CN106834325A - One can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid vector - Google Patents

One can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid vector Download PDF

Info

Publication number
CN106834325A
CN106834325A CN201710091992.7A CN201710091992A CN106834325A CN 106834325 A CN106834325 A CN 106834325A CN 201710091992 A CN201710091992 A CN 201710091992A CN 106834325 A CN106834325 A CN 106834325A
Authority
CN
China
Prior art keywords
val
rdrp
leu
pro
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710091992.7A
Other languages
Chinese (zh)
Other versions
CN106834325B (en
Inventor
原雪峰
逯晓明
于成明
王国鲁
王德亚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Agricultural University
Original Assignee
Shandong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Agricultural University filed Critical Shandong Agricultural University
Priority to CN201710091992.7A priority Critical patent/CN106834325B/en
Publication of CN106834325A publication Critical patent/CN106834325A/en
Application granted granted Critical
Publication of CN106834325B publication Critical patent/CN106834325B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/127—RNA-directed RNA polymerase (2.7.7.48), i.e. RNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07048—RNA-directed RNA polymerase (2.7.7.48), i.e. RNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to phytovirology and molecular biology, there is provided a prokaryotic expression carrier for tobacco bushy top virus (TBTV) RdRp albumen.The entitled pMAL TB RdRp of the plasmid vector, the RdRp coded sequences containing TBTV China separator.The plasmid as TBTV RdRp albumen prokaryotic expression carrier, its prokaryotic expression product can obtain active RdRp albumen by affinitive layer purification, the replication in vitro research system of RdRp mediations is set up, this replication in vitro system can be used for the research that TBTV replicates regulation and control in the future.

