel strip, and the tube was inverted multiple times during the process to mix the liquid.

And ii, transferring the recovery liquid to a glue recovery and purification column, and centrifuging at the rotating speed of 11000rpm for 1 min.

The filtrate was removed and 750. mu. L NE 3 solution (from PCR purification Kit) was added and centrifuged at 11000rpm for 1 min.

The filtrate was removed and centrifuged again at 11000rpm for 1 min.

v. addition of 20 μ L dd H₂0 (deionized water) to the gel recovery purification column, standing for 10min, centrifuging at the rotation speed of 11000rpm for 1min, and storing in a refrigerator at-20 ℃.

2.4T vector ligation

The components and amounts of the pGEM-T ligation system are shown in Table 5:

TABLE 5

The corresponding reagents were added according to the PGEM-T ligation reaction system and ligated at 4 ℃ for 14 hours.

2.5 preparation of electrocompetent cells

1) The Escherichia coli DH5 α strain frozen in glycerol was dipped with a sterile toothpick and cultured overnight in 10ml of L B liquid medium at 37 ℃ and 250rpm with shaking.

2) 10ml of the overnight-cultured culture medium was inoculated into a fresh 1L L B liquid medium, cultured with shaking at 37 ℃ and 250rpm for about 2 hours, and the OD600 was measured to be 0.6 to 0.7 (measured every 15 to 20 minutes).

3) Aseptically, the inoculum was transferred to a pre-chilled centrifuge tube and allowed to stand on ice for 30 minutes.

4) Centrifugation was carried out at 5000rpm for 20 minutes at 4 ℃ to discard the supernatant and the bacteria were recovered and resuspended in 1L precooled ultrapure water.

5) Centrifugation was carried out at 5000rpm for 20 minutes at 4 ℃ and the supernatant was discarded, and the bacteria were recovered and resuspended in 100ml of precooled 10% glycerol.

6) Centrifugation was carried out at 6000rpm for 10 minutes at 4 ℃ and the supernatant was discarded, and the bacteria were recovered and resuspended in 20ml of precooled 10% glycerol.

7) Centrifugation was carried out at 6000rpm for 10 minutes at 4 ℃ and the supernatant was discarded, and the bacteria were recovered and resuspended in 2ml of precooled 10% glycerol.

8) And 7, repeating the step.

9) Centrifugation was carried out at 6000rpm for 10 minutes at 4 ℃ and the supernatant was discarded, and the bacteria were recovered and resuspended in 3ml of precooled 10% glycerol.

10) The suspension was dispensed into 1.5ml clean centrifuge tubes (40. mu. L per tube), snap frozen with liquid nitrogen and stored at-80 ℃.

2.6 electroporation competent cell transformation recombinant plasmid

1) And (3) drying the electric rotating cup in a room at 37 ℃ for 20-30 min to ensure that the electric rotating cup is fully dried, and cooling the dried electric rotating cup in ice for 20 min.

2) After thawing the electrocompetent cells obtained in step 2.5 in an ice box, adding 1-2 mu L of the ligation product obtained in step 2.4 into each tube of electrocompetent cells, and then transferring into an electric rotor, wherein the process is light and can not generate bubbles.

3) After the electric transfer, 400. mu. L L B liquid medium was quickly added to the electric rotor and the electric rotor was gently rinsed, and placed in a 37 ℃ room at 250rpm for recovery of culture for 50min while L B solid medium containing Amp (ampicillin) was reversed in the 37 ℃ room and pre-heated to dry.

4) The bacterial liquid after 50min activation is coated on L B solid culture medium containing Amp (ampicillin) preheated and dried in the step 3), and obvious bacterial colonies are obtained after the bacterial liquid is placed in an incubator at 37 ℃ for culturing for 13 h.

2.7 screening and amplification of recombinant plasmids

1) When L B solid culture medium of step 2.6 presents single colony with proper morphology and regular size, the solid culture medium is taken out.

2) A single white colony on L B solid medium was picked using a small sterile pipette tip and inoculated into fresh 5m L L B liquid medium containing 70. mu.g/m L ampicillin (Amp). The culture was carried out overnight (12-14h) at 37 ℃ and 250rpm rotation.

3) Extraction of recombinant plasmid: the plasmid concentration was determined.

2.8 Rapid cleavage reaction to identify recombinant plasmid

The components and the amounts of the rapid enzymatic digestion system are shown in Table 6:

TABLE 6

Component (Component)	Volume (dosage)
		Plasmid (Plasmid)Granule)	200ng
10 × Enzyme Buffer	1μL
		Enzyme(SalI&BamHI) (restriction enzyme)	0.2μL
dd H2O (deionized water)	Variable
		Totoal (Total volume)	10μL

Adding corresponding reagents into an EP tube according to a system shown in Table 7, generally placing the tube at the optimal enzyme reaction temperature of 37 ℃ for enzyme digestion for 30min, carrying out gel electrophoresis detection by using agarose with the concentration of 1%, determining a recombinant plasmid with the correct enzyme digestion result, and sending the recombinant plasmid to the Shanghai Yingjun biotechnology limited company for identification.

