CN106834448A - The interleukins 16 associated with primary biliary cholangitis and its application - Google Patents

Abstract

The invention discloses the application of interleukin 16 (IL-16) in the preparation of products for detection or auxiliary detection, screening or prediction of primary biliary cholangitis (Primary Biliary Cholangitis, PBC). The present invention also discloses that the single nucleotide polymorphic sites of IL-16 significantly related to the susceptibility of primary biliary cholangitis are: rs17875509, rs11857713, rs4778636, rs11073001, rs11630277, rs56859031, rs57763246, rs17875523, rs3898677, rs1398 . The invention also discloses the application of IL-16 in the preparation of PBC animal models and the application in the preparation of PBC therapeutic drugs. The present invention finds for the first time that multiple gene polymorphism sites of IL-16 are significantly related to the occurrence of PBC, and can be used as one of the indicators for predicting the risk of PBC incidence. The present invention finds for the first time that the expression of IL-16 in the blood of PBC patients is abnormally elevated.

Description

Interleukin 16 associated with primary biliary cholangitis and its application

technical field

The invention belongs to the field of immunology, and in particular relates to interleukin 16 (IL-16) associated with primary biliary cholangitis and its application.

Background technique

Primary biliary cholangitis (PBC), formerly known as primary biliary cirrhosis (primary biliary cirrhosis), is a chronic progressive autoimmune disease involving the intrahepatic bile duct system, mainly manifested as liver Progressive destruction of the small internal bile ducts with portal inflammatory changes eventually leads to fibrosis and cirrhosis. The disease mainly occurs in middle-aged women, and only 10% of male cases. With the increasing awareness of PBC disease and the establishment of diagnostic methods, the incidence and prevalence of PBC are on the rise globally. In 2003, 5011 healthy persons (aged 26-85) were screened for PBC-specific anti-mitochondrial antibody (AMA) (PDC-E2) in Shanghai, and it was found that the positive rate of AMA was higher than 0.16%. higher than 0.3% [5]. In 2006, in the census of 8126 adults (18-83 years old) in Guangdong, it was found that the positive rate of AMA (PDC-E2) was higher than 0.05%, and higher than 0.15% in middle-aged women. A recent AMA screening of 19012 residents in the Shanghai area found that 0.40% of males and 0.94% of females were positive for AMA, and 25 of them (0.13%) suffered from PBC. With the aging population in our country, PBC will rapidly develop into a relatively common disease in my country, which may reach 200,000-300,000 patients in 2025, and may reach 350,000-500,000 patients by 2050.

Early diagnosis and treatment are the most effective means to control the development of PBC disease. At present, there is no effective treatment for PBC. Ursodeoxycholic acid is the only drug that can effectively control early PBC patients (especially those without jaundice), but it has no curative effect. The only way to save advanced PBC patients is Perform a liver transplant. my country is a country with a high incidence of viral hepatitis. The clinical symptoms of PBC are similar to those of viral hepatitis. PBC patients are often misdiagnosed as viral hepatitis or drug-induced hepatitis in the early stage, which seriously affects the diagnosis and treatment of PBC patients. Therefore, early diagnosis and treatment of PBC patients have important social significance.

PBC has a strong genetic susceptibility, and the incidence of PBC in the first-generation relatives of patients is 100 times higher than that of the general population. Based on reports from North America, Europe and Japan, the family incidence of PBC is 3.8-9%. In 2005, a large-scale survey in North America showed that the relative risk (odds ratio) of immediate relatives of PBC patients was as high as 10.7. Through the analysis of identical twins of PBC patients, it was found that the co-morbidity rate reached 63%. In the past four years, our team has found 3 pairs of identical twins of PBC patients in the investigation of domestic PBC patients. The symptoms and onset time of the sisters of the three pairs of patients are very close. The co-morbidity rate is as high as 72.7%.

Since 2009, a series of genome-wide association analyzes (GWAS) of Caucasian PBC patients revealed a strong genetic susceptibility to PBC. The North American PBC Cooperation Group with the applicant as the core member used the method of GWAS and high-density gene polymorphism analysis at specific sites to conduct cohort analysis on North American PBC patients and control populations, and confirmed the genetic susceptibility of PBC and HLA-II antigen , IL12A, IL12RB2, STAT4, IRF5, ch17q12-21, MMEL1 and SPIB are closely related, and revealed that the abnormalities of IL12 signaling pathway and Toll-like receptor (TLR)/TNF signaling pathway may lead to the occurrence of PBC . A small-scale GWAS study by Japanese scholars also found that the TNFSF15 locus is closely related to PBC. The genetics research of PBC in our country already has a certain basis, the domestic scholars have carried on the preliminary research on the HLA and CTLA4 gene loci and the PBC genetic susceptibility of the Han nationality respectively.

We initiated and completed the Illumina Zhonghua chip scanning work on 1122 cases of Han PBC samples, combined with 4046 cases of control data, conducted a large-scale cohort analysis, discovered and confirmed the gene locus of IL-16 for the first time in the world and reached GWAS Significantly, and found for the first time that IL-16 was abnormally highly expressed in the blood of PBC patients.

At present, there is no patent literature in the world that mentions the IL-16 gene locus and the relationship between IL-16 and PBC.

Contents of the invention

Purpose of the invention: The first technical problem to be solved by the present invention is to provide the application of IL-16 in the preparation of products for detection or auxiliary detection, screening or prediction of primary biliary cholangitis.

The second technical problem to be solved by the present invention is to provide a series of single nucleotide polymorphic sites (SNPs) significantly related to primary biliary cholangitis, and to find out the SNPs associated with primary biliary cholangitis The most prominent representative loci are associated with susceptibility, thereby providing the use of said single nucleotide polymorphism (SNP) for assessing susceptibility to primary biliary cholangitis.

The third technical problem to be solved by the present invention is to provide the application of IL-16 in the preparation of PBC animal models.

The fourth technical problem to be solved by the present invention is to provide the application of IL-16 in the preparation of PBC treatment medicine.