Description

One can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid Carrier
Technical field
The present invention relates to phytovirology and molecular biology, there is provided one can prokaryotic expression tobacco bushy top virus China The plasmid vector of separator RdRp albumen.
Background technology
Tobacco bushy top disease (tobacco bushy top disease) reported first in 1958 in African Zimbabwe, Afterwards successively in its neighbouring country, and Pakistan in Asia, Thailand find.The nineties, in Baoshan, Yunnan, Three Rivers regions outburst stream OK, in part, cigarette district causes crushing disaster.At present, the disease sporadicly occurs in the main cigarette district such as Dali, the Baoshan and Yuxi.It is susceptible Cigarette strain leaf color pale green or yellow, and with system necrosis withered spot or downright bad strain line, seedling stage susceptible cigarette strain is seriously downgraded, contract top, leaf Piece diminishes, and the cigarette strain axillary bud hyperplasia that late period is susceptible, plant type is as close raw leaflet, the Cong Zhizhuan towers of sprig.
Tobacco bushy top disease generally by Tombusviridae (Tombusviridae) Umbravi-rus (Umbravirus) into Member's tobacco bushy top virus (Tobacco bushy top virus, TBTV) and the tobacco of Lutoevirus section (Luteoviridae) Arteries and veins virus (Tobacco vein distorting virus, TVDV) Combined Infection is turned round to cause.Under natural conditions, tobacco clump top It is sick main by aphis propagation；The juice frictional inoculation health tobacco seedlings of tobacco seedlings of falling ill can also cause a disease, but cause the loss of TVDV, and not Can be by aphis propagation；Show that TVDV can not be propagated by mechanical inoculation, TBTV falls ill by being individually inoculated with tobacco seedlings.
Mo Xiaohan is equal to the genom sequence for reporting TBTV China separator for 2003.The genome of TBTV is one (+) ssRNA, is made up of 4152 nucleotides.4 albumen of its genome encoding, the encoder block of wherein ORF1 and ORF2 is overlapped deposits It is replicase (RdRp) component of virus in, expression product, ORF3 albumen may participate in the long-distance transportation of virus, ORF4 albumen It is probably the functional protein moved between virocyte.Similar to other Umbravi-rus member, the ends of TBTV 5 ' noncoding region is very short (10nt), ORF1 encodes the albumen of 35kD, and ORF2 then encodes the albumen of 98kD, is the frame-shift translation mechanism table that ORF1 passes through -1 Up to generation, its N-terminal is identical with ORF1 protein sequences, and ORF2 albumen possesses the RNA polymerase (RNAdependent of RNA dependences RNA polymerase, RdRp) activity.RdRp activated proteins participate in the duplication of TBTV genomes, directly determine TBTV in plant Internal levels of replication and pathogenic.But currently without the research system that independent studies TBTV RdRp controlling genes group is replicated, Simultaneously because TBTV RdRp are frameshit products, plant interior expression amount is very low；It is necessary to obtain RdRp by prokaryotic expression, enters And setting up replication in vitro system replicate the independent studies of regulation and control；But prior art indicates that the albumen for possessing RdRp activity exists Loss of activity is easily caused in prokaryotic expression, purge process, thus replication in vitro system cannot be set up, thus according to prior art Replication in vitro system cannot be set up.
The content of the invention
The invention provides a prokaryotic expression carrier for tobacco bushy top virus (TBTV) RdRp albumen.Plasmid vector name Referred to as pMAL-TB-RdRp, the RdRp coded sequences containing TBTV China separator.The plasmid as TBTV RdRp albumen original Nuclear expression carrier, prokaryotic expression product can obtain active RdRp albumen by affinitive layer purification, set up RdRp mediations Replication in vitro research system.
Inventor disclose first one can the plasmid of prokaryotic expression tobacco bushy top virus China separator RdRp albumen carry Body, the entitled pMAL-TB-RdRp of the plasmid vector, the coded sequence containing TBTV China separator RdRp albumen, its nucleotides As shown in Seq ID No.1, amino acid sequence is as shown in Seq ID No.2 for sequence.
The prokaryotic expression product of the plasmid vector through affinitive layer purification, using the outer replisome of protein constructs after purification System, is its complementary strand of templated synthesis using the special RNA fragments of TBTV, and the replication in vitro system of this TBTV RdRp mediations can be Further qualitative, quantitative research TBTV genome duplication regulation and control lay the foundation.
Inventor also disclose this can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid vector The construction method of pMAL-TB-RdRp is as follows：
According to genom sequence (the Genebank accession number of TBTV China separator：AF402620), design primer M- TB-ORF1-5'F and M-TB-ORF2-3'R (details are shown in Table 1), corresponds respectively to the initiation codon of RdRp and terminates close Sequence near numeral.
Because TBTV RdRp are expressed by ORF1 with -1 type frame-shift translation mechanism, therefore in TBTV sequences And in the absence of the direct coding sequence of RdRp, it is impossible to directly expanded by PCR and obtain RdRp coded sequences.To obtain TBTV RdRp coded sequences, 955 by overlapping PCR method in TBTV full length sequences are inserted a base (figure and between 956 bit bases Shown in 1), form the complete encoder block of RdRp.