2.9 bulk digestion and recovery of the corresponding target fragment of the recombinant plasmid

An appropriate restriction site (SalI & BamHI) was selected based on the map of the laboratory stock plasmid pBluescript-KS-ela-Dendra2-NTR, the plasmid pBluescript-KS-ela-Dendra2-NTR after restriction retains about 4kb of backbone, and the plasmid pGEMT-twhh takes about 4kb of fragment after restriction as an insertion sequence.

1) The composition and amounts of the bulk digestion system are shown in Table 7:

TABLE 7

Component (Component)	Volume (dosage)
		Plasmid (Plasmid)	8μg
Cutsmart (buffer)	10μL
		Enzyme(SalI&BamHI) (restriction enzyme)	2μL
dd H2O (deionized water)	Variable
		Totoal (Total)	100μL

Corresponding reagents are added to a new EP tube according to the above system, and the enzyme digestion is carried out for 2-3 hours at 37 ℃ or other suitable temperatures. And (3) recovering and purifying an enzyme digestion product: the same procedure as for recovery and purification of PCR products. The plasmid pBluescript-KS-ela-Dendra2-NTR and the plasmid pGEMT-twhh were digested with restriction enzymes (SalI & BamHI) and recovered and purified to obtain 4kb pBluescript-KS-Dendra2-NTR fragment and 5.8kb twhh promoter fragment, respectively, for subsequent use in subsequent T4 DNA ligation enzyme (T4 ligase) ligation experiments.

2) T4 DNA ligation enzyme (T4 ligase)

The components and amounts of the T4 ligation enzyme (T4 ligase) ligation system are shown in Table 8:

TABLE 8

Component (Component)	Volume (dosage)
		T4 ligation enzyme	3.5μL
twhh promoter fragment	2.5μL
		pBluescript-KS-Dendra2-NTR fragment	1μL

Ligation was carried out at 4 ℃ for 13 h. The transformation and screening were carried out in sequence according to the above system, and the recombinant plasmid pBluescript-twhh-Dendra2-NTR was identified by rapid digestion (ApaI & NcoI) and analyzed by Shanghai Invitrogen Biotech Ltd.

2.10 purification of recombinant plasmids

1) RNase Free Water (RNase-Free Water) was added to the recombinant plasmid pBluescript-twhh-Dendra2-NTR to 630. mu. L, and after mixing, 70. mu. L sodium acetate (NaAc) was added and mixed by shaking.

2) 700 μ L PCI (Phenol-Chloroform-Isoamylalcohol ) was added, shaken for 30 seconds, 13000rpm, and centrifuged for 20 min.

3) Pipette 650. mu. L supernatant into a new EP tube, add 650. mu. L isopropanol, shake for 10 seconds, 11000rpm, centrifuge for 20 min.

4) The supernatant in the EP tube was removed, and the white precipitate of the residual DNA was centrifuged for 7min with 75% ethanol 1m L at 13000 rpm.

5) Remove the alcohol, left to dry on ice, add 40 u L nucleic free water (Nuclease free water) dissolved, detection of plasmid concentration and OD value.

3 results

3.1 cloning of the promoter fragment of twhh from the Zebra Fish genome

A pBluescript-twhh-Dendra2-NTR recombinant plasmid was constructed by PCR amplification of the promoter sequence of the 5.8kb twhh (tiggy-winkle Hedgehog, a member of the Hedgehog family) gene from the zebrafish genome. A BamHI site is added into the forward primer, and a SalI site is added into the reverse primer, so that the subsequent experiment can be conveniently carried out. As shown in FIG. 1, the PCR products were spotted, the results of gel electrophoresis showed that the brightest band in lane 1 was between 5000 and 6000bp, the 5.8kb gel target band containing the twhh promoter was excised and recovered under an ultraviolet lamp and purified, and the position of the nonspecific band was shown to be about 1100bp (the excision of the gel target band without affecting the twhh promoter and the recovery and purification of the gel target band). Lane 2 is 1Kb DNAmarker, and lane 1 is the twhh promoter fragment.

3.2 construction and enzyme digestion detection of recombinant plasmid pGEMT-twhh

Ligation of purified PCR amplification products

T Easy Vector, transformed with electrotransformation peptide DH5a, and extracted by screening with blue-white spots to pick out ampicillin resistant white spots and amplify positive colonies, and the correct pGEMT-twhh recombinant plasmid was excised with BamHI and SalI enzymes to form bands of 3015bp and 5784 bp. As shown in fig. 2, the rapid enzyme digestion assay showed: lane 1 shows the false positive plasmid pGEMT-twhh, lane 2 shows the correct recombinant plasmid pGEMT-twhh, and lane 3 shows the band of 1kb DNA marker. Lane 3 is 1Kb DNA marker, and

lanes

1 and 2 are the recombinant plasmid pGEMT-twhh to be tested.