Technical solution: In order to solve the above-mentioned technical problems, the technical solution adopted in the present invention is as follows: the first aspect provides the application of IL-16 in the preparation of products for detection or auxiliary detection, screening or prediction of primary biliary cholangitis . We initiated and completed the Illumina Zhonghua chip scanning work on 1122 cases of Han PBC samples, combined with 4036 cases of control data, conducted a large-scale cohort analysis, and discovered and confirmed the gene locus of IL-16 for the first time in the world to reach GWAS Significant, and found for the first time that IL-16 was abnormally highly expressed in the blood of PBC patients; specifically, through genome-wide association analysis, it was found that the gene polymorphism of IL-16 was closely related to the pathogenesis of PBC; through the serum of PBC patients and normal people Through clinical analysis, it was found that IL-16 was abnormally highly expressed in PBC patients.

The second aspect provides a series of IL-16 single nucleotide polymorphism sites that are significantly associated with the susceptibility of primary biliary cholangitis, through the study of 1122 samples of Chinese Han PBC patients and 4036 samples of normal people Subject, HumanOmniZhongHua-8 (v1.1) was used to scan the genome-wide association data, and the gene polymorphism (SNP) was typed. Using the data obtained by the chip, the comparative analysis of all polymorphic sites was performed using PLINK software , found that the frequency of multiple SNPs in the IL-16 gene was significantly different between PBC and normal people: the single nucleotide polymorphism site of IL-16 significantly associated with the susceptibility to primary biliary cholangitis is: rs17875509 , the allele is G/C; rs11857713, the allele is C/T; rs4778636, the allele is G/A; rs11073001, the allele is A/G; rs11630277, the allele is T/C; rs56859031 , the allele is A/AGT; rs57763246, the allele is C/T; rs17875523, the allele is C/T; rs3898677, the allele is T/C; rs139879640, the allele is TCTCA/T; rs4577037 , the allele is T/G; rs3899547, the allele is A/G; rs17875532, the allele is C/T; rs17875533, the allele is C/A; rs11556218, the allele is T/G; rs1803275 , the allele is G/A; rs3926277, the allele is C/A; rs3926278, the allele is C/G; rs3926279, the allele is A/G; rs17875542, the allele is G/C; rs17875543 , the allele is C/T; rs7166271, the allele is C/T; rs11325, the allele is G/T; rs4778640, the allele is A/G.

In the third aspect, the present invention finds the linkage relationship between multiple SNPs and rs11556218 by performing linkage disequilibrium analysis on the SNP at the IL16 site. Using the iPlex method of Sequenom, the verification test was carried out for the most significantly different rs11556218 polymorphic site; and using Impute2 and PLINK software, the logistic regression principle was used, gender was used as a covariate, and the analysis was based on the superimposed effect model; it was also found that there was a significant difference Difference; all SNPs in Table 1 are gene polymorphism sites with significant differences between PBC and controls, which can be used for risk prediction of PBC.

In the fourth aspect, the present invention finds through the analysis of the existing international gene expression analysis database that the polymorphism of the PBC association site is significantly related to the expression of IL-16 in lymphocytes and monocytes; using PLINK software, logic The regression principle was used to analyze and evaluate the relationship between each SNP site and primary biliary cholangitis, and calculate the relative risk (Odd ratio, OR) and 95% confidence interval of the risk allele, and obtain this series of SNP sites The risk alleles of the points are: rs17875509 polymorphic locus is C; rs11857713 polymorphic locus is T; rs4778636 polymorphic locus is A; rs11073001 polymorphic locus is G; Point is A; rs56859031 polymorphic site is AGT; rs57763246 polymorphic site is T; rs17875523 polymorphic site is T; rs3898677 polymorphic site is C; rs139879640 polymorphic site is T; rs4577037 The polymorphic site is G; the rs3899547 polymorphic site is G; the rs17875532 polymorphic site is T; the rs17875533 polymorphic site is A; the rs11556218 polymorphic site is G; the rs1803275 polymorphic site A; rs3926277 polymorphic site is A; rs3926278 polymorphic site is G; rs3926279 polymorphic site is G; rs17875542 polymorphic site is C; rs17875543 polymorphic site is T; The polymorphic site is T; the rs11325 polymorphic site is T; the rs4778640 polymorphic site is G.

In the fifth aspect, the present invention measures the concentration of serum IL-16 in 120 cases of PBC patients and 120 cases of normal people by specific quantitative enzyme-linked immunoassay (ELISA) to IL-16, and finds that IL-16 in PBC patients Significantly increased (P<0.0001).

In the sixth aspect, chronic IL-16 expression is introduced into the animal model established by the present invention to prepare a PBC animal model, and this model is used for screening of PBC therapeutic drugs.

Beneficial effects: the present invention has the following features and advantages:

1) The present invention found for the first time that multiple gene polymorphisms of IL-16 were significantly correlated with the occurrence of PBC, which can be used as one of the indicators for predicting the risk of PBC.

2) The present invention finds that the expression of IL-16 in the blood of PBC patients is abnormally elevated, and it is a target that can be used for targeted therapy of PBC.

3) The invention found that it is possible to prepare a PBC animal model by introducing chronic IL-16 expression in the animal model, and use this model for screening of PBC therapeutic drugs.

Description of drawings

Fig. 1 is the association diagram of the single nucleotide polymorphism site and PBC in the IL16 gene region determined in embodiment 1; Among Fig. 1: abscissa "Position on chr" is the position (unit Mb) on the chromosome; The coordinates are the significance P value (-log10(p-value)) of the association between the single nucleotide polymorphism site and PBC, and the Recombination rate on the right is the recombination rate in CM/Mb; the representative site rs17875509 is in the order of ◆ express.

Fig. 2 is the expression difference (**** is P<0.0001) of ELISA detection IL-16 in PBC and normal control population (HC) serum in embodiment 3; Among Fig. 2: abscissa shows and is divided into PBC and normal control Two groups of people (HC), the ordinate is the detected serum IL-16 concentration, unit (pg/ml, picogram/ml).

detailed description

The present invention will be further described below through specific embodiments and accompanying drawings.