With plasmid pMTB1 (kingdom Shandong etc., 2016, public affairs in Plant Pathology containing TBTV China separator complete sequence Open) it is template, using primer pair M-TB-ORF1-5'F/TB-936+C+956-R and primer pair TB-948+C+956-F/M- TB-ORF2-3'R is expanded in the presence of pfu Taq archaeal dna polymerases and is respectively obtained about 950bp (A sections of product) and 1700bp (B Section product) PCR primer, A section and B sections of PCR primer after glue reclaim, recycling M-TB-ORF1-5'F and M-TB-ORF2-3'R The fragment that over-lap PCR obtains about 2600bp is carried out under the effect of Fast Pfu Taq archaeal dna polymerases, this PCR primer and plasmid PMAL-C2X is attached through Pst I and EcoR I double digestions respectively, and converted product is through bacterium colony PCR screenings, digestion identification and matter Grain DNA sequencing, confirmation obtains the prokaryotic expression carrier pMAL- of the albumen coded sequences of the RdRp containing TBTV based on pMAL-C2X TB-RdRp。
The primer used in 1 research of table
Primer name Sequence(5'to 3') PCR fragment Seq ID No
M-TB-ORF1-5'F RdRp Seq ID No.3
M-TB-ORF2-3'R RdRp Seq ID No.4
TB-948+C+956-F ATTTTTGCCTAGGGGATGTGGTCGC RdRp Seq ID No.5
TB-936+C+956-R ATCCCCTAGGCAAAAATCCTTGGGCCCAC RdRp Seq ID No.6
TB-T7-1-F taa tac gac tca ctataGAGGTTACGATATGGAGTTC TB 5'160nt Seq ID No.7
TB-(144-160)-R GATCCCCGGGGCGTGACACCTCATTGG TB 5'160nt Seq ID No.8
TB-T7-925-F GCtaatacgactcactataGGGCCCTTCAATGTGGGC TB int 195nt Seq ID No.9
TB-1120-R GGGAGTTGTTGTGGACTCC TB int 195nt Seq ID No.10
TB-T7-4003-F GCtaatacgactcactataGGCAGAAACCAAGTAGCAAAT TB 3'150nt Seq ID No.11
TB-4152Y-R GGGCGCGAGAGAAA TB 3'150nt Seq ID No.12
TBTV-210R-5'F AGGTTACGATATGGAGTTCATCAACAAG TB minus 3'210nt Seq ID No.13
TBTV-210R-3'R TAGCtaatacgactcactataGGCAAGCGGTAGGTGG TB minus 3'210nt Seq ID No.14
Note：Restriction enzyme site represents that T7 promoter sequence small letter italics are represented with underscore, inserts base shade table Show；
int：Intermediate sequence, nt：Nucleotides, minus：Genome complementation chain
After obtaining plasmid pMAL-TB-RdRp, inventor carries out prokaryotic expression using the plasmid, and by affinity chromatography side The RdRp fusion proteins of method purification of soluble, and then the replication in vitro system of RdRp mediations is set up, test result indicate that TBTV RdRp albumen can specific recognition TBTV genomes chain or complementary strand 3 ' terminal fragments, and with its be template produce it is respective mutually Mend chain.Key step includes：
1) the pre- expression of the RdRp albumen of fusion MBP labels：
By the competent cell of plasmid pMAL-TB-RdRp conversion Escherichia coli Rossetta, surveyed using SDS-PAGE electrophoresis Examination 0.5M IPTG concentration confirms to the inducing action of destination protein (the RdRp albumen with MBP labels, be named as MBP-RdRp) Whether 0.5mM IPTG can induce the expression of destination protein.
2) soluble analysis of MBP-RdRp albumen：
On the premise of confirming that the inducible destination proteins of IPTG are expressed, the solubility of analysis purpose albumen.Test difference is lured Influence of the temperature for soluble destination protein ratio is led, confirms that optimal inducing temperature is 18 DEG C, it is ensured that soluble purpose egg White ratio can meet follow-up affinitive layer purification.
3) Amylose Resin affinity column chromatographies purifying (MBP labels) of soluble protein：
Using Amylose Resin (NEB companies) preparative chromatography post, purified through filling the steps such as post, balance, loading, wash-out Soluble M BP-RdRp albumen, for follow-up replication in vitro active testing.
4) the replication in vitro system of NIb mediations：
TBTV genome different fragments RNA (including 5' ends, intermediate sequence, 3' ends are prepared by in-vitro transcription first With the 3' ends of complementary strand), then test the catalytic capability of the MBP-RdRp albumen for different RNA fragments of purifying, final body It is outer replicate experiment show MBP-RdRp albumen can specific recognition TBTV genomes chain or complementary strand 3 ' terminal fragments, and with It is that template produces respective complementary strand.
In sum, present invention obtains one can prokaryotic expression tobacco bushy top virus China separator RdRp albumen matter Grain carrier, the entitled pMAL-TB-RdRp of the plasmid vector, the RdRp coded sequences containing TBTV China separator.The plasmid is made It is the prokaryotic expression carrier of TBTV RdRp albumen, prokaryotic expression product can obtain active RdRp by affinitive layer purification Albumen, sets up the replication in vitro research system of RdRp mediations.
Brief description of the drawings
Fig. 1 is the schematic diagram that artificial -1 type frameshit is built in 955 and 956 interdigits insertion base；
Fig. 2 is plasmid pMAL-TB-RdRp digestion qualification result electrophoresis schematic diagrames,
Wherein M is the DNA Ladder 5000 of SinoBio companies, and carrier and NIb coding fragments are respectively obtained after digestion；
Fig. 3 is the result schematic diagram of the prokaryotic expression of plasmid pMAL-TB-RdRp,
Wherein M is the Blue Plus II Protein Marker of Transgen companies.There is about 120kDa after IPTG inductions Differential protein expression, its molecular weight is consistent substantially with the molecular weight sum of RdRp (95kD) and MBP labels (40kD)；
Fig. 4 is the soluble analysis result schematic diagram of prokaryotic expression product under different temperatures,
Wherein M has about 120kDa for Blue Plus II the Protein Marker, IPTG of Transgen companies after inducing Differential protein expression, ultrasonication post analysis supernatant precipitation in destination protein (MBP-RdRp) ratio, wherein 18 DEG C Ratio highest of the destination protein of induction in supernatant, about 20%；
Fig. 5 is the replication in vitro result schematic diagram of TBTV-RdRp mediations,
Replication in vitro experiment is that analysis purifying obtains whether RdRp fusion proteins have the special of catalysis activity and its identification Property template, as seen from the figure, MBP-RdRp can specific recognition TBTV normal chains and strand RNA 3' fragments, catalysis produces respective Complementary strand.
Specific embodiment
Other use prior art unless otherwise specified in the embodiment of the present invention；