3.3 restriction enzyme digestion detection and plasmid sequencing of recombinant plasmid pBluescript II-KS-twhh-Dendra2-NTR

The plasmid pGEMT-twhh and the plasmid pBluescript-KS ela-CFP-NTR were digested in large quantities with BamHI restriction enzyme and SalI restriction enzyme, the insertion sequence of the twhh promoter (5.8kbp) and the fragment of pBluescript-KS vector (4.8kb) were recovered from the gel, and the gel band of the desired fragment was excised, recovered and purified.

The results of gel electrophoresis for a number of enzyme digestion reactions are shown in FIG. 3: lane 1 is a 1kb DNA marker band. The plasmid in lane 2 is pGEMT-twhh, 5.8kb fragment as insert. The plasmid in lane 3 is pBluescript-KS-ela-Dendra2-NTR plasmid, 4.8kb of the digested fragment is taken as a vector fragment, the gel is cut, the corresponding fragment is recovered, the vector fragment is connected by T4 DNA ligase, electrotransformation peptide DH5a is used for transformation, and a single colony with ampicillin resistance is screened out and subjected to amplification culture to extract a correct recombinant plasmid. The correct pBluescript-KS-twhh-Dendra2-NTR recombinant plasmid was digested with the restriction enzyme ApaI to obtain 6082bp and 4150bp bands, and with NcoI to obtain 7230bp and 3002bp bands. The results of gel electrophoresis of the rapid cleavage assay are shown in FIG. 4: wherein

lanes

1 and 4 are the recombinant plasmid No. 1 to be detected,

lanes

2 and 5 are the recombinant plasmid No. 2 to be detected, and the gel electrophoresis images are cut by restriction enzymes ApaI and NcoI respectively. And (3) respectively applying restriction enzymes ApaI and NcoI to carry out rapid enzyme digestion detection: lane 1 is the band 6082bp and 4150bp of the recombinant plasmid No. 1 to be detected after digestion with the restriction enzyme ApaI, lane 2 is the band 1700bp and 7000bp of the recombinant plasmid No. 1 to be detected after digestion with the restriction enzyme ApaI, lane 3 is the band display region of the 1kb DNA marker, lane 4 is the band 7230bp and 3002bp of the recombinant plasmid No. 2 to be detected after digestion with the restriction enzyme NcoI, lane 5 is the band 2000bp and 6000bp of the recombinant plasmid No. 2 to be detected after digestion with the restriction enzyme NcoI,

lanes

1 and 4 are the correct recombinant plasmid pBluescript-KS-twhh-Dendra2-NTR, and

lanes

2 and 5 are the false positive recombinant plasmid pBluescript-KS-twhh-Dendra 2-NTR.

We sent the recombinant plasmid pBluescript II-KS-twhh-Dendra2-NTR with correct enzyme digestion detection to the Nengjun Biotechnology Limited company in the Shanghai for sequencing, and the sequencing result shows that the twhh promoter is correctly connected to the pBluescript II-KS-I-Dendra2-NTR vector fragment, which indicates that we have successfully constructed the recombinant plasmid pBluescript II-KS-twhh-Dendra 2-NTR.

3.4 sequencing results of the recombinant plasmid pBluescript II-KS-twhh-Dendra2-NTR

The primary correct recombinant plasmid pBluescript II-KS-twhhh-Dendra 2-NTR is sent to Shanghai Yingjun Biotechnology Limited company for sequencing, and the sequencing result shows that the twhh promoter is correctly connected with the pBluescript II-KS-I-Dendra2-NTR vector fragment, and the plasmid pBluescript II-KS-twhhh-Dendra 2-NTR is successfully constructed, and as shown in figure 5, the plasmid pBluescript II-KS-twhhh-Dendra 2-NTR map is made according to the sequencing result and the known sequence.

Step two, constructing the transgenic line Tg (twhh: Dendra2-NTR) of the zebra fish

1. Experimental Material

1.1 Experimental animals

1.2 Experimental reagents

DMSO (dimethyl sulfoxide) is from Shanghai Biotechnology company, China

Mtz (Metronidazole) from Sigma;

PTU (1-phenyl-2-thiourea) was obtained from Sigma;

tricaine (ethyl m-aminobenzoate) was from Sigma company;

PT (buffered solution) PBS (phosphate buffered saline) + 1% Triton X-100 (polyethylene glycol octylphenyl ether);

PBTN (blocking solution) PT + 4% BSA (bovine serum albumin) + 0.02% NaN3 (sodium azide).

1.3 microinjection

The compositions and amounts of the microinjection solutions are shown in Table 9

Table 9 (recombinant plasmid pBluescriptII-KS-twhh-Dendra2-NTR from results 3.4)

Component (Component)	Volume (dosage)
		Recombinant plasmid (150 ng/. mu. L)	1μL
10 × I-SceI buffer (buffer)	0.5μL
		I-SceI (Endonuclease)	1μL
ddH₂O (deionized water)	2.5μL

2. Laboratory apparatus

A Peking love zebra fish culture system;

l SM780 laser confocal microscope (Zeiss, Germany)

Zeiss AxioImageZ1 full-automatic upright fluorescence microscope (Zeiss, Germany)

Zeiss SteREO discovery V20 fluorescent stereomicroscope (Zeiss, Germany)

L Eica stereomicroscope (L Eica, Germany)

L eica M165C fluoroscope microscope (L eica, Germany).