Used experimental material, main reagent and formula in the embodiment of the present invention are as follows:

Main experimental materials and main reagents:

1. DNA samples and serum from patients with primary biliary cholangitis and normal controls;

2. Genome-wide association analysis chip analysis kit: the HumanOmniZhongHua-8 (v1.1) analysis kit produced by Illumina includes chips and reagents.

3. IL-16 Quantitative ELISA Kit: purchased from R&D Systems, Human IL-16 Quantikine ELISA Kit, product number D1600.

Main solution preparation:

1. Phosphate buffer solution (PBS, 1L): 8g NaCl, 0.2g KCl, 0.24g KH ₂ PO ₄ , 3.628g Na ₂ HPO ₄ ·12H ₂ O, distilled water to 1L;

2. Saturated sodium chloride solution (5M NaCl, 1L): 292.5g NaCl, dissolved in double distilled water and set to 1L;

3. 1M Tris-HCl buffer solution (pH 8.0): dissolve 30.3g Tris base in 200ml double distilled water, adjust the pH value to 8.0 with hydrochloric acid, and dilute to 250ml;

4. 0.5M EDTA (PH 8.0): Dissolve 36.5g EDTA in NaOH solution, adjust the pH to 8.0, and set the volume to 250ml;

5. Nuclei Lysis Buffer (500ml): 40ml 5M NaCl, 2ml 0.5M EDTA (pH 8.0), 5ml 1M Tris-HCl (pH 8.0), 453ml double distilled water;

6. Proteinase K buffer (Proteinase K buffer, 100ml): 50ml glycerol, 100ul 1MTris-HCl (pH 7.5), 200μl 1M CaCl ₂ , 47ml double distilled water;

7. Proteinase K (Proteinase K Solution, 10mg/ml): Dissolve 100mg of proteinase K powder in 10ml of proteinase K buffer;

8. Digestion solution (Nuclei-SDS-Proteinase K-Master Mix Lysis buffer, 504ml): 420ml Nuclei Lysis Buffer, 3.5ml Proteinase K (10mg/ml), 17.5ml 10% SDS, 0.35ml 0.5MEDTA (PH 8.0), 62.65 ml double distilled water;

9. TE buffer (pH 8.0): 1ml 1M Tris-HCl buffer (pH 8.0), 0.2ml 0.5M EDTA (pH 8.0), distilled water to 100ml;

10. 6×DNA spotting buffer (10ml): 88mg EDTA, 5mg bromophenol blue, 5mg xylene cyanol, dissolved in 4ml double distilled water, then add 3.6ml glycerin, adjust to pH 7.0 with NaOH, and dilute to 10ml;

11. 50×TAE buffer: 242g Tris-base, 57.1ml glacial acetic acid, 200ml 0.5M EDTA (pH 8.0), distilled water to 1L.

Example 1 Genome-wide association analysis

The present invention discovers the correlation between IL-16 gene locus and primary biliary cholangitis through the following methods and steps.

1. Method

Firstly, 1122 samples of Chinese Han PBC patients and 4036 samples of normal people were selected from the Chinese Han population as the research objects, and HumanOmniZhongHua-8 (v1.1) was scanned for genetic polymorphism (SNP) typing, using PLINK The comparative analysis of all polymorphic sites by the software found that the frequency of multiple SNPs of the IL-16 gene was significantly different between PBC and normal population.

2. Inclusion Criteria for Case and Control Samples

All PBC patients included in the study met the following criteria: 1), all patients were Han nationality; 2), AMA-M2 serological test was positive; 3), biochemical indicators showed evidence of cholestasis, mainly manifested as elevated ALP and GGT ;5), various types of hepatitis virus infection and human immunodeficiency virus infection indicators are negative (negative hepatitis B virus surface antigen, hepatitis B virus DNA in serum is less than 200 copies/ml, hepatitis C virus RNA in serum is less than 500 copies/ml, hepatitis E Antigen negative, human immunodeficiency virus antibody negative); 6), no history of schistosomiasis infection; 7) The patient complained that the alcohol consumption was less than 100ml/day.

Whole-genome scanning control population samples came from normal physical examination populations in Anhui, Jiangsu, and Shandong, with normal biochemical indicators, no clinical disease symptoms, and self-reported health. Cases were screened between 22 and 85 years old, with an average age of 54.7 years; controls were screened between 15 and 96 years old, with an average age of 34.8 years.

3. Basic characteristics of the test population

The test population is the chip test sample, and its basic characteristics are as follows:

Table 1

4. Preparation of genomic DNA samples from patients with primary biliary cholangitis (PBC) and normal controls

1. The non-anticoagulant blood of patients and normal people is collected in non-anticoagulant blood collection tubes by each hospital. Centrifuge the collection tube to separate the serum and clot. Gently mix the serum on the upper layer of the thawed blood sample with a pipette in the ultra-clean workbench, and put it into four 1.5ml screw-cap preservation tubes evenly, and store it at -80°C.

2. Take out the separation gel with a long-handled spoon, pour the blood clot into a weighing boat, cut the blood clot fully with scissors, and transfer the broken blood clot to a 50ml centrifuge tube with a plastic straw.

3. Rinse the weighing boat and blood collection tubes with PBS buffer solution, recover the cleaning solution into a 50ml centrifuge tube, mix the liquid with a plastic straw, centrifuge at 2500rpm, 15min, 4°C, and discard the supernatant.

4. Add 5ml of digestion solution, mix well, put it into a constant temperature shaker in a water bath, 50°C, 200rpm, and digest overnight.

5. After the digestion is complete, add 1.5ml 5M NaCl and mix well; let it stand at room temperature for 10min, during which time mix well by inverting several times, centrifuge at 3800rpm, 30min, at room temperature.

6. Transfer the supernatant to a 50ml centrifuge tube, add 2 times the volume of absolute ethanol, and mix well.

7. Use a pipette to transfer the visible flocculent DNA precipitate to a 2ml EP tube containing 500μl 70% ethanol for washing.

8. Centrifuge at 13000rpm for 5min at room temperature, discard the supernatant; centrifuge again at 13000rpm for 1min at room temperature, discard the residual liquid with a pipette, dry it in the air, and dissolve it in double distilled water.