Embodiment 1
One can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid vector pMAL-TB-RdRp Construction method, comprises the following steps that：
According to genom sequence (the Genebank accession number of TBTV China separator：AF402620), design primer M- TB-ORF1-5'F and M-TB-ORF2-3'R (table 1).Simultaneously in order to expand the coded sequence to RdRp, by over-lap PCR 955 Position and 956 interdigits insert a base (as shown in Figure 1), design overlapping PCR primers TB-936+C+956-R and TB-948+C+ 956-F (table 1).
With plasmid pMTB1 (kingdom Shandong etc., 2016, public affairs in Plant Pathology containing TBTV China separator complete sequence Open) it is template, using primer pair M-TB-ORF1-5'F/TB-936+C+956-R and TB-948+C+956-F/M-TB-ORF2-3' R respectively obtains about 950bp (RdRp A sections of product) and (RdRp B sections of 1700bp in the effect amplification of Pfu Taq archaeal dna polymerases Product) PCR primer, 94 DEG C of predegeneration 5min of PCR conditions；94 DEG C, 40s denaturation, 55 DEG C, 40s annealing, (A sections is prolonged for 72 DEG C of extensions Stretch 1min, B sections of extension 2min), 30 circulations；72 DEG C of extension 10min；4 DEG C of preservations.
PCR primer through 1.0% agarose gel electrophoresis, gel extraction purpose fragment, through DNA QIAquick Gel Extraction Kits (full formula Gold, EG101-02) reclaim.
A sections and B sections of product recycling primer M-TB-ORF1-5'F and M-TB-ORF2-3'R of recovery is in FastPfu Taq The fragment that over-lap PCR obtains about 2600bp, 94 DEG C of predegeneration 5min of PCR reaction conditions are carried out under archaeal dna polymerase effect；94 DEG C of changes Property 40s, 45 DEG C annealing 40s, 72 DEG C extension 3min, 5 circulation；94 DEG C of denaturation 40s, 55 DEG C of annealing 40s, 72 DEG C of extension 3min, 25 circulations；72 DEG C of extension 10min；4 DEG C of preservations.Overlapping PCR products through 1.0% agarose gel electrophoresis, gel extraction mesh Fragment, with DNA QIAquick Gel Extraction Kits (Quan Shijin, EG101-02) reclaim.
Overlapping PCR products and plasmid pMAL-C2X are attached after Pst I and EcoR I double digestions respectively, connector System：The μ g of digestion carrier 0.1, the μ g of digestion target DNA 2.0, the μ l of 10 × T4DNA ligase Buffer 2, T4DNA ligase 1 μl、ddH2To 20 μ l, reaction temperature is 16 DEG C to O polishings.Overnight connect.
Connection product converts bacillus coli DH 5 alpha competent cell, and positive colony is obtained through bacterium colony PCR screenings.Extract plasmid PMAL-TB-RdRp, carries out digestion identification.The double digestion of Pst I and EcoR I obtains about 2600bp and 6000bp digestion bands (result is as shown in Figure 2), illustrates to contain the identical insertion of the coding clip size with ORF1/ORF2 fusion proteins in recombinant plasmid Fragment.Finally, confirm to obtain the prokaryotic expression of the TBTV ORF1/ORF2 fusion proteins based on pMAL-C2X through DNA sequencing Carrier pMAL-TB-RdRp.
Embodiment 2
The prokaryotic expression of TBTV-RdRp albumen:：
By the competent cell of plasmid pMAL-TB-RdRp conversion Escherichia coli Rossetta, apply and carry 100mg/mL ammonia benzyls The LB flat boards of penicillin；Rossetta bacterial strain of the picking containing recombinant plasmid is placed in the LB fluid nutrient mediums of 5ml (containing antibiotic), 37 DEG C, overnight incubation in 200rpm incubators；The bacterium solution of incubated overnight is taken by 1:100 ratio is added to the fresh LB liquid of 20ml (contain antibiotic) in body culture medium, 37 DEG C, 200rpm is cultivated between OD600 to 0.4-0.6；The bacterium solution of fresh cultured is put Put in 10min on ice, be dispensed into dactylethrae, often pipe 3ml, totally 2 pipe.IPTG is added to be respectively 0mM, 0.5mM to final concentration.37 DEG C, 200pm cultures 4h；Collect 3ml Induced cultures in 1.5mL centrifuge tubes, 13000rpm is centrifuged 30s, and collects thalline is gone Clearly.
Sample treatment：30 μ l ddH are added in bacterium to collection2O, vibration suspends, and adds on isometric 2 × SDS albumen Sample buffer solution.Boiling water bath 5min, stands 5min on ice.Run glue and detection：Above-mentioned sample is respectively taken into 10 μ l point samples, 120V electrophoresis, Run out of completely (2-3h) to bromophenol blue index strip.Dyeing：Separation gel is placed in culture dish, adds dyeing liquor, preservative film to seal, Middle fire heating 15s high, takes out in micro-wave oven, and horizontal shaker shake 10min outwells dyeing liquor, and dyeing liquor is reclaimed.Decolourize：Plus Enter destainer, middle fire heating 15s high, horizontal shaker shake 10min, remove destainer in micro-wave oven, add dd H2O, and level is shaken Bed vibration is clean to decolourizing, testing goal band.
Interpretation of result：SDS- polyacrylamide gel electrophoresis results show, the bacterium solution of 0.5M IPTG inductions is not relative to luring For the bacterium solution led, there is the expression of obvious inducible protein in 120KDa or so, this albumen size and the RdRp albumen for merging MBP Size coincide substantially.(as shown in Figure 3)
Embodiment 3
Merge the soluble analysis of the RdRp albumen of MBP:
According to the basic step of prokaryotic expression, 50ml bacterium solutions are induced at different temperatures, choose 18 DEG C, 26 DEG C, 37 DEG C of temperature Degree environment, overnight incubation in 200rpm incubators sets CK groups (without IPTG inductions)；Each inductive condition collects 1ml bacterium solutions respectively, Treatment sample is standby, remaining sample centrifugation collection bacterium, 8000rpm, 5min, 4 DEG C；By microorganism collection thing 5.0ml albumen buffer solutions Again suspend.Since this step, all operations are carried out on ice.
Suspension carries out ultrasonic disruption：400W, 100 times, work 4s, is spaced 4s, is carried out on ice.
It is centrifuged after broken：13000rpm, 15min, 4 DEG C, separate supernatant with precipitation.