3. Related plasmids

pBluescript-KS-twhh-Dendra2-NTR plasmid from the first step results.

4. Experimental methods

4.1 microinjection of embryos

4.1.1 preparation work

1) An injection tank, 1.5g agarose to 100ml egg water is weighed and added into a flask, the flask is heated in a microwave oven for 3min, the flask is taken out, the flask is placed on a table and poured into a culture dish, about 30m L gel liquid is taken out, a clean mold is taken, one end of the mold is firstly contacted with the liquid surface and is slowly covered until the whole template is stably floated above the liquid surface, the mold is taken out after the gel liquid is solidified, a small amount of egg water is poured into the culture dish, the whole injection tank is just covered, and the mold is stored at 4 ℃.

2) Needle pulling: the sterile thin glass tube is fixed to a needle drawing instrument, and the microsyringe to be used is drawn out instantly. The heating position should be located in the middle of the capillary glass tube as much as possible during the process, so that the two drawn needles have moderate length and uniform thickness. The most forward end of the needle was cut with a clean blade under a stereomicroscope.

3) Preparing zebra fish to be mated: before and after injection, 10 pairs of adult fish with large fish body and obvious body color can be selected. They were placed in pairs in a distribution tank, with baffles in between, and separated overnight. The baffles can be taken out to mate seven moments in the morning the next day.

4.1.2 microinjection work on the day

1) Preparing injection, namely preparing the injection at present, sucking 3 mu L by using a pipette gun, injecting the injection into a prepared pull needle, fixing the needle on a microinjection instrument, and adjusting the position of the injection needle to be suitable for microinjection.

2) Mating and embryo collection: the baffle in the aquarium is extracted to allow the male zebra fish to catch up with the female zebra fish to stimulate spawning. After spawning, wait 10min when the embryo has been fully fertilized and developed to the stage best suited for injection. Embryos were collected with egg water for use.

3) And (3) injection: selecting young fish embryo in the oval single cell period. The embryo yolk is slightly pressed into the injection groove by pointing the embryo yolk towards the direction of needle injection with a metal poking needle. 0.15ng of the injection solution was injected into each embryo, and the injected embryos were placed in a new petri dish, soaked with egg water, and cultured in an incubator at 28.5 ℃.

4.1.3 selection and passage stabilization of transgenic Fish lines

Culturing the injected embryo to the third day, observing that the reporter gene twhh (tiggy-winklehedgehog, a member of Hedgehog family) has green fluorescence expression in the notochord region under a fluorescence microscope, and selecting juvenile fish with strong fluorescence signal for continuous culture. And (3) hybridizing adult fish with strong fluorescence signals with wild zebra fish (AB line) for passage until the intensity of the fluorescence signals is stable, and generally hybridizing the adult fish with strong fluorescence signals with the wild zebra fish for three generations to obtain a stable transgenic fish line.

4.1.4 antibody development

The first day:

1) zebra fish transgenic line Tg (twhh: Dendra2-NTR) samples were collected for appropriate periods (25dpf, 45dpf, 60dpf), material was fixed with 4% PFA (paraformaldehyde), and embryos were rinsed 3 times for 5min each with 1ml of PT solution.

2) Embryos were rinsed 2 times for 5min with 1ml PBS (phosphate buffered saline).

3) 1ml of 4% paraformaldehyde was added and fixed overnight at 4 ℃ (12-14 h).

The next day:

1) embryos were rinsed 3 times for 5min with PBS (phosphate buffered saline).

2) Blocking was carried out with PBTN (blocking solution) at 4 ℃ for 2 hours.

3) Primary antibody (e.g.anti-dendra 2) is added and the mixture is diluted with PBTN (blocking solution) in a ratio of 1:1000 and incubated overnight at 4 ℃.

And on the third day:

1) the antibody was recovered and was able to be reused 3 times.

2) Embryos were rinsed 5 times 45min each with PT (buffer).

3) Add secondary antibody Goat-anti-rabbit488 (Green fluorescence) secondary antibody was diluted with PBTN (blocking solution) at a ratio of 1:500 to 1:1000, 200ul per tube. Incubate at room temperature for 2 hours, or at 4 ℃ overnight (usually overnight). The incubation was protected from light (wrapped in tinfoil) to avoid quenching the fluorescence.

The fourth day:

1) the secondary antibody was removed and the embryos were rinsed 5 times for 45min each with PT (buffer).

2) lmlPT +0.2ul DAPI (4', 6-diamidino-2-phenylindole, DAPI reagent stored at-30 deg.C, taken out and placed on an ice box to melt for about 15min, and taken out of the dark place) was added to a new EP tube, and the horizontal shaker was shaken uniformly for one hour. Embryos were transferred to PT (buffer) containing 80% glycerol for observation under a microscope.

3) The samples can be stored in PT solution at 4 ℃ in the dark and photographed.