5. HumanOmniZhongHua-8 (v1.1) chip scanning typing and genome-wide association data analysis

The HumanOmniZhongHua-8 (v1.1) chip was purchased from ILLUMINA Company, and the typing was performed according to the product method requirements. The exact steps of the specific operation were carried out according to the experimental procedures of the HumanOmniZhongHua-8 (v1.1) chip of Illumina Company, and related descriptions can also be found in the published literature [Adler, A.J., Wiley, G.B., Gaffney, P.M. J.Vis.Exp.(81), e50683, doi:10.3791/50683(2013).]. Each DNA sample used 200 nanograms (ng) and was processed in strict accordance with the instructions of the HumanOmniZhongHua-8 (v1.1) chip from Illumina Company.

HumanOmniZhongHua-8 (v1.1) chip typing data was processed and output by BeadStudio software of ILLUMINA company, and the associated data analysis was also carried out according to the published literature [Zuo, X. et al. Whole-exome SNP arrayidentifies 15 new susceptibility loci for psoriasis. Nat Commun 6, 6793, 2015]. The typing data output by BeadStudio was analyzed by PLINK, and duplicate samples and relative samples were excluded according to the principle of pairwise identity-by-state. Using smartpca software, according to the principle of principal component analysis (principal component analysis), to exclude heterogeneous samples of the population, a total of 1,122 PBC patients and 4,036 normal controls were used for statistical analysis. SNPs with typing success rate lower than 98%, SNPs with minorallele frequency (MAF) lower than 0.01 in analyzed samples and SNPs with Hardy–Weinbergequilibrium value P<1×10 ^-4 in normal control samples were excluded. After exclusion, a total of 776,516 autosomal SNPs were used for comparison. Using PLINK software, SNP correlation analysis adopts the principle of linear regression, takes gender as a covariate (covariate), adopts the principle of additive effect (additive allelic effect), evaluates the significance of each SNP locus associated with PBC, and calculates the risk allele The relative risk (Odds ratio, OR) and 95% credible interval of the gene, the OR value, credible interval and P value are directly obtained in the analysis, so as to obtain the risk allele of the site. The significance level (P value) of the association between each site in the SNP chip and PBC was calculated by genome-wide association (GWAS) analysis, and the chromosomal region with potential association with PBC was found according to the significance level (P value less than 0.0001) , and the SNPs and their alleles that were significantly associated with PBC susceptibility were obtained. The imputation of SNP is based on the results of the Han nationality in the Thousand Genomes Project as the reference value (Reference), using IMPUTE2 software, combined with the results of 1,122 PBC patients and 4,036 normal controls.

The analysis results are shown in Table 2 and Figure 1. The results show that in the IL16 gene region, there are 7 single nucleotide polymorphism sites (rs11857713, rs4778636, rs11073001, rs11556218, rs1803275, rs11325, rs4778640) disease-related haplotype frequency It was significantly higher in PBC than in the control population, with a p value of 3.33-9.67×10 ^-6 . There are 7 SNPs in linkage disequilibrium with rs11857713, rs4778636, rs11073001, rs11556218, rs1803275, rs11325, rs4778640 (r ² =0.9-1) to calculate the corresponding p value, all of which were significantly higher in PBC than in the control population (p=9.91 -3.15×10 ^-6 ). Linkage disequilibrium (LD) between single nucleotide polymorphism sites in chromosome regions refers to the non-random combination of different single nucleotide polymorphism sites, expressed by r ² ( 0-1).

This series of SNPs and their alleles are: rs17875509, the allele is G/C; rs11857713, the allele is C/T; rs4778636, the allele is G/A; rs11073001 , the allele is A/G; rs11630277, the allele is C/A; rs56859031, the allele is A/AGT; rs57763246, the allele is C/T; rs17875523, the allele is C/T; rs3898677 , the allele is T/C; rs139879640, the allele is TCTCA/T; rs4577037, the allele is T/G; rs3899547, the allele is A/G; rs17875532, the allele is C/T; rs17875533, the allele is C/A; rs11556218, the allele is T/G; rs1803275, the allele is G/A; rs3926277, the allele is C/A; rs3926278, the allele is C/G; rs3926279, the allele is A/G; rs17875542, the allele is G/C; rs17875543, the allele is C/T; rs7166271, the allele is C/T; rs11325, the allele is G/T; rs4778640, the allele is A/G. The risk alleles are: rs17875509 polymorphic site is C; rs11857713 polymorphic site is T; rs4778636 polymorphic site is A; rs11073001 polymorphic site is G; rs11630277 polymorphic site A; rs56859031 polymorphism is AGT; rs57763246 polymorphism is T; rs17875523 polymorphism is T; rs3898677 polymorphism is C; rs139879640 polymorphism is T; The polymorphic site of rs3899547 is G; the polymorphic site of rs17875532 is T; the polymorphic site of rs17875533 is A; the polymorphic site of rs11556218 is G; the polymorphic site of rs1803275 is A; rs3926277 polymorphism is A; rs3926278 polymorphism is G; rs3926279 polymorphism is G; rs17875542 polymorphism is C; rs17875543 polymorphism is T; rs7166271 polymorphism The sex site is T; the rs11325 polymorphism site is T; the rs4778640 polymorphism site is G (see Table 2). The relative risk of PBC in individuals carrying these risk alleles was 1.27-1.31 times that of non-carriers.

IL-16 gene region single nucleotide polymorphism site sequence:

As shown in SEQ ID NO.1 in the sequence listing:

rs17875509CCTTACCCATGCAGATATGATGCTG[C/G]TTCAATGCTGGCTTCTGAGAAAGAC

As shown in SEQ ID NO.2 in the sequence listing:

rs11857713GTCAAAGCACAAAACAGCTGCCAACT[C/T]ATGACCTTTGTCTTAAAAGTTTAAA

As shown in SEQ ID NO.3 in the sequence listing:

rs4778636CTCCTCCTCTTGAATCCTTCTTGCT[A/G]TTCAGCTTGGAAACTAGAATTTAGG

As shown in SEQ ID NO.4 in the sequence listing:

rs11073001CTGCTGAAACATCTGCCTTGGACAC[A/G]GGGTTCTCGCTCAAGTGAGTTTCTA

As shown in SEQ ID NO.5 in the sequence listing:

rs11630277TCTCATCTTTATTTTTAAAAATAAT[C/T]CTATATATAATTTAAAAAATTCCCA

As shown in SEQ ID NO.6 in the sequence listing:

rs56859031TTTCCATGTGTGTGCAGATGTCTGA[AGT/A]GTGTGTGTGTGTCTGTCTGTAGGTA

As shown in SEQ ID NO.7 in the sequence listing

rs57763246ATAACAAATCAGTCTGATGTCAGTC[C/T]GATGTTAAATTGTTCATCCTCTTGC

As shown in SEQ ID NO.8 in the sequence listing

rs17875523TGTCAGTGGTGACTTCCTTGATTTC[C/T]TGATAAGTTTTCTATCACATAAAAA

As shown in SEQ ID NO.9 in the sequence listing

rs3898677

TTTTAAGTGTTTTTTATGTGATAGA[A/G]AACTTATCAGGAAATCAAGGAAGTC

As shown in SEQ ID NO.10 in the sequence listing

rs139879640TTAAAACCTGTAAGTCTCTATTTC[T/TCTCA]CTGAGTGCAGCTGAGTATTACAA

As shown in SEQ ID NO.11 in the sequence listing

rs4577037AAGATTCCTGACCGTGTAGTTTTACT[G/T]TCTACTTGAAGAGGAGGAAAGAGAG

As shown in SEQ ID NO.12 in the sequence listing

rs3899547GGTAAAGAGTCAGAATTTCTAGGGG[A/G]GGAGCTATAAAAATGTCTAGACTGC

As shown in SEQ ID NO.13 in the sequence listing

rs17875532ATGCTGGCCTCTGTGCCAGCAGCTC[C/T]AATCTAGGACACAATTATCTTTAAT

As shown in SEQ ID NO.14 in the sequence listing

rs17875533GGACTGGACTTGTGTGATTTCTGGT[A/C]CTGACTTCCTTTGGTTTGCTCAGGT

As shown in SEQ ID NO.15 in the sequence listing

rs11556218

TGGTTTGCTCAGGTTCACAGAGTGTTTCCAAA[G/T]GGGCTGGCCTCCCAGGAAGGGACTATTCAGAAGGGCAATGAGGTTCT

As shown in SEQ ID NO.16 in the sequence listing

rs1803275CCAGGCAAGCTGTGATTGTCACAAG[A/G]AAGCTGACTCCAGAGGCCATGCCCG

As shown in SEQ ID NO.17 in the sequence listing

rs3926277AAAAAAACATGTTGGACAAAATATC[A/C]AAGTTTAAAATCAAAGACAGAGTCTGA

As shown in SEQ ID NO.18 in the sequence listing

rs3926278CACACTTGGCCTCATTTGCCTTACC[C/G]TAGTCCTGGACACGTCAGCTCCTGC

As shown in SEQ ID NO.19 in the sequence listing

rs3926279GGATTGGAGTACAAAACCAGTCTGAT[A/G]TGGGGGTCACTTGGATTTCCCTGTG

As shown in SEQ ID NO.20 in the sequence listing;

rs17875542CTCCTGCTGCTGACTGGTTTCGTTA[C/G]AGGAAGTTCTGCTGCGGCTGCAGAA

As shown in SEQ ID NO.21 in the sequence listing;

rs17875543GGTTTCGTTAGAGGAAGTTCTGCTG[C/T]GGCTGCAGAAACCCAGAAGGTAGAG

As shown in SEQ ID NO.22 in the sequence listing

rs7166271ACAAGTCACTTCACCACCATGGGCC[C/T]ATTTGCTTAAATGTTTAGGATGAGA

As shown in SEQ ID NO.23 in the sequence listing

rs11325TCCTAAAATAAGGGCAGAGTCACAC[G/T]GGGGCAGCTGATACAAATTGCAGAC

As shown in SEQ ID NO.24 in the sequence listing

rs4778640AATGAATGAATTCTAAGTCAATCCA[A/G]GAGTCTGATGATTTCTTGAAAAGGG

Table 2 Single nucleotide polymorphisms in the IL-16 gene region significantly associated with primary biliary cholangitis

Wherein "OR (95% CI)" indicates the relative risk of PBC in individuals carrying disease-associated haplotypes compared with individuals carrying normal haplotypes. Chromosomal positions are referenced to Human Genome GRCh37/hg19.

Embodiment 2 rs11556218 verification experiment

Through the verification of rs11556218 in 907 PBC patients and 2027 normal controls, significant differences were also found. The verification samples of PBC patients were the same as those in Example 1; the normal control samples for IL-16 serum analysis were from the physical examination of teachers from Southeast University, with normal biochemical indicators, no liver and spleen abnormalities in B-ultrasound examination, no clinical disease symptoms, and self-reported health. The materials and time in the implementation of the verification experiment are provided by Sequenom Company unless otherwise stated.

Experimental steps:

1. rs11556218 sequence

TGGTTTGCTCAGGTTCACAGAGTGTTTCCAAA[G/T]GGGCTGGCCTCCCAG

GAAGGGACTATTCAGAAGGGCAATGAGGTTCT

2. Primer Design

Use Sequenom's Genotyping Tools and MassARRAY Assay Design software to design PCR amplification primers and single-base extension primers for the SNP sites to be tested, and submit them to Integrated DNA Technologies for synthesis.

Design DNA primers and probes using the following:

rs11556218:

Primer 1 sequence, ACGTTGGATGAGAACCTCATTGCCCTTCTG;

Primer 2 sequence, ACGTTGGATGTGGTTTGCTCAGGTTCACAG;

Probe sequence, GGTTCACAGAGTGTTTCCAAA

3.PCR amplification

PCR amplification was carried out in a 384-well plate using multiplex PCR technology, and the total volume of each reaction system was 5 μl. Prepare the PCR master mix solution in a new 1.5ml EP tube.