The microorganism collection thing that sample treatment induces 1ml and the microorganism collection thing that 1ml is not induced are separately added into 20 μ l water, acute Strong vibration adds isometric 2 × SDS albumen sample-loading buffers after suspending.For the precipitation after ultrasonication, processing method Ibid；For the supernatant after ultrasonication, isometric 2 × SDS albumen sample-loading buffers are added.By above-mentioned sample boiling water Bath 5min, stands 5min on ice.Then, SDS-PAGE electrophoresis is carried out, and is dyeed and detection of being decolourized.
Interpretation of result：Under condition of different temperatures, there is larger difference in the solvable sex ratio of destination protein；By to 18 DEG C, 26 DEG C, 37 DEG C of expression product analysis find, 18 DEG C of ratio highests in supernatant of destination protein of induction, about 20%； And 26 DEG C, the ratio at 37 DEG C be only for about 3% and less than 1% (as shown in Figure 4).
Embodiment 4
Amylose Res in affinity column chromatographies purifying (MBP labels) of soluble protein：
Induce and crush, according to the method for prokaryotic expression, at a temperature of 18 DEG C, 0.5M IPTG induction 500ml bacterium solutions, and surpass Sonication；By supernatant with 0.45 μm of water system membrane filtration to 50ml corning tube, place on ice, waited Post.(note：Whole chromatography process is carried out in 4 DEG C of environment)
Dress post:Take in 2mL Amylose Resin (NEB companies, 0111207) filler addition chromatographic column, let the liquid out； Balance:With the 5-10 times of equilibration buffer chromatographic column of column volume；Loading:Sample is passed through into chromatographic column；Washing:With 5-10 times The equilibrium liquid washing chromatographic column of column volume, collects efflux；Wash-out:(collected with centrifuge tube with 3ml elution destination proteins Eluent, often the μ l of pipe 500, flag sequence, place on ice).Often pipe wash-out protein will take and carry out SDS-PAGE electrophoresis on a small quantity, will contain Purposeful protein storage is at -80 DEG C.
Level pad (Amylose Resin) employed in it：20mM Tris-Cl (pH 8.0), 25mM NaCl, 1mM EDTA (pH 8.0), 10mM β-mercaptoethanol, 10%glycerol；
Elution buffer (Amylose Resin)：0.5M maltose mother liquors are added in equilibrium liquid, maltose is dense eventually Degree reaches 10mM.
Embodiment 5
In-vitro transcription prepares the different RNA fragments of TBTV：
With the plasmid pMTB1 (kingdom Shandong etc., 2016, disclosed in Plant Pathology) containing TBTV China separator for mould Plate, PCR fragment (including genome 5' ends, intermediate sequence, the 3' ends obtained corresponding to TBTV diverse locations are expanded by PCR End and the 3' ends of complementary strand) (the primer is shown in Table 1), and cut using DNA QIAquick Gel Extraction Kits (Quan Shijin, EG101-02) Glue reclaim.It is template using above PCR primer, is turned in vitro in the presence of t7 rna polymerase (Pu Luomaige, P2075) Record reaction (reaction system：4.0 μ g, 100mM DTT of PCR primer, 12.0 μ l, 5mM rNTPs 12.0 μ l, 5 × T7Buffer The μ l of 24.0 μ l, Rnase enzyme inhibitor 0.5, t7 rna polymerase 2.0 μ l, H2O is mended to 120 μ l), 37 DEG C of reaction temperature, during reaction Between 2.5h；Product cuts the corresponding RNA fragments of glue purification after 1.5% agarose gel electrophoresis.RNA fragments are made after purification For the template of replication in vitro is standby.
Embodiment 6
The replication in vitro system of TBTV RdRp mediations：
Replication in vitro reaction (reaction system is carried out in the presence of TBTV RdRp albumen：RNA templates 1.0 μ g, 1M Tris-Cl (pH 8.2) 2.5 μ l, 1M MgCl20.5 μ l, 1M DTT, 0.5 μ l, 1M KCl 5 μ l, 10mg/ml yeast 2.5 μ l, 20mM CTP of tRNA 1.75 μ l, 20mM ATP, 2.5 μ l, 20mM GTP 2.5 μ l, 1mM UTP0.5 μ l, α-32P- 0.5 μ l, NIb fusion proteins of UTP 12.5 μ l, H2O is mended to 50 μ l), 20 DEG C of reaction temperature is incubated 1h-1.5h；After reaction terminates Add 70 μ L ddH2O is mixed, and adds 120 μ L phenol/imitative (0.5mL phenol/0.5mL chloroforms/0.04mL 0.5M EDTA/ 0.01mL10%SDS mixtures) extracting；Centrifuged supernatant adds the 2.4 times of NH4Ac/isopropanol of volume (5M NH4Ac: Isopropanol=1:5), mix, -20 DEG C of overnight precipitations, precipitate through being centrifuged, washing, dry；Add 10 μ L RNA Loading buffer, then in 5%PAGE glue (urea containing 8M), 1500mA electrophoresis 1-2h；Dry glue, the screen imaging of pressure phosphorus.
Interpretation of result：TBTV RdRp albumen can specific recognition TBTV genome 3' ends and genome complementation chain 3' ends, and be that template catalyzes and synthesizes complementary strand (as shown in Figure 5) with it.Illustrate that this passes through plasmid pMAL-TB-RdRp protokaryon tables Up to and the MBP-RdRp albumen that purifies can mediate replication in vitro system for TBTV.
<110>Shandong Agricultural University
<120>One can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid vector
<160>14
<210>1
<211>2607
<212>DNA
<213>Artificial sequence
<400>1
atg gag ttc atc aac aag ata aag caa ttg ttg gca atg aat ttc aag 48
Met Glu Phe Ile Asn Lys Ile Lys Gln Leu Leu Ala Met Asn Phe Lys
1 5 10 15
ccc tca aag ggc gta atg tct cgg gag gag ctc cgt gaa gct ttc gat 96
Pro Ser Lys Gly Val Met Ser Arg Glu Glu Leu Arg Glu Ala Phe Asp
20 25 30
ccc act tgg gag ctc ctc atc aca cag gcc cgt gtc acc aat gag gtg 144
Pro Thr Trp Glu Leu Leu Ile Thr Gln Ala Arg Val Thr Asn Glu Val
35 40 45
tca cgc cag tgt gag gat tgg tac act cta gct gta ccc acc acc tac 192
Ser Arg Gln Cys Glu Asp Trp Tyr Thr Leu Ala Val Pro Thr Thr Tyr
50 55 60
cgc ttg cca gag ttg gcg gta gaa gag gct gtg cgt gaa aag aac ata 240
Arg Leu Pro Glu Leu Ala Val Glu Glu Ala Val Arg Glu Lys Asn Ile
65 70 75 80
gcg cga gag gtg gcg gtc aag tgc ccc cct gag gac ccg att cct gca 288
Ala Arg Glu Val Ala Val Lys Cys Pro Pro Glu Asp Pro Ile Pro Ala
85 90 95
atc ccg cag ggg tca cag cct gtc ccc ttg gtg atg agc tct gaa cgc 336
Ile Pro Gln Gly Ser Gln Pro Val Pro Leu Val Met Ser Ser Glu Arg