5. Results of the experiment

5.1 expression Pattern of the transgenic Zebra Fish line Tg (twhh: Dendra2-NTR)

The development process of the spinal column of the zebra fish is revealed by scanning with a confocal laser microscope (Zeiss L SM780), as shown in figure 6, when the young fish develops to 12dpf, the intensity of green fluorescence of the spinal cord and the base plate of the zebra fish (namely, the area indicated by a straight arrow in figure 6 shows a gray area) gradually weakens, alizarin red staining (namely, the area indicated by a curved arrow in figure 6, namely, the area which shows gray color in the rest parts except a rectangular frame) shows that the vertebrae mineralizes in a ring shape, the mineralization of the vertebrae is gradual from the head to the tail of the spinal cord, the spinal cord is mainly occupied by vacuolar spinal cord cells marked by green fluorescence, at 17dpf, the spinal cord and the base plate of the zebra fish are marked by green fluorescence, the fluorescence expression intensity of the head is consistent with that of the tail, the mineralization of the vertebrae shown by the alizarin red staining starts to expand and develop towards the front end and back abdominal side, and at 25dpf, a large amount of green fluorescence cells gather towards the spinal area of the spinal column, the intervertebral area is obviously stronger than the green fluorescence intensity of the spinal area, each vertebral body is shown by the spinal cord, and the anterior side of the spinal cord and the vertebral body is shown by the three spinal cord, and the three spinal.

5.2 expression characteristics of intervertebral disc-specific marker Gene twhh in intervertebral discs

The expression characteristics of the twhh gene in the intervertebral disc at different periods of the spinal column development of the zebra fish are revealed by staining antibodies to the spinal column cross section of the zebra fish. As shown in fig. 7: at 25dpf, cells with green-stained fluorescence (i.e., the area indicated by the straight arrow in FIG. 7 showing grayish white color) were mostly localized to the notochordal sheath wall, and cells with green fluorescence labeled with the twhh gene were vacuolated notochordal cells. When the juvenile fish develops to 45dpf, the green fluorescent cells are only expressed in the intervertebral disc tissues, the outer-layer annulus fibrosus cells and the inner-side nucleus pulposus cells are both marked by the green fluorescent signals, and at the moment, the twhh gene is simultaneously expressed in the outer-layer annulus fibrosus cells and the inner-side nucleus pulposus cells of the intervertebral disc. At 60dpf, green fluorescent cells were only expressed in the annulus fibrosus cells of the outer layer of the disc tissue, and no expression of green fluorescent signal was found in the nucleus pulposus cells of the inner side, at which time the twhh gene green-stained fluorescent cells were only expressed in the annulus fibrosus cells of the disc and no longer labeled nucleus pulposus cells. As shown in fig. 8, when the juvenile fish developed to 60dpf, green fluorescent cells (white areas indicated by the straight line arrows in fig. 8) appeared highly expressed in the disc tissues, alizarin red staining (white areas indicated by the curved arrows in fig. 8) showed that the vertebrae developed completely maturely, and the green-labeled intervertebral discs were embedded inside the red-labeled vertebrae, as shown by cross-sectional antibody staining: at 60dpf, the green stained fluorescent cells were expressed only in the annulus fibrosus cells of the disc and no longer labeled nucleus pulposus cells. Through repeated continuous microinjection of recombinant plasmids, we screened the Founders whose expression site has strong fluorescent expression and can be stably inherited in the offspring for subsequent experiments. The transgenic line Tg (twhh: Dendra2-NTR) juvenile fish used in the experiments performed subsequently were all stably inherited offspring from transgenic fish lines with consistent levels of fluorescent expression of intervertebral disc cells of various segments of the spinal column.

Degeneration of vertebrae caused by severe damage of intervertebral discs

In the experiment, the Mtz/NTR system is used for simulating intervertebral disc degeneration of the stable zebra fish transgenic fish line Tg (twhh: Dendra2-NTR) in the early-stage experiment, and the intervertebral disc degeneration caused by the intervertebral disc degeneration of the intervertebral disc severe damage is found through laser confocal scanning. Continuous and accurate scanning of Micro CT in a three-dimensional direction can be used for generating high-resolution scanning data to analyze phenotypes such as vertebra biomineralization abnormality and the like.

Step three: construction of transgenic line Tg (twhh: Dendra2-NTR) severe injury model

1. Experimental Material

1.1 Experimental animals

The experimental study is carried out in the ecological environment of the three gorges reservoir area in Chongqing and the national key laboratory breeding base of province co-construction of biological resources, and the zebra fish transgenic line Tg (twhh: dendro 2-NTR) is propagated and raised under the standard experimental conditions according to the regulations of the animal management committee.

1.2 Experimental reagents

DMSO (dimethyl sulfoxide) was from shanghai bio-technology;

mtz (Metronidazole) from Sigma;

PTU (dianilinemethylthioketone) from Sigma company;

tricaine (ethyl m-aminobenzoate) was obtained from Sigma company.