Prepare PCR master mix:

PCR Mix for each reaction, μL

10×PCR Buffer 0.5μL

MgCl2 (25mM) 0.4μL

dNTP mix (25mM)0.1μL

HotStar Taq (5U/μL)0.1μL

Water 1.9μL

PCR primer mix (0.5 pmol each of primers 1 and 2) 1 μL

Total Volume 4μL

Use a 24-channel sampler to adjust the sample volume to 4 μL, and add PCRmaster mix solution to each sample well of the 384-well plate. The 384-well plate is the PCR reaction plate. Take out the prepared DNA sample 384-well plate, use a 24-channel sampler, adjust the sample volume to 1μL, each 5μl PCR reaction system contains 20-50ng of template DNA, Hotstar Taq0.5U, and 0.5pmol of each amplification primer , 0.1 μl of 25 mM dNTPs. Set the PCR reaction conditions on a PCR machine compatible with 384-well plates as follows: 94°C for 4 minutes; 94°C for 20 seconds, 56°C for 30 seconds, 72°C for 1 minute, 45 cycles; 72°C for 3 minutes; 4°C hold. Place the 384-well PCR reaction plate on the PCR machine to start the PCR reaction.

4. Alkaline phosphatase treatment of PCR products

After the PCR reaction, the PCR product was treated with SAP (shrimp alkaline phosphatase, shrimp alkaline phosphatase) to remove free dNTPs in the system.

(1) Prepare alkaline phosphatase treatment reaction solution, SAP Mix.

SAP Mix for each reaction, μL

H ₂ O1.53

SAP Buffer(10x)0.17

SAP Enzyme (1.7U/μL)0.3

Total Volume 2

(2) Using a 24-channel sampler, adjust the sample volume to 2 μL, and add SAP Mix to a 384-well PCR reaction plate. For each alkaline phosphatase treatment reaction well, the total volume of the reaction system is 7 μl, including 5 μl of PCR product and 2 μl of SAP Mix.

(3) Place the 384-well plate on a PCR machine compatible with 384-well plates, set the PCR reaction conditions: 37°C for 40 minutes; 85°C for 5 minutes; maintain at 4°C, start the PCR machine for alkaline phosphatase treatment.

5. Single base extension

(1) After the treatment with alkaline phosphatase, a single base extension reaction was performed, and the total volume of the reaction system was 9 μl.

(2) Prepare single base extension reaction solution, EXTEND Mix.

(3) Using a 24-channel sampler, adjust the sample volume to 2 μL, and add EXTEND Mix to the 384-well reaction plate correspondingly. For each reaction well, the single-base extension reaction system included 7 μl of PCR product after SAP treatment and 2 μl of EXTEND Mix solution (0.94 μl of each extension reaction primer mixture, 0.041 μl of iPLEX enzyme, and 0.2 μl of extension mixture).

(4) Place the 384-well plate on a PCR machine compatible with 384-well plates, and set the PCR reaction conditions:

I.94°C for 30 seconds;

II.94°C for 5 seconds;

III.52°C for 5 seconds;

IV.80°C for 5 seconds;

V. GOTO III, 4 more times;

VI. GOTO II, 39 more times;

VII.72°C for 3 minutes;

VIII.4°C forever;

Start the PCR machine to carry out the single base extension reaction.

6. Resin purification

(1) Spread the Clean Resin resin into a 6mg resin plate;

(2) Add 16 μl of water to the corresponding well of the extension product;

(3) Pour the dried resin into the extension product plate, seal the film, and rotate vertically at a low speed for 30 minutes to fully contact the resin with the reactant;

(4) Centrifuge to allow the resin to sink to the bottom of the well.

7. Chip spotting

Start the MassARRAY Nanodispenser RS1000 spotting instrument, and move the extension product after resin purification to the 384-well SpectroCHIP chip.

8. Mass spectrometry detection

The spotted SpectroCHIP chip was analyzed using MALDI-TOF (matrix-assisted laser desorption/ionization–time of flight, matrix-assisted laser desorption ionization time-of-flight mass spectrometry), and the detection results were typed and output using TYPER 4.0 software (sequenom). Valid results were obtained for a total of 907 PBC samples and 2127 control samples.

The results of 907 PBC samples and 2127 control samples were statistically analyzed using PLINK software and the principle of logistic regression, taking gender as a covariate, and according to the superimposed effect model. The disease-associated haplotype (G) frequency of rs11556218 was significantly higher in PBC (0.2326) than in the control population (0.1885), with a p value of 7.0×10 ^-4 . The GWAS results of rs11556218 in 1,122 PBC patients and 4,036 normal controls were compared with The results of rs11556218 in 907 PBC samples and 2127 control samples were superimposed and analyzed, using the principle of fixed-effect model (I2<25%), and the statistical analysis included 2029 PBC samples and 6163 control samples. The results showed that the disease-associated haplotype (G) frequency of rs11556218 was significantly higher in PBC than in the control population, the p value was 8.99×10 ^-9 , and the odds ratio value (96% CI) was 1.29 (1.18-1.41) (see Table 3 ).

Table 3: Results of IL-16 polymorphic site rs11556218 in genome-wide association analysis and validation findings

Example 3 Quantitative analysis of serum IL-16 in patients with primary biliary cholangitis and normal control population

IL-16 quantitative enzyme-linked immunoassay is a mature kit purchased from R&D Systems, Human IL-16 Quantikine ELISA Kit, product number D1600. According to the steps of the kit, 2 μl of serum was used.

Prepare a standard curve according to the standard provided in the kit, and quantify the test samples.

1. Add 100 microliters of diluent (provided in the kit) to the detection well of the ELISA plate;

2. Add 100 microliters of standard sample, negative control (provided in the kit), and 1:5 diluted serum of the test sample (diluted with the diluent provided in the kit) to the detection well of the ELISA plate;

3. Seal the plate and keep at room temperature for 2 hours;

4. Aspirate the liquid, wash 4 times with 200 microliters of washing solution (provided in the kit), and dry;

5. Add 100 microliters of conjugates (provided in the kit), seal the plate, and keep at room temperature for 2 hours;

6. Aspirate the liquid, wash 4 times with 200 microliters of washing solution (provided in the kit), and dry;

7. Add 200 microliters of substrate solution (provided in the kit), and keep at room temperature in the dark for 30 minutes;

8. Add 50 microliters of stop solution (provided in the kit), within 30 minutes, use an ELISA plate reader (iMarkMicroplate Absorbance Reader, Bio-Rad Company), set the wavelength to 450nm, and read the results.