100 105 110
tct agc cag gat gcc gag cgt gag gcg ctc gat gag ata tgg ggg ctc 384
Ser Ser Gln Asp Ala Glu Arg Glu Ala Leu Asp Glu Ile Trp Gly Leu
115 120 125
ccc act ccc gag tca cat cct ctg ccc aag tac ttc gag cgg cgc tac 432
Pro Thr Pro Glu Ser His Pro Leu Pro Lys Tyr Phe Glu Arg Arg Tyr
130 135 140
cag gcg ctg gct cgg acc tgc gag aag gac tac tcc aac tgg cag att 480
Gln Ala Leu Ala Arg Thr Cys Glu Lys Asp Tyr Ser Asn Trp Gln Ile
145 150 155 160
gta ccc tac acg ggt ggg cca cgc gtg ctg aga gag gag gac gtg cta 528
Val Pro Tyr Thr Gly Gly Pro Arg Val Leu Arg Glu Glu Asp Val Leu
165 170 175
cca atg gct tcg ggg gtt ata ccc ttg cca cca ccc ccc cct aag gct 576
Pro Met Ala Ser Gly Val Ile Pro Leu Pro Pro Pro Pro Pro Lys Ala
180 185 190
tct gta atc gga gca gtc ttg ggg ctg att acc cgc ctt acc aag gtg 624
Ser Val Ile Gly Ala Val Leu Gly Leu Ile Thr Arg Leu Thr Lys Val
195 200 205
gcg ggg gag gtg aag agc agg ctg agc gta ccg ccg cgg gag ccc tcg 672
Ala Gly Glu Val Lys Ser Arg Leu Ser Val Pro Pro Arg Glu Pro Ser
210 215 220
ccc act tgc att ggc tta gag cag gtg gct ggt gag ccc atg ggc tac 720
Pro Thr Cys Ile Gly Leu Glu Gln Val Ala Gly Glu Pro Met Gly Tyr
225 230 235 240
atg aat gca cac tct gtg gcc atg gag ttg cgg gct agg tac gga gtc 768
Met Asn Ala His Ser Val Ala Met Glu Leu Arg Ala Arg Tyr Gly Val
245 250 255
cag ccc gcc aca gct gcg aac ttg cag ctt gga aac cgg gtg gcc agg 816
Gln Pro Ala Thr Ala Ala Asn Leu Gln Leu Gly Asn Arg Val Ala Arg
260 265 270
gaa atc ctg gaa aaa cag tgc ggg gcc acc cgc gac atg gtg ttc ata 864
Glu Ile Leu Glu Lys Gln Cys Gly Ala Thr Arg Asp Met Val Phe Ile
275 280 285
ctc ggg cac ctc gcc acc acc ttg tgg ttc acc cct acc atg gtg gac 912
Leu Gly His Leu Ala Thr Thr Leu Trp Phe Thr Pro Thr Met Val Asp
290 295 300
ttg gcc ctt caa tgt ggg ccc aag gat ttt tgC cta ggg gat gtg gtc 960
Leu Ala Leu Gln Cys Gly Pro Lys Asp Phe Cys Leu Gly Asp Val Val
305 310 315 320
gct cgg agg ggt gta gaa act aaa gtg aag acg aaa atc cac ccc aaa 1008
Ala Arg Arg Gly Val Glu Thr Lys Val Lys Thr Lys Ile His Pro Lys
325 330 335
atc cga gtg ctt agg gcg gcc cgt ccc cgg ccc gta gaa aga gtg tcg 1056
Ile Arg Val Leu Arg Ala Ala Arg Pro Arg Pro Val Glu Arg Val Ser
340 345 350
tac caa atc gac gtg gtg cgg ccc tgt gct gac ttt gga gtc cac aac 1104
Tyr Gln Ile Asp Val Val Arg Pro Cys Ala Asp Phe Gly Val His Asn
355 360 365
aac tcc ctc aac aat tta gtg cga ggg gtt aac gag cgg gtg ttc tac 1152
Asn Ser Leu Asn Asn Leu Val Arg Gly Val Asn Glu Arg Val Phe Tyr
370 375 380
aca gac cac aag agg aaa gag ccc cgc aga cct tca gct ggt agt ttt 1200
Thr Asp His Lys Arg Lys Glu Pro Arg Arg Pro Ser Ala Gly Ser Phe
385 390 395 400
gac aag att gac atc agc gag ata aaa gcg ttc aga gtc cag ccg tgg 1248
Asp Lys Ile Asp Ile Ser Glu Ile Lys Ala Phe Arg Val Gln Pro Trp
405 410 415
act ctc gag gag gtc gtt gac agc tac acg ggt agc cag agg gtg cgg 1296
Thr Leu Glu Glu Val Val Asp Ser Tyr Thr Gly Ser Gln Arg Val Arg
420 425 430
tat gga caa gct gtt gaa tcc tta gca gta acg ccc ctc tca cga aac 1344
Tyr Gly Gln Ala Val Glu Ser Leu Ala Val Thr Pro Leu Ser Arg Asn
435 440 445
gac gcc cgg gtc aaa aca ttt gta aag gcg gaa aag ata aac ttc acc 1392
Asp Ala Arg Val Lys Thr Phe Val Lys Ala Glu Lys Ile Asn Phe Thr
450 455 460
gcc aag ccc gac ccg gct cct cgc gta atc cag ccg cgg gat cca agg 1440
Ala Lys Pro Asp Pro Ala Pro Arg Val Ile Gln Pro Arg Asp Pro Arg
465 470 475 480
ttc aat gcc tgc ttt gcc aaa tac aca aag ccc ttg gaa ccc ctc cta 1488
Phe Asn Ala Cys Phe Ala Lys Tyr Thr Lys Pro Leu Glu Pro Leu Leu
485 490 495
tac aag cag ctg ggt aag ctt tac cag ttc cca tgc atc gca aaa ggc 1536
Tyr Lys Gln Leu Gly Lys Leu Tyr Gln Phe Pro Cys Ile Ala Lys Gly
500 505 510
ttt aac gcc gta gag acc gga gag ata gta gcc aag aag tgg aag tgc 1584
Phe Asn Ala Val Glu Thr Gly Glu Ile Val Ala Lys Lys Trp Lys Cys
515 520 525
ttc agt gac cct gtc tgt gtg ggt tta gat gcc tcc cgg ttt gac cag 1632
Phe Ser Asp Pro Val Cys Val Gly Leu Asp Ala Ser Arg Phe Asp Gln
530 535 540
cat gtg tca tgc gat gca cta cgg ttc acc cat agc gtg tac aaa cgg 1680
His Val Ser Cys Asp Ala Leu Arg Phe Thr His Ser Val Tyr Lys Arg
545 550 555 560
ttc gtg aag ggc agg gaa gtg aac aag ttg ctt tcc tgg atg tac aaa 1728
Phe Val Lys Gly Arg Glu Val Asn Lys Leu Leu Ser Trp Met Tyr Lys
565 570 575
aac cac gct ctg gga agt gcg aag gac gga ttc gtc aag tac gag gtg 1776
Asn His Ala Leu Gly Ser Ala Lys Asp Gly Phe Val Lys Tyr Glu Val
580 585 590
gaa ggc tgt cgg atg agt ggg gat atg gat aca gcc cta ggg aat tgt 1824
Glu Gly Cys Arg Met Ser Gly Asp Met Asp Thr Ala Leu Gly Asn Cys
595 600 605
gtc ctg atg gtc ctc atg act agg caa cta tgc aag aac ctc tcc ata 1872
Val Leu Met Val Leu Met Thr Arg Gln Leu Cys Lys Asn Leu Ser Ile
610 615 620
ccg cac gaa ctg atg aac aac ggc gac gac tgc ata gtt ata ttt gac 1920
Pro His Glu Leu Met Asn Asn Gly Asp Asp Cys Ile Val Ile Phe Asp
625 630 635 640
agg cag tac ctg tcc acc ttt cag gat gca gtc gag cct tgg ttt agg 1968
Arg Gln Tyr Leu Ser Thr Phe Gln Asp Ala Val Glu Pro Trp Phe Arg
645 650 655
gag cta ggg ttt aca atg aag gtc gag gag cca gtc tac cat ctc gaa 2016
Glu Leu Gly Phe Thr Met Lys Val Glu Glu Pro Val Tyr His Leu Glu
660 665 670
aga gta gat ttt tgc cag acc cgc ccc gtg tat gac ggc aag aag tgg 2064
Arg Val Asp Phe Cys Gln Thr Arg Pro Val Tyr Asp Gly Lys Lys Trp
675 680 685
aga atg gtc agg cat atc tca agt ata gcg aag gat tgc tgt tca gtc 2112
Arg Met Val Arg His Ile Ser Ser Ile Ala Lys Asp Cys Cys Ser Val
690 695 700
att gac tgg gaa cag tta ccg gct tgg tgg aac gcc att gga gaa tgt 2160
Ile Asp Trp Glu Gln Leu Pro Ala Trp Trp Asn Ala Ile Gly Glu Cys
705 710 715 720
ggc att gcc gtg gct ggt ggt ata ccc ata cac aac agc ttc ttg aga 2208
Gly Ile Ala Val Ala Gly Gly Ile Pro Ile His Asn Ser Phe Leu Arg
725 730 735
tgg ctc ctg aga tca ggt gag agc aac cct gat ctc ctg aag cat ggc 2256
Trp Leu Leu Arg Ser Gly Glu Ser Asn Pro Asp Leu Leu Lys His Gly
740 745 750
gca tgg aaa aat gag ggc cta gcg tgg tac cgg atg ggc atg gac cta 2304
Ala Trp Lys Asn Glu Gly Leu Ala Trp Tyr Arg Met Gly Met Asp Leu
755 760 765
tcc cat gag aga cac gtt agt gat gaa gcg cgc gcc agc ttc cac act 2352
Ser His Glu Arg His Val Ser Asp Glu Ala Arg Ala Ser Phe His Thr
770 775 780