1.2.1 Mtz (Metronidazole) treatment Agents

1) Treatment group solution: mtz (metronidazole) powder of the corresponding weight was weighed, added to eggwater (egg water) containing 0.2% DMSO, placed on a horizontal shaker in a room at 37 ℃ and shaken at 250rpm for 2h to dissolve, and then, strictly protected from light.

2) Control group solution: 0.2% DMSO was added to egg water and placed on a 37 ℃ room horizontal shaker at 250rpm to dissolve for 2h, protected from light.

1.3 Experimental instruments

A Peking love zebra fish culture system;

l SM780 confocal laser microscope from Zeiss, Germany;

heraeus vertical constant temperature embryo incubator;

zeiss axioiimagez 1 full-automatic upright fluorescence microscope;

zeiss SteREO discovery v20 fluoroscope microscope;

l eica stereodissection microscope;

l Eica M165C fluoroscope.

2. Experimental methods

1) 60 days after fertilization was selected as the starting time for juvenile fish treatment.

2) Mtz (Nitrocellum file) solution with a concentration of 10mM and a control solution are prepared, and the juvenile fish are soaked in the dark for 72 hours.

3) And observing the change of the fluorescence of the juvenile fish in the treatment group and the control group by using a body type fluorescence microscope. The young fish intervertebral disc cells in the treatment group were waited for the complete disappearance of the green fluorescence signal and washed with fresh egg water.

4) The optimal Mtz solution treatment concentration, starting time and duration are determined according to the treatment condition of the juvenile fish.

3. Results of the experiment

As shown in FIG. 9, the treated group was 10mM Mtz solution, the control group was 0.2% DMSO solution, 60dpf of the Tg (twhh: Dendra2-NTR) of the young transgenic fish was selected and subjected to the experiment, when the treated group was treated with Mtz (metronidazole) solution in the dark for 72 hours, the intensity of green fluorescence (white area indicated by the straight arrow in FIG. 9) of the young fish of the treated group was significantly reduced until disappearance, scanning with a confocal laser microscope (Zeiss L SM780) revealed that the young fish recovered for 0 days after treatment with Mtz (metronidazole) and the green fluorescence cells of the fibrous ring of the young fish of the control group were present in large quantity, and the central part of the red vertebrae located outside the white area indicated by the straight arrow, which showed gray intervertebral disc, had well-aligned segmental arrangement, whereas the green fluorescence cells of the fibrous ring of the treated group young fish were completely disappeared, and the width of the green fluorescence cells of the spinal ring of the treated group was not lost, and the spinal disc had been closely connected with Mtz, and the width of the spinal disc between the spinal discs remained well-aligned, and the red fluorescence of the control group had significantly decreased, and the spinal disc, had not appeared, but the spinal disc, had remained well-aligned segmental arrangement, and the control group had appeared, when the spinal disc, had been treated group, had been closely-stained, had.

Step four: micro CT scanning analysis of spine after severe injury of zebra fish intervertebral disc

1. Experimental Material

1.1 Experimental animals

The experimental animals were the same as in step three.

1.2 Experimental reagents

The experimental reagent is the same as in step three.

1.3 Experimental instruments

A Peking love zebra fish culture system;

Micro-CT is from vivaCT40, Switzerland SCANCO.

2. Experimental methods

Zebrafish samples from control and treated groups recovered for 0 days (R0D) after Mtz treatment and 40 days (R40D) after Mtz treatment were fixed with 4% PFA (paraformaldehyde) by first scanning the entire fish spine (resolution of 17 μm) and then isolating the tail spine of the entire fish under a stereomicroscope as a local precision scan fraction (resolution of 10 μm). The scanning voltage is set to 70KV, and the current is set to 500 mA.

3. Results of the experiment

As shown in the rectangular box of fig. 10: mtz recovery day 0 after treatment (R0D), the vertebrae in the control group were aligned in segments, whereas the vertebrae in the treated group were closely connected and the intervertebral space was apparently covered by abnormally mineralized bone tissue in the intervertebral area. Mtz (Metronidazole) is recovered for 40 days (R40D), the mineralization of the vertebra of the young fish of the control group is obviously enhanced, however, the vertebra of the young fish of the treatment group is more closely connected, the mineralization of the intervertebral area is obviously enhanced, so that the intervertebral space is completely disappeared, the biomineralization abnormality of the vertebra causes the morphological abnormality of the single vertebra, and the obvious shortening of the length of the single vertebra is the main reason for shortening the length of the whole fish spine.

Therefore, the transgenic line Tg (twhh: Dendra2-NTR) in the construction method of the invention explains the development process of the intervertebral disc and vertebra of the zebra fish in detail, and shows that the twhh gene promoter can drive the expression of green fluorescent protein, thereby clearly recording the gradual conversion process of the zebra fish from the development of notochord cells to the development and maturation of intervertebral disc cells. A specific intervertebral disc injury model is constructed based on an Mtz/NTR system, and Nitroreductase (NTR) is specifically expressed by cells mainly through a recombinant transgenic line successfully constructed in the early stage. The basic principle of the zebra fish intervertebral disc injury is as follows: disc cells expressing nitroreductase are killed by Nitroreductase (NTR) in combination with metronidazole (Mtz). The current research suggests that: degeneration of the intervertebral disc is one of the most prominent pathological processes leading to lower back pain and is a prerequisite for herniated intervertebral discs. Although mechanical stress is a very important regulatory factor leading to disc degeneration, the underlying molecular mechanisms for disc degeneration remain unknown. By combining the advantages of the zebra fish living in water, the influence of long-term mechanical pressure of external gravity on the zebra fish intervertebral disc stimulation can be eliminated. Compared with a mouse intervertebral disc degeneration model which mainly aims at damaging a plurality of local intervertebral discs of the lumbar vertebra of a mouse in a fixed point mode through a surgical operation mode, the invention specifically damages all the intervertebral discs in a zebra fish body in a mode of soaking a zebra fish transgenic line Tg (twhh: Dendra2-NTR) by a metronidazole medicament, and constructs a novel animal model of all the intervertebral discs in the zebra fish body by means of severe damage of all the intervertebral discs in the zebra fish body.

In the experiment, 10mM Mtz (metronidazole) solution is used as a treatment group, 0.2% DMSO is used as a control group, and the treatment is carried out for 72 hours under the condition of keeping out of the sun, wherein the green fluorescence of the intervertebral disc of the transgenic line Tg (twhh: Dendra2-NTR) of the control group is not obviously changed, but the green fluorescence of the whole intervertebral disc of the juvenile fish of the treatment group obviously disappears. This indicates that Mtz (metronidazole) in the treatment group was able to induce the production of NTR (nitroreductase) lethal protein, the Mtz/NTR (metronidazole/nitroreductase) system was able to specifically cause the death of NTR (nitroreductase) -expressing cells, whereas DMSO in the control group had no effect on disc development. Therefore, the construction method of the Tg (twhh: Dendra2-NTR) transgenic zebra fish intervertebral disc injury model constructed by the inventor is successful.

When we soaked young fish with metronidazole MTZ drug, the green fluorescent cells on the annulus fibrosus in the disc would exert corresponding cytotoxicity, we distinguished the degree of disc injury by the time of metronidazole MTZ drug soaking at 10mM L working concentration, treated continuously for 72 hours by light-shielding soaking, thereby the phenomenon of massive apoptosis on the annulus fibrosus occurs, while metronidazole MTZ would not damage other tissues around, mouse model of disc degeneration is often used to explore the effect of mechanical pressure in disc degeneration, induced apoptosis of the annulus fibrosus by mechanical overload for 24 hours and resulted in some disc degeneration in mice, revealed by immunostaining that cytochrome C is released but no apoptosis-related factor ligand is generated, Rannou et al, by collecting human samples, analysis of mouse model, combined with disc culture experiment, proved that mechanical overload induced disc degeneration is regulated by apoptosis pathway in disc cells, however, we discovered that Mtz/NTR system specific damaged disc cells, induced disc degeneration is convenient for developing intervertebral disc degeneration, thus, we further discovered whether there is a serious defect that the degeneration of intervertebral disc is caused by the degeneration of intervertebral disc, which we are disturbed spinal bone degeneration caused by the abnormal bone degeneration of some intervertebral disc, and the abnormal bone degeneration of mare.

The transgenic line Tg (twhh: Dendra2-NTR) has seriously damaged intervertebral discs to cause vertebral body degeneration, the intervertebral discs are specifically marked by green fluorescent protein, and mineralized vertebrae are specifically marked by alizarin red staining, and under the standard experimental conditions, the severely damaged intervertebral discs can not be recovered by self and cause serious defects of development and mineralization of the vertebrae. Two transgenic fish lines of Tg (twist: EGFP) and Tg (osteopocalcin: GFP) are constructed in connection with Inohaya et al to mark precursor osteoblasts and mature osteoblasts of the vertebral body respectively, and the differentiation of green fluorescent precursor osteoblasts in the intervertebral area into red fluorescent mature osteoblasts of the vertebral body is verified by scanning through a laser confocal microscope by using the double transgenic fish line. This study considered that: the precursor osteoblasts derived from the osteogenic segments in the intervertebral region of the spine differentiate into mature osteoblasts of the vertebral body, which serves as a growth center during growth and development of the vertebral body. Combining the research results, we preliminarily speculate that the zebra fish intervertebral disc plays an important role in the growth and development of vertebrae.

The experimental technical means prove that the zebra fish intervertebral disc severe injury model can be used for researching an intervertebral disc degeneration model, and then the intervertebral disc degeneration of zebra fish causes degenerative change of vertebrae, which shows that the animal model constructed by the method can be used for exploring related molecular regulation and control mechanisms of intervertebral disc degeneration and vertebra degeneration. The action mechanism is preliminarily presumed that the severely damaged intervertebral disc can not restore to generate degenerative changes, the microenvironment of the intervertebral area of the spine is influenced, and the stable equilibrium of the vertebrae is disordered, so that the pathological phenotype of the vertebrae degeneration is generated.