In this experiment, 120 cases of PBC patients and 120 cases of normal control serum were quantitatively analyzed, and GraphPad Prism6 software was used to draw graphs and perform statistical analysis. All data were expressed as mean ± standard deviation, and Mann- Whiteny U test, Kruskal-Wallis test was used for the expression of IL-16 in different genotypes of rs11556218, and the two-tailed test P value <0.05 was considered statistically significant. Statistics found that the serum concentration of IL-16 was significantly higher in PBC patients than in normal controls (P<0.0001).

The above are only preferred embodiments of the present invention. For those skilled in the art, without departing from the principle of the present invention, other changes or changes in different forms can also be made, and these should also belong to the protection of the present invention. scope.

SEQUENCE LISTING

<110> Southeast University

<120> Interleukin 16 associated with primary biliary cholangitis and its application

<130> SG20161114001

<160> 27

<170> PatentIn version 3.3

<210> 1

<211> 51

<212>DNA

<213>rs17875509

<221> misc_feature

<223> n is c or g

<400> 1

ccttacccat gcagatatga tgctgnttca atgctggctt ctgagaaaga c 51

<210> 2

<211> 51

<212>DNA

<213>rs11857713

<220>

<221> misc_feature

<223> n is c or t

<400> 2

gtcaaagcac aaacagctgc caactnatga cctttgtctt aaaagtttaa a 51

<210> 3

<211> 51

<212>DNA

<213>rs4778636

<221> misc_feature

<223> n is a or g

<400> 3

ctcctcctct tgaatccttc ttgctnttca gcttggaaac tagaatttag g 51

<210> 4

<211> 51

<212>DNA

<213>rs11073001

<221> misc_feature

<223> n is a or g

<400> 4

ctgctgaaac atctgccttg gacacngggt tctcgctcaa gtgagtttct a 51

<210> 5

<211> 51

<212>DNA

<213>rs11630277

<221> misc_feature

<223> n is c or t

<400> 5

tctcatcttt atttttaaaa ataatnctat atataattta aaaaattccc a 51

<210> 6

<211> 51

<212>DNA

<213>rs56859031

<221> misc_feature

<223> n is g or t

<400> 6

tttccatgtg tgtgcagatg tctgangtgt gtgtgtgtct gtctgtaggt a 51

<210> 7

<211> 51

<212>DNA

<213>rs57763246

<221> misc_feature

<223> n is c or t

<400> 7

ataacaaatc agtctgatgt cagtcngatg ttaaattgtt catcctcttg c 51

<210> 8

<211> 51

<212>DNA

<213>rs17875523

<221> misc_feature

<223> n is c or t

<400> 8

tgtcagtggt gacttccttg atttcntgat aagttttcta tcacataaaa a 51

<210> 9

<211> 51

<212>DNA

<213>rs3898677

<221> misc_feature

<223> n is a or g

<400> 9

ttttaagtgt tttttatgtg ataganaact tatcaggaaa tcaaggaagt c 51

<210> 10

<211> 48

<212>DNA

<213>rs139879640

<221> misc_feature

<223> n is t or tctca

<400> 10

taaaacctg taagtctcta tttcnctgag tgcagctgag tattacaaaa 50

<210> 11

<211> 51

<212>DNA

<213>rs4577037

<221> misc_feature

<223> n is g, or t

<400> 11

aagattcctg accgtgtagt ttactntcta cttgaagagg aggaaagaga g 51

<210> 12

<211> 51

<212>DNA

<213>rs3899547

<221> misc_feature

<223> n is a or g

<400> 12

ggtaaagagt cagaatttct aggggngggag ctataaaaat gtctagactg c 51

<210> 13

<211> 51

<212>DNA

<213>rs17875532

<221> misc_feature

<223> n is c or t

<400> 13

atgctggcct ctgtgccagc agctcnaatc taggacacaa ttatctttaa t 51

<210> 14

<211> 51

<212>DNA

<213>rs17875533

<221> misc_feature

<223> n is a or c

<400> 14

ggactggact tgtgtgattt ctggtnctga cttcctttgg tttgctcagg t 51

<210> 15

<211> 51

<212>DNA

<213>rs11556218

<221> misc_feature

<223> n is g or t

<400> 15

ctcaggttca cagagtgttt ccaaangggc tggcctccca ggaagggact a 51

<210> 16

<211> 51

<212>DNA

<213>rs1803275

<221> misc_feature

<222> (26)..(26)

<223> n is a or g

<400> 16

ccaggcaagc tgtgattgtc acaagnaagc tgactccaga ggccatgccc g 51

<210> 17

<211> 51

<212>DNA

<213>rs3926277

<221> misc_feature

<223> n is a or c

<400> 17

aaaaaaacat gttggacaaa atatcnaagt ttaaatcaag acagagtctg a 51

<210> 18

<211> 51

<212>DNA

<213>rs3926278

<221> misc_feature

<223> n is c or g

<400> 18

cacacttggc ctcatttgcc ttaccntagt cctggacacg tcagctcctg c 51

<210> 19

<211> 51

<212>DNA

<213>rs3926279

<221> misc_feature

<223> n is a or g

<400> 19

ggattggagt acaaaccagt ctgatntggg ggtcacttgg atttccctgt g 51

<210> 20

<211> 51

<212>DNA

<213>rs17875542

<221> misc_feature

<223> n is c or g

<400> 20

ctcctgctgc tgactggttt cgttanagga agttctgctg cggctgcaga a 51

<210> 21

<211> 51

<212>DNA

<213>rs17875543

<221> misc_feature

<223> n is c or t

<400> 21

ggtttcgtta gaggaagttc tgctggnggct gcagaaaccc agaaggtaga g 51

<210> 22

<211> 51

<212>DNA

<213>rs7166271

<221> misc_feature

<223> n is c or t

<400> 22

acaagtcact tcaccaccat gggccnattt gcttaaatgt ttaggatgag a 51

<210> 23

<211> 51

<212>DNA

<213>rs11325

<221> misc_feature

<223> n is g or t

<400> 23

tcctaaaata agggcagagt cacacngggg cagctgatac aaattgcaga c 51

<210> 24

<211> 51

<212>DNA

<213>rs4778640

<221> misc_feature

<223> n is a or g

<400> 24

aatgaatgaa ttctaagtca atccangagt ctgatgattt cttgaaaagg g 51

<210> 25

<211> 30

<212>DNA

<213> Primer 1 sequence

<400> 25

acgttggatg agaacctcat tgcccttctg 30

<210> 26

<211> 30

<212>DNA

<213> Primer 2 sequence

<400> 26

acgttggatg tggtttgctc aggttcacag 30

<210> 27

<211> 21

<212>DNA

<213> probe sequence

<400> 27

ggttcacaga gtgtttccaa a 21

Claims (27)

1. Applications of the 1.IL-16 in the product for preparing detection or auxiliary detection, examination or prediction primary biliary cholangitis.
2. The reagent of 2.IL-16 gene polymorphics site rs17875509 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs17875509 sequences as shown in the SEQ ID NO.1 in sequence table, wherein, it is single Nucleotides n is higher than allele G for the risk of carrier's primary biliary cholangitis of C.
3. The reagent of 3.IL-16 gene polymorphics site rs11857713 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs11857713 sequences as shown in the SEQ ID NO.2 in sequence table, wherein, it is single Nucleotides n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
4. The reagent of 4.IL-16 gene polymorphics site rs4778636 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs4778636 sequences as shown in the SEQ ID NO.3 in sequence table, wherein, monokaryon glycosides Sour n is higher than allele G for the risk of carrier's primary biliary cholangitis of A.
5. The reagent of 5.IL-16 gene polymorphics site rs11073001 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs11073001 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele A for the risk of carrier's primary biliary cholangitis of G.
6. The reagent of 6.IL-16 gene polymorphics site rs11630277 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs11630277 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
7. The reagent of 7.IL-16 gene polymorphics site rs56859031 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs56859031 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele A for the risk of carrier's primary biliary cholangitis of AGT.
8. The reagent of 8.IL-16 gene polymorphics site rs57763246 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs57763246 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
9. The reagent of 9.IL-16 gene polymorphics site rs17875523 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs17875523 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
10. The reagent of 10.IL-16 gene polymorphics site rs3898677 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs3898677 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, monokaryon Thuja acid n is higher than allele T for the risk of carrier's primary biliary cholangitis of C.
11. The reagent of 11.IL-16 gene polymorphics site rs139879640 is preparing detection or auxiliary detection, examination or is predicting primary Application in the product of the biliar cholangitis of property, rs139879640 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, Mononucleotide n is higher than allele TCTCA for the risk of carrier's primary biliary cholangitis of T.
12. The reagent of 12.IL-16 gene polymorphics site rs4577037 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs4577037 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, monokaryon Thuja acid n is higher than allele T for the risk of carrier's primary biliary cholangitis of G.
13. The reagent of 13.IL-16 gene polymorphics site rs3899547 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs3899547 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, monokaryon Thuja acid n is higher than allele A for the risk of carrier's primary biliary cholangitis of G.
14. The reagent of 14.IL-16 gene polymorphics site rs17875532 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs17875532 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
15. The reagent of 15.IL-16 gene polymorphics site rs17875533 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs17875533 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele C for the risk of carrier's primary biliary cholangitis of A.
16. The reagent of 16.IL-16 gene polymorphics site rs11556218 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs11556218 sequences as shown in the SEQ ID NO.5 in sequence table, wherein, it is single Nucleotides n is higher than allele T for the risk of carrier's primary biliary cholangitis of G.
17. The reagent of 17.IL-16 gene polymorphics site rs1803275 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs1803275 sequences as shown in the SEQ ID NO.6 in sequence table, wherein, monokaryon Thuja acid n is higher than allele G for the risk of carrier's primary biliary cholangitis of A.
18. The reagent of 18.IL-16 gene polymorphics site rs3926277 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs3926277 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, monokaryon Thuja acid n is higher than allele C for the risk of carrier's primary biliary cholangitis of A.
19. The reagent of 19.IL-16 gene polymorphics site rs3926278 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs3926278 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, monokaryon Thuja acid n is higher than allele C for the risk of carrier's primary biliary cholangitis of G.
20. The reagent of 20.IL-16 gene polymorphics site rs3926279 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs3926279 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, monokaryon Thuja acid n is higher than allele A for the risk of carrier's primary biliary cholangitis of G.
21. The reagent of 21.IL-16 gene polymorphics site rs17875542 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs17875542 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele G for the risk of carrier's primary biliary cholangitis of C.
22. The reagent of 22.IL-16 gene polymorphics site rs17875543 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs17875543 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, it is single Nucleotides n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
23. The reagent of 23.IL-16 gene polymorphics site rs7166271 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs7166271 sequences as shown in the SEQ ID NO.4 in sequence table, wherein, monokaryon Thuja acid n is higher than allele C for the risk of carrier's primary biliary cholangitis of T.
24. The reagent of 24.IL-16 gene polymorphics site rs11325 is preparing detection or auxiliary detection, examination or prediction primary courage Application in the product of juice cholangitis, rs11325 sequences as shown in the SEQ ID NO.7 in sequence table, wherein, mononucleotide N is higher than allele G for the risk of carrier's primary biliary cholangitis of T.
25. The reagent of 25.IL-16 gene polymorphics site rs4778640 is preparing detection or auxiliary detection, examination or prediction primary Application in the product of biliar cholangitis, rs4778640 sequences as shown in the SEQ ID NO.8 in sequence table, wherein, monokaryon Thuja acid n is higher than allele A for the risk of carrier's primary biliary cholangitis of G.
26. Applications of 26. IL-16 in PBC animal models are prepared.
27. Applications of 27. IL-16 in terms of PBC medicines are prepared.