gcc ttt gga atc gaa cca tcc atg cag gtc gca tta gag cag atc tat 2400
Ala Phe Gly Ile Glu Pro Ser Met Gln Val Ala Leu Glu Gln Ile Tyr
785 790 795 800
gac tca ttg cct gct ccc acc att ggt ggg aaa cga gcc aga gtg tgt 2448
Asp Ser Leu Pro Ala Pro Thr Ile Gly Gly Lys Arg Ala Arg Val Cys
805 810 815
aaa cct ggt gaa atg gta ttg gtt gat tca ctc cca ccg cgg cac ttt 2496
Lys Pro Gly Glu Met Val Leu Val Asp Ser Leu Pro Pro Arg His Phe
820 825 830
aat gat tac ttc cag gat gtt gga ata ggg ggg agt agc agt gat tac 2544
Asn Asp Tyr Phe Gln Asp Val Gly Ile Gly Gly Ser Ser Ser Asp Tyr
835 840 845
gtt gtc ccg ggg acc cac gag ttc gaa ccg ggg acg ttg tgg aca caa 2592
Val Val Pro Gly Thr His Glu Phe Glu Pro Gly Thr Leu Trp Thr Gln
850 855 860
tgC cta gtc aat tga 2607
Cys Leu Val Asn
865 868
<210>2
<211>868
<212>PRT
<213>Artificial sequence
<400>2
Met Glu Phe Ile Asn Lys Ile Lys Gln Leu Leu Ala Met Asn Phe Lys
1 5 10 15
Pro Ser Lys Gly Val Met Ser Arg Glu Glu Leu Arg Glu Ala Phe Asp
20 25 30
Pro Thr Trp Glu Leu Leu Ile Thr Gln Ala Arg Val Thr Asn Glu Val
35 40 45
Ser Arg Gln Cys Glu Asp Trp Tyr Thr Leu Ala Val Pro Thr Thr Tyr
50 55 60
Arg Leu Pro Glu Leu Ala Val Glu Glu Ala Val Arg Glu Lys Asn Ile
65 70 75 80
Ala Arg Glu Val Ala Val Lys Cys Pro Pro Glu Asp Pro Ile Pro Ala
85 90 95
Ile Pro Gln Gly Ser Gln Pro Val Pro Leu Val Met Ser Ser Glu Arg
100 105 110
Ser Ser Gln Asp Ala Glu Arg Glu Ala Leu Asp Glu Ile Trp Gly Leu
115 120 125
Pro Thr Pro Glu Ser His Pro Leu Pro Lys Tyr Phe Glu Arg Arg Tyr
130 135 140
Gln Ala Leu Ala Arg Thr Cys Glu Lys Asp Tyr Ser Asn Trp Gln Ile
145 150 155 160
Val Pro Tyr Thr Gly Gly Pro Arg Val Leu Arg Glu Glu Asp Val Leu
165 170 175
Pro Met Ala Ser Gly Val Ile Pro Leu Pro Pro Pro Pro Pro Lys Ala
180 185 190
Ser Val Ile Gly Ala Val Leu Gly Leu Ile Thr Arg Leu Thr Lys Val
195 200 205
Ala Gly Glu Val Lys Ser Arg Leu Ser Val Pro Pro Arg Glu Pro Ser
210 215 220
Pro Thr Cys Ile Gly Leu Glu Gln Val Ala Gly Glu Pro Met Gly Tyr
225 230 235 240
Met Asn Ala His Ser Val Ala Met Glu Leu Arg Ala Arg Tyr Gly Val
245 250 255
Gln Pro Ala Thr Ala Ala Asn Leu Gln Leu Gly Asn Arg Val Ala Arg
260 265 270
Glu Ile Leu Glu Lys Gln Cys Gly Ala Thr Arg Asp Met Val Phe Ile
275 280 285
Leu Gly His Leu Ala Thr Thr Leu Trp Phe Thr Pro Thr Met Val Asp
290 295 300
Leu Ala Leu Gln Cys Gly Pro Lys Asp Phe Cys Leu Gly Asp Val Val
305 310 315 320
Ala Arg Arg Gly Val Glu Thr Lys Val Lys Thr Lys Ile His Pro Lys
325 330 335
Ile Arg Val Leu Arg Ala Ala Arg Pro Arg Pro Val Glu Arg Val Ser
340 345 350
Tyr Gln Ile Asp Val Val Arg Pro Cys Ala Asp Phe Gly Val His Asn
355 360 365
Asn Ser Leu Asn Asn Leu Val Arg Gly Val Asn Glu Arg Val Phe Tyr
370 375 380
Thr Asp His Lys Arg Lys Glu Pro Arg Arg Pro Ser Ala Gly Ser Phe
385 390 395 400
Asp Lys Ile Asp Ile Ser Glu Ile Lys Ala Phe Arg Val Gln Pro Trp
405 410 415
Thr Leu Glu Glu Val Val Asp Ser Tyr Thr Gly Ser Gln Arg Val Arg
420 425 430
Tyr Gly Gln Ala Val Glu Ser Leu Ala Val Thr Pro Leu Ser Arg Asn
435 440 445
Asp Ala Arg Val Lys Thr Phe Val Lys Ala Glu Lys Ile Asn Phe Thr
450 455 460
Ala Lys Pro Asp Pro Ala Pro Arg Val Ile Gln Pro Arg Asp Pro Arg
465 470 475 480
Phe Asn Ala Cys Phe Ala Lys Tyr Thr Lys Pro Leu Glu Pro Leu Leu
485 490 495
Tyr Lys Gln Leu Gly Lys Leu Tyr Gln Phe Pro Cys Ile Ala Lys Gly
500 505 510
Phe Asn Ala Val Glu Thr Gly Glu Ile Val Ala Lys Lys Trp Lys Cys
515 520 525
Phe Ser Asp Pro Val Cys Val Gly Leu Asp Ala Ser Arg Phe Asp Gln
530 535 540
His Val Ser Cys Asp Ala Leu Arg Phe Thr His Ser Val Tyr Lys Arg
545 550 555 560
Phe Val Lys Gly Arg Glu Val Asn Lys Leu Leu Ser Trp Met Tyr Lys
565 570 575
Asn His Ala Leu Gly Ser Ala Lys Asp Gly Phe Val Lys Tyr Glu Val
580 585 590
Glu Gly Cys Arg Met Ser Gly Asp Met Asp Thr Ala Leu Gly Asn Cys
595 600 605
Val Leu Met Val Leu Met Thr Arg Gln Leu Cys Lys Asn Leu Ser Ile
610 615 620
Pro His Glu Leu Met Asn Asn Gly Asp Asp Cys Ile Val Ile Phe Asp
625 630 635 640
Arg Gln Tyr Leu Ser Thr Phe Gln Asp Ala Val Glu Pro Trp Phe Arg
645 650 655
Glu Leu Gly Phe Thr Met Lys Val Glu Glu Pro Val Tyr His Leu Glu
660 665 670
Arg Val Asp Phe Cys Gln Thr Arg Pro Val Tyr Asp Gly Lys Lys Trp
675 680 685
Arg Met Val Arg His Ile Ser Ser Ile Ala Lys Asp Cys Cys Ser Val
690 695 700
Ile Asp Trp Glu Gln Leu Pro Ala Trp Trp Asn Ala Ile Gly Glu Cys
705 710 715 720
Gly Ile Ala Val Ala Gly Gly Ile Pro Ile His Asn Ser Phe Leu Arg
725 730 735
Trp Leu Leu Arg Ser Gly Glu Ser Asn Pro Asp Leu Leu Lys His Gly
740 745 750
Ala Trp Lys Asn Glu Gly Leu Ala Trp Tyr Arg Met Gly Met Asp Leu
755 760 765
Ser His Glu Arg His Val Ser Asp Glu Ala Arg Ala Ser Phe His Thr
770 775 780
Ala Phe Gly Ile Glu Pro Ser Met Gln Val Ala Leu Glu Gln Ile Tyr
785 790 795 800
Asp Ser Leu Pro Ala Pro Thr Ile Gly Gly Lys Arg Ala Arg Val Cys
805 810 815
Lys Pro Gly Glu Met Val Leu Val Asp Ser Leu Pro Pro Arg His Phe
820 825 830
Asn Asp Tyr Phe Gln Asp Val Gly Ile Gly Gly Ser Ser Ser Asp Tyr
835 840 845
Val Val Pro Gly Thr His Glu Phe Glu Pro Gly Thr Leu Trp Thr Gln
850 855 860
Cys Leu Val Asn
865 868
<210>3
<211>35
<212>DNA
<213>Artificial sequence
<400>3
gatcgaattc atggagttca tcaacaagat aaagc 35
<210>4
<211>35
<212>DNA
<213>Artificial sequence
<400>4
gatcctgcag tcactagcat tgtgtccaca acgtc 35
<210>5
<211>25
<212>DNA
<213>Artificial sequence
<400>5
atttttgcct aggggatgtg gtcgc 25
<210>6
<211>29
<212>DNA
<213>Artificial sequence
<400>6
atcccctagg caaaaatcct tgggcccac 29
<210>7
<211>37
<212>DNA
<213>Artificial sequence
<400>7
taatacgact cactatagag gttacgatat ggagttc 37
<210>8
<211>27
<212>DNA
<213>Artificial sequence
<400>8
gatccccggg gcgtgacacc tcattgg 27
<210>9
<211>37
<212>DNA
<213>Artificial sequence
<400>9
gctaatacga ctcactatag ggcccttcaa tgtgggc 37
<210>10
<211>19
<212>DNA
<213>Artificial sequence
<400>10
gggagttgtt gtggactcc 19
<210>11
<211>40
<212>DNA
<213>Artificial sequence
<400>11
gctaatacga ctcactatag gcagaaacca agtagcaaat 40
<210>12
<211>14
<212>DNA
<213>Artificial sequence
<400>12
gggcgcgaga gaaa 14
<210>13
<211>28
<212>DNA
<213>Artificial sequence
<400>13
aggttacgat atggagttca tcaacaag 28
<210>14
<211>37
<212>DNA
<213>Artificial sequence
<400>14
tagctaatac gactcactat aggcaagcgg taggtgg 37