Test one: effect of primer-free construction of recombinant plasmids

The test method comprises the following steps: the difference is that the following steps are consistent with the operation method of the first step in the embodiment: DNA Polymerase Chain Reaction (PCR) four different primer sequences were set up as shown in table 10:

watch 10

	Forward primer FW	Reverse primer RW
			Lane
1	cgtccatgtgtaactccgtaac	gtccttgcaccatttgtctgtc
			Lane
2	cgtccatgtgtaactccgtaac	gacgtttgaattatctcttctggtc
			Lane
4	gtactgtatctgtgctgattcac	gtccttgcaccatttgtctgtc
			Lane
5	gtactgtatctgtgctgattcac	gacgtttgaattatctcttctggtc

The test results are shown in fig. 11:

it can be seen from this that: lane 3 is a 1kb DNA marker. Lane 5 has a specific 5.8kb twhh fragment, and is more intense, indicating a higher concentration, and can be used for construction of pGEMT-twhh recombinant plasmids.

Lanes

1,2 and 4 show a specific 5.8kb twhh fragment, and the intensity was modest, and the non-specific band was too much dragged to construct pGEMT-twhh recombinant plasmid.

And (2) test II: effect of annealing temperature on recombinant plasmid construction

The test method comprises the following steps: the method is consistent with the first step operation method of the embodiment, and the difference is that: DNA Polymerase Chain Reaction (PCR) two different annealing temperatures were set as shown in table 11:

TABLE 11

	PCR reaction system and reaction process of different reagents
		Lane
1	The annealing temperature is 58 DEG C
		Lane
3	The annealing temperature is 52 DEG C

The test results are shown in fig. 12:

it can be seen from this that: lane 2 is a 1kb DNA marker. Lane 1 shows a specific 5.8kb twhh fragment and some non-specific bands, but the 5.8kb twhh fragment is very bright, indicating that the concentration is high, and is beneficial to the construction of pGEMT-twhh recombinant plasmid. Lane 3 shows no specific 5.8kb twhh fragment and is not useful for construction of pGEMT-twhh recombinant plasmids.

It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the spirit and scope of the invention, which should not be construed as affecting the effect of the invention and its practical application.

<110> Chongqing college of medical sciences affiliated oral hospital

Construction method of <120> zebra fish intervertebral disc injury model

<160>10

<210>1

<211>29

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>1

GTCGACGTACTGTATCTGTGCTGATTCAC

<210>2

<211>24

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>2

GACCAGAAGAGATAATTCAAACGT

<210>3

<211>22

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>3

cgtccatgtgtaactccgtaac

<210>4

<211>22

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>4

gtccttgcaccatttgtctgtc

<210>5

<211>22

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>5

cgtccatgtgtaactccgtaac

<210>6

<211>25

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>6

gacgtttgaattatctcttctggtc

<210>7

<211>23

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>7

gtactgtatctgtgctgattcac

<210>8

<211>22

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>8

gtccttgcaccatttgtctgtc

<210>9

<211>23

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>9

gtactgtatctgtgctgattcac

<210>10

<211>25

<212>RNA

<213> Artificial sequence

<220>

<221>prim_bind

<400>10

gacgtttgaattatctcttctggtc

Claims

1. The construction method of the zebra fish intervertebral disc injury model comprises a DNA polymerase chain reaction, and is characterized in that primers and sequences used in the DNA polymerase chain reaction are as follows:

a forward primer: 5'-GCGTCGACGTACTGTATCTGTGCTGATTCAC-3'

Reverse primer: 5'-CGGGATCCGACGTTTGAATTATCTCTTCTGGTC-3'

Extracting genome DNA from a zebra fish embryo which is fertilized for 3 days, and then obtaining a promoter fragment of a twhh gene through a DNA polymerase chain reaction, wherein the zebra fish germ line is a wild zebra fish AB germ line;

also comprises an expression vector construction step, a transgenic step and a metronidazole treatment step;

in the construction step of the expression vector, the promoter fragment of the twhh gene is connected to a plasmid vector containing a Dendra2-NTR gene to obtain the expression vector; the promoter fragment of the twhh gene is used for starting the expression of the Dendra2-NTR gene;

in the transgenic step, the expression vector is injected into a zebra fish embryo, and a stable transgenic fish line is obtained through multi-generation hybridization;

in the metronidazole treatment step, transgenic young fish 60 days after fertilization is treated with 10mM metronidazole for 72h, and a zebrafish intervertebral disc injury model is obtained.

2. The method for constructing the zebra fish intervertebral disc injury model according to claim 1, wherein: the reaction system of the DNA polymerase chain reaction is as follows:

3. the method for constructing the zebrafish intervertebral disc injury model according to claim 1 or 2, wherein: the reaction process of the DNA polymerase chain reaction is,

a. pre-denaturation at 98 ℃ for 2min

b. Denaturation at 98 ℃ for 10sec

c. Annealing at 58 ℃ for 15sec

d. Extension at 72 ℃ for 5min30sec

b to d repeat 35 cycles

e. Final extension at 72 ℃ for 10 min.