Claims (1)

1. one can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid vector, the plasmid vector is entitled PMAL-TB-RdRp, the coded sequence containing TBTV China separator RdRp albumen, its nucleotide sequence such as Seq ID No.1 institutes Show, amino acid sequence is as shown in Seq ID No.2.
CN201710091992.7A 2017-02-21 2017-02-21 Plasmid vector capable of prokaryotic expression of tobacco plexiglass virus Chinese isolate RdRp protein Active CN106834325B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710091992.7A CN106834325B (en) 2017-02-21 2017-02-21 Plasmid vector capable of prokaryotic expression of tobacco plexiglass virus Chinese isolate RdRp protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710091992.7A CN106834325B (en) 2017-02-21 2017-02-21 Plasmid vector capable of prokaryotic expression of tobacco plexiglass virus Chinese isolate RdRp protein

Publications (2)

Publication Number Publication Date
CN106834325A true CN106834325A (en) 2017-06-13
CN106834325B CN106834325B (en) 2020-05-22

Family

ID=59133170

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710091992.7A Active CN106834325B (en) 2017-02-21 2017-02-21 Plasmid vector capable of prokaryotic expression of tobacco plexiglass virus Chinese isolate RdRp protein

Country Status (1)

Country Link
CN (1) CN106834325B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110592128A (en) * 2019-08-30 2019-12-20 山东农业大学 Plasmid vector capable of prokaryotic expression of cherry small fruit No.1 virus RdRp protein and application thereof

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
K. S. RAJENDRAN等: "Comparison of Turnip Crinkle Virus RNA-Dependent RNA Polymerase Preparations Expressed in Escherichia coli or Derived from Infected Plants", 《JOURNAL OF VIROLOGY》 *
MO,X.等: "登录号：AF402620.2", 《GENBANK》 *
X.-H.MO1等: "Molecular identification and phylogenetic analysis of a viral RNA associated with the Chinese tobacco bushy top disease complex", 《ANNALS OF APPLIED BIOLOGY》 *
YI-IJA LI等: "Identification and Characterization of the Escherichia coli-Expressed RNA-Dependent RNA Polymerase of Bamboo Mosaic Virus", 《JOURNAL OF VIROLOGY》 *
YILING HONG等: "RNA Polymerase Activity Catalyzed by a Potyvirus-Encoded RNA-Dependent RNA Polymerase", 《VIROLOGY》 *
YU CHENG-MING等: "1 programmed ribosome frameshift mechanism responsible for the expression of RdRp in Tobacco bushy top virus", 《中国植物病理学会2015年学术年会论文集》 *
徐章逸: "两种葡萄卷叶伴随病毒的基因克隆、原核表达及葡萄遗传转化体系的初步建立", 《中国优秀博硕士学位论文全文数据库（博）农业科技辑》 *
逯晓明等: "烟草丛顶病毒ＲNA依赖ＲNA聚合酶(ＲdＲp)介导的体外复制体系", 《植物病理学报》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110592128A (en) * 2019-08-30 2019-12-20 山东农业大学 Plasmid vector capable of prokaryotic expression of cherry small fruit No.1 virus RdRp protein and application thereof
CN110592128B (en) * 2019-08-30 2022-02-11 山东农业大学 Plasmid vector capable of prokaryotic expression of cherry small fruit No.1 virus RdRp protein and application thereof

Also Published As

Publication number Publication date
CN106834325B (en) 2020-05-22

Similar Documents

Publication Publication Date Title
CN110194790A (en) The plant immune activator protein FoPII1 of Fusarium oxysporum secretion and its application
CN111690054B (en) Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application
CN110922457B (en) Plant immune induced resistance protein FgPII1 secreted by fusarium graminearum and application thereof
CN114774372B (en) Coxsackie virus A10 type strain and vaccine and application thereof
CN112424366A (en) Recombinant vector for producing antigen for diagnosing African swine fever and use thereof
CN109705200A (en) Graywall resistance-associated protein ZmWAK-RLK and its encoding gene and application
CN109609524A (en) Protein and the application of a kind of lactobacillus plantarum nitrite reductase gene and its coding
CN106834325A (en) One can prokaryotic expression tobacco bushy top virus China separator RdRp albumen plasmid vector
CN106632625B (en) Application of the protein PGR5 in regulation algae inoxidizability
CN106906234A (en) One can prokaryotic expression WYMV Huangchuan separator NIb albumen plasmid vector
CN104862331B (en) A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen
CN107056908A (en) Soybean salt-tolerance gene GmCHS5 and its application
CN101294154A (en) Method for preparing large-size fluke cathepsin L1
CN103060333B (en) Litopenaeus vannamei metallothionein gene LvMT as well as coding gene and application thereof
CN110592128B (en) Plasmid vector capable of prokaryotic expression of cherry small fruit No.1 virus RdRp protein and application thereof
CN108754019B (en) Amplification method of porcine epidemic diarrhea virus ORF1 gene complete sequence
CN108504672A (en) Ralstonia solanacearum N477 extracellular proteins PHD and its encoding gene and application
Chen et al. Development of polyclonal antibodies-based serological methods for detection of the Rehmannia mosaic virus in field plants
CN101280343A (en) Primer for quantitative and qualitative determination of blue tongue virus
CN111575221B (en) Method for producing prodigiosin based on PNTs
CN112342198A (en) PAT/PAT monoclonal antibody hybridoma cell strain, antibody produced by same and preparation method thereof
CN109750021A (en) A kind of scallop carotenoid oxicracking enzyme gene and its application
CN102492702A (en) Beta-nodavirus genome complete sequence and cloning method thereof
CN116218806B (en) N-glycosyltransferase mutant AaFQ and application thereof
CN110791513B (en) Codon-optimized holothuria leucospilota alpha-amylase gene, recombinant expression vector and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant