CN106834135B - A method of induction grape Elsinochrome produces spore - Google Patents

A method of induction grape Elsinochrome produces spore Download PDF

Info

Publication number
CN106834135B
CN106834135B CN201611220119.5A CN201611220119A CN106834135B CN 106834135 B CN106834135 B CN 106834135B CN 201611220119 A CN201611220119 A CN 201611220119A CN 106834135 B CN106834135 B CN 106834135B
Authority
CN
China
Prior art keywords
grape
culture
spore
days
elsinochrome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201611220119.5A
Other languages
Chinese (zh)
Other versions
CN106834135A (en
Inventor
李智
王西平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northwest A&F University
Original Assignee
Northwest A&F University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest A&F University filed Critical Northwest A&F University
Priority to CN201611220119.5A priority Critical patent/CN106834135B/en
Publication of CN106834135A publication Critical patent/CN106834135A/en
Application granted granted Critical
Publication of CN106834135B publication Critical patent/CN106834135B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N3/00Spore forming or isolating processes

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A kind of method that induction grape Elsinochrome produces spore is disclosed in the present invention, this method takes the outer ring mycelium for being grown in the grapevine anthracnose disease fungus bacterium colony that the culture dish equipped with PDA culture medium grows 15 days to be inoculated in the new sterile culture bottle equipped with PDA culture medium;At 25 DEG C after dark culturing 25 days, by culture bottle at 21 DEG C, dark is placed 24 hours;Bacterium colony surface texture is scraped with aseptic operation knife, is squeezed into powdered, is then placed in sterile water, shakes 30 seconds, supernatant is taken to carry out spore count with blood counting chamber.This method is easy to operate, can stablize and obtain more conidium, for use in the grape germplasm of screening anthracnose disease resistant, provides safeguard for breeding for disease resistance and grape pathological study.

Description

A method of induction grape Elsinochrome produces spore
Technical field
The invention belongs to fruit tree pathology technical fields, and in particular to a kind of for inducing grape Elsinochrome to produce the side of spore Method.
Background technique
Grape disease type is more, and harm is serious, and wherein grapevine anthracnose is widely distributed, a large amount of in China, area of heavy rainfull, north and south Occur, highest can cause fruit losses 50% when falling ill serious, seriously affect the yield and quality of grape, have become restriction One of the principal element that grape industry develops in a healthy way.Grapevine anthracnose is drawn by grape Elsinochrome (Elsinoe ampelina) A kind of fungal disease risen, endangers the positions such as young sprout, climing, petiole, vein, carpopodium and the fruit of grape.
The imperfect stage of grape Elsinochrome is Deuteromycotina scab circle spore Pseudomonas, and the perfect stage is Ascomycotina scab capsule Chamber Pseudomonas, the slow growth on artificial medium.It is reported that grape Elsinochrome is grown preferably on cereal agar medium, But culture can be only achieved 8cm in 8 weeks2Left and right.The extremely difficult production spore of the pathogen mainly passes through ultraviolet radiation treatment and plus Aquaponic at present Spore is obtained, but production spore is unstable, inconvenient, especially sporulation quantity is small.
Summary of the invention
It is the technology hardly possible of the pathogen of grapevine anthracnose, the bacterium slow growth, and production spore difficulty for grape Elsinochrome Topic, the object of the present invention is to provide a kind of methods that induction grape Elsinochrome produces spore.
In order to realize that above-mentioned task, the present invention use following technical solution:
A method of induction grape Elsinochrome produces spore, which is characterized in that sequentially includes the following steps:
(1) the outer of the grapevine anthracnose disease fungus bacterium colony for being grown in the growth 15 days of the culture dish equipped with PDA culture medium is taken Circle mycelium is inoculated in the new sterile culture bottle equipped with PDA culture medium;
At (2) 25 DEG C after dark culturing 25 days, by culture bottle at 21 DEG C, dark is placed 24 hours;
(3) bacterium colony surface texture is scraped with aseptic operation knife, is squeezed into powdered, be then placed in sterile water, concussion 30 Second, it takes supernatant to carry out grape Elsinochrome spore count with blood counting chamber, obtains grape Elsinochrome spore.
According to the present invention, the PDA culture medium is potato dextrose agar formula are as follows: 1000 milliliters pure Water, 200 g potatos, 20 grams of glucose, 15 grams of agar.
Further, the culture bottle is glass material, has 0.22 micron of micropore on plastic bottle closure, can filter micro- life The ventilated membrane of object, specification are 250 milliliters, and the size of bore, the diameter of a cross-section of a tree trunk 1.3 meters above the ground and bottle height is respectively 5.6 centimetres, 6.9 centimetres and 9.1 lis Rice.
According to the present invention, the DNA sequence dna of the grape Elsinochrome is:
TCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGGTAGGGTTCTCCTCCGGGAAGCCCGAACTCCCC ACCCCTTGCTGTTGCGAATACGTTGCTTCGGCGGGACCCCCCCTTCTGCCCTTCACCGGGGAGGGGGAGGGACCGG GCCTTCACGGGCCCGGGCAGCGCCCGCCGGGGGACCGAACCAACTCTTTTTGTTAAACAATGCAGTCGGAGTACAA CGTACATAATCAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGA TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGG GCATGCCTGTTCGAGCGTCATTTCACCAATCAAGCCCCGCTTGGTATTAGGCGATCCGGCCGGCCCCCCCGTGGCC GGCCCGCCCGAAATGCATCGGCGAGGCACCGACCCCCGGCGTGTTAGAATTTCTTTTAACGTCGGGAGCACCGGTG TACCTCCGCCGTGAAACCTTTCTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGA。
The method that induction grape Elsinochrome of the invention produces spore, it is easy to operate, it can stablize and obtain more grape scab Blister cavities bacterium conidium provides guarantor for use in the grape germplasm of screening anthracnose disease resistant for breeding for disease resistance and grape pathological study Barrier.
Detailed description of the invention
Fig. 1 is the separation and identification of Elsinǒe ampelina.A figure is to be good for the bacterium colony that intersection is grown from ' the red earth ' blade disease It is inoculated in and grows 10 days forms in new PDA culture medium;B figure is that hemorrhagic black smallpox germ conidium grows 6 days on culture medium, long The form of single colonie out;C figure is the Elsinǒe ampelina ITS amplified production after isolating and purifying, size 580bp;D figure is grape The phylogenetic analysis of fungi ITS sequence in hemorrhagic black smallpox germ ITS sequence and Elsinoe.
Fig. 2 is the colonial morphology picture of PDA culture dish and PDA culture bottle culture grape Elsinochrome in different number of days.Its In, A-C figure is to cultivate 0 day on PDA culture dish, 10 days, 15 days forms, and scale 2cm;D figure is to grow 25 on PDA culture dish It colonial morphology, scale 0.5cm;E-G figure is the colonial morphology that 0,10,15 days are cultivated in PDA culture bottle, scale 1cm; H figure is the colonial morphology cultivated in PDA culture bottle 25 days, scale 0.5cm.
Fig. 3 is the influence diagram that temperature, illumination, induction time and incubation time produce spore to grape Elsinochrome.Wherein, A schemes It is that the grape Elsinochrome cultivated 25 days in PDA culture bottle is individually positioned at 19 DEG C, 21 DEG C, 23 DEG C and 25 DEG C 24 hours Produce spore situation;B figure be cultivated in PDA culture dish and culture bottle 25 days grape Elsinochromes respectively illumination and it is dark under, 21 24 hours production spore situations are induced at DEG C;C figure is that the culture of PDA culture bottle 25 days grape Elsinochrome dark are placed on 21 DEG C Under, different induction times is to the influence situation for producing spore;D figure is after the culture of PDA culture bottle 20 days, 25 days, 30 days and 35 days Grape Elsinochrome, the grape Elsinochrome that dark is placed on 24 hours at 21 DEG C produce spore situation.
Fig. 4 be the culture of PDA culture bottle 25 days and the colonial morphology after 35 days and induction produce spore the case where figure.Wherein, A figure is The colonial morphology of PDA culture bottle 25 days grape Elsinochromes of culture, scale 0.5cm;B figure is 25 days Portugals of PDA culture bottle culture The bacterium colony configuration of surface of grape Elsinochrome, scale are 50 μm;C figure is that the grape Elsinochrome of PDA culture bottle culture 25 days is placed 24 hours production spore situations at 21 DEG C, scale are 10 μm;D figure is the bacterium colony of PDA culture bottle 35 days grape Elsinochromes of culture Form, scale 0.5cm;E figure is the bacterium colony configuration of surface of 35 days grape Elsinochromes of PDA culture bottle culture, and scale is 50 μm; F figure is the production spore situation that the grape Elsinochrome of PDA culture bottle culture 35 days is placed on 24 hours at 21 DEG C, and scale is 10 μm.
Below in conjunction with the embodiment that attached drawing and inventor provide, invention is further described in detail.
Specific embodiment
Since grapevine anthracnose pathogen is grape Elsinochrome, slow growth, it is extremely difficult to produce spore, applicant passes through research training The influence of the mode of supporting, cultivated days, temperature and illumination to spore is produced, and then find:
1) culture bottle culture is easier to produce spore than culture dish culture;
2) inducing effect is best after culture bottle culture 25 days;
3) after culture bottle culture 25 days, dark induction 24 hours, it is best to produce spore effect at 21 DEG C.
The method that the induction grape Elsinochrome that the present invention provides produces spore, produces spore for Elsinoe fungal induction and provides fastly The stable reference of speed, while basis is provided to carry out grapevine anthracnose correlative study.
The specific experiment of selection includes:
(1) determination of training method: since PDA culture dish culture grape Elsinochrome has the diversity of colonial morphology, The stability that induction produces spore is influenced, and it is morphologically with uniformity by the grape Elsinochrome of PDA culture bottle culture, and The sporulation quantity of culture bottle is big compared with culture dish.
(2) determination of incubation time: the growth of grape Elsinochrome is slower, and the colony colour of early period is kermesinus, but Become celadon in later period colony colour, by carrying out induction production spore discovery culture 25 days after cultivating different number of days on culture bottle Sporulation quantity it is maximum.
(3) temperature, which is adjusted, produces spore: the condition of culture of grape Elsinochrome is 25 DEG C, and different culture ranks at this temperature Section all there is no spore.The influence that spore is produced to grape Elsinochrome is observed by setting temperature gradient, as a result, it has been found that at 21 DEG C Under grape Elsinochrome produce spore effect it is best;It has furthermore been found that being induced 24 hours at 21 DEG C, grape Elsinochrome sporulation quantity It is maximum.
(4) illumination to produce spore influence: under illumination condition, 21 DEG C induction 24 hours after find that its sporulation quantity compares dark condition It is few, illustrate to be unfavorable for inducing grape Elsinochrome to produce spore under illumination, therefore dark lower induction grape Elsinochrome produces the effect of spore More preferably.
In embodiment below, used culture bottle is glass material, there is 0.22 micron of micropore on plastic bottle closure, can mistake Filter microorganism ventilated membrane, specification be 250 milliliters, the size of bore, the diameter of a cross-section of a tree trunk 1.3 meters above the ground and bottle height be respectively 5.6 centimetres, 6.9 centimetres and 9.1 centimetre.
Embodiment 1: the separation and identification of Elsinǒe ampelina
The blade that anthrachose of grape (having grapevine anthracnose disease fungus) occurs for acquisition ' the red earth ' grape takes back laboratory, uses Scalpel cuts the strong intersection of disease, and the fritter of 3mm × 3mm is cut into scissors, and it is 2.5% that the fritter sheared, which is put into concentration, Surface sterilization 2min in NaClO solution, then with rinsed with sterile water 3 times.After natural drying, it is placed in the streptomysin containing 50ng/mL On potato dextrose agar (PDA), the formula of potato dextrose agar are as follows: 1000 milliliters of pure water, 200 G potato, 20 grams of glucose, 15 grams of agar.Dark culturing at 25 DEG C.Growth will grow the bacterium colony of grape Elsinochrome after 5 days It is transferred in new PDA culture medium and continues to cultivate (Figure 1A).Conidium is uniformly coated in PDA culture medium, growth 6 days can Single colonie is grown, the colony inoculation of picking list grape Elsinochrome is in (Figure 1B) in new PDA culture medium.It is extracted using CTAB method Elsinǒe ampelina DNA expands (forward primer: 5 '-TCCGTAGGTGAACCTGCGGA-3 ', reverse primer: 5 '-by ITS TCCTACCTGATCCGAGGTCA-3 '), product clip size is 580bp (Fig. 1 C), and the DNA sequence dna that the product segment is sequenced is:
TCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGGTAGGGTTCTCCTCCGGGAAGCCCGAACTCCCC ACCCCTTGCTGTTGCGAATACGTTGCTTCGGCGGGACCCCCCCTTCTGCCCTTCACCGGGGAGGGGGAGGGACCGG GCCTTCACGGGCCCGGGCAGCGCCCGCCGGGGGACCGAACCAACTCTTTTTGTTAAACAATGCAGTCGGAGTACAA CGTACATAATCAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGA TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGG GCATGCCTGTTCGAGCGTCATTTCACCAATCAAGCCCCGCTTGGTATTAGGCGATCCGGCCGGCCCCCCCGTGGCC GGCCCGCCCGAAATGCATCGGCGAGGCACCGACCCCCGGCGTGTTAGAATTTCTTTTAACGTCGGGAGCACCGGTG TACCTCCGCCGTGAAACCTTTCTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGA (as shown in SEQ ID NO.1).
Gained sequence is compared in ncbi database, as a result with the sequence identity highest of Elsinǒe ampelina, belongs to Grape Elsinochrome (Fig. 1 D) in Elsinoe, therefore it is named as grape Elsinochrome.
Embodiment 2: training method produces the influence of spore to grape Elsinochrome
Picking grows 15 days grape Elsinochrome colony edges on PDA culture dish first, is inoculated in and cultivates containing PDA In the culture dish of base and the culture bottle containing PDA culture medium (Fig. 2A and 2E), dark culturing at 25 DEG C, colonial morphology such as Fig. 2 institute Show, after culture 25 days, then culture dish and culture bottle are placed at 21 DEG C and induced 24 hours, scrapes bacterium colony with aseptic operation knife Surface texture, is squeezed into powdered, is then placed in sterile water, shakes 30 seconds, supernatant is taken to carry out grape with blood counting chamber Elsinochrome spore count obtains grape Elsinochrome spore.
Using the bacterium colony of the grape Elsinochrome of culture bottle culture, sporulation quantity is up to 5.3 × 106A/mL, and culture dish The sporulation quantity of the bacterium colony of each grape Elsinochrome under the same conditions is only 1.3 × 106A/mL (Fig. 3 B).Illustrate with culture The training method grape Elsinochrome of bottle is better than culture dish on sporulation quantity.
Embodiment 3: incubation time produces the influence of spore to grape Elsinochrome
Since the growth of grape Elsinochrome is slower, the colony colour of the grape Elsinochrome of early period is kermesinus, but Become celadon in later period colony colour, the influence of spore is produced to inquire into incubation time to grape Elsinochrome, culture bottle is trained The grape Elsinochrome supported 20 days, 25 days, 30 days and 35 days carries out induction and produces spore, and discovery is cultivated 25 days on culture bottle, grape The sporulation quantity of Elsinochrome is maximum, and the sporulation quantity of 35 days grape Elsinochromes is only 0.25 × 106A/mL (Fig. 3 D), says The long production spore for being unfavorable for grape Elsinochrome of bright incubation time.It is found by morphologic observation, cultivates 35 days grape Elsinochromes Bacterium colony surface have a large amount of aerial hyphaes (Fig. 4 E), and generate a large amount of oil vacuole (Fig. 4 F) in mycelia, induce grape scab blister cavities The sporulation quantity of bacterium is low;And the bacterium colony surface aerial hyphae for cultivating 25 days grape Elsinochromes is few (Fig. 4 B), does not observe oil vacuole, energy Enough induce more conidium (Fig. 4 C).Illustrate when being within culture bottle culture 25 days that the optimal induction of grape Elsinochrome produces spore Phase.
Embodiment 4: temperature produces the influence of spore to grape Elsinochrome
In order to which clear temperature produces the influence of spore to grape Elsinochrome, by culture bottle culture 25 days grape Elsinochromes, It is individually positioned at 19 DEG C, 21 DEG C, 23 DEG C and 25 DEG C and induces 24 hours, as a result, it has been found that being induced at 21 DEG C, grape Elsinochrome Spore amount it is maximum, reach 5.0 × 106A/mL (Fig. 3 A).To further determine that how long need induction at 21 DEG C, effect Most preferably, culture bottle culture 25 days grape Elsinochromes are placed at 21 DEG C and are induced, respectively at 6 hours, 12 hours, 18 is small When, sporulation quantity is observed after 24 hours, 30 hours, as a result, it has been found that the sporulation quantity of grape Elsinochrome reaches steady 24 hours at 21 DEG C Fixed (Fig. 3 C).
Embodiment 5: illumination produces the influence of spore to grape Elsinochrome
A large amount of document report grape Elsinochrome needs are cultivated under dark condition, for clear illumination grape scab Blister cavities bacterium produces the influence of spore, by culture bottle or culture dish culture 25 days grape Elsinochromes under illumination condition, 21 DEG C of inductions 24 hours, as a result, it has been found that the production spore effect of grape Elsinochrome is better than under illumination condition (Fig. 3 B) under dark condition, illustrate illumination Under be unfavorable for induce grape Elsinochrome produce spore.
Nucleotide or amino acid sequence table
<110>university, Xibei Univ. of Agricultural & Forest Science & Technology
<120>a kind of induction grapevine anthracnose pathogen stablizes the method for producing spore
<160>
<210> 1
<211> 580
<212> SEQ ID NO. 1
<213> DNA
<220>
<400> 1
TCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGGTAGGGTTCTCCTCCGGGAAGCCCGAACTCCCCA CCCCTTGCTGTTGCGAATACGTTGCTTCGGCGGGACCCCCCCTTCTGCCCTTCACCGGGGAGGGGGAGGGACCGGGC CTTCACGGGCCCGGGCAGCGCCCGCCGGGGGACCGAACCAACTCTTTTTGTTAAACAATGCAGTCGGAGTACAACGT ACATAATCAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATG CCTGTTCGAGCGTCATTTCACCAATCAAGCCCCGCTTGGTATTAGGCGATCCGGCCGGCCCCCCCGTGGCCGGCCCG CCCGAAATGCATCGGCGAGGCACCGACCCCCGGCGTGTTAGAATTTCTTTTAACGTCGGGAGCACCGGTGTACCTCC GCCGTGAAACCTTTCTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGA
<210> 2
<211>25
<212>forward primer
<213> DNA
<220>
<400> 2
5’- TCCGTAGGTGAACCTGCGGA-3’
<210> 3
<211>25
<212>reverse primer
<213> DNA
<220>
<400> 3
5’- TCCTACCTGATCCGAGGTCA-3’

Claims (3)

1. a kind of method that induction grape Elsinochrome (Elsinoe ampelina) produces spore, which is characterized in that according to the following steps It carries out:
(1) the outer ring mycelia that 15 days grapevine anthracnose disease fungus bacterium colonies are grown on the culture dish equipped with PDA culture medium is taken Body is inoculated in the new sterile culture bottle equipped with PDA culture medium;
At (2) 25 DEG C after dark culturing 25 days, by culture bottle at 21 DEG C, dark is placed 24 hours;
(3) bacterium colony surface texture is scraped with aseptic operation knife, is squeezed into powdered, be then placed in sterile water, shaken 30 seconds, take Supernatant carries out grape Elsinochrome spore count with blood counting chamber, obtains grape Elsinochrome spore.
2. the method as described in claim 1, which is characterized in that the PDA culture medium is potato dextrose agar culture Base, formula are as follows: 1000 milliliters of pure water, 200 g potatos, 20 grams of glucose, 15 grams of agar.
3. the method as described in claim 1, which is characterized in that the culture bottle is glass material, is had on plastic bottle closure 0.22 micron of micropore and the ventilated membrane of energy filtering microorganism, specification is 250 milliliters, the size point of bore, the diameter of a cross-section of a tree trunk 1.3 meters above the ground and bottle height It Wei not be 5.6 centimetres, 6.9 centimetres and 9.1 centimetres.
CN201611220119.5A 2016-12-26 2016-12-26 A method of induction grape Elsinochrome produces spore Active CN106834135B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611220119.5A CN106834135B (en) 2016-12-26 2016-12-26 A method of induction grape Elsinochrome produces spore

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611220119.5A CN106834135B (en) 2016-12-26 2016-12-26 A method of induction grape Elsinochrome produces spore

Publications (2)

Publication Number Publication Date
CN106834135A CN106834135A (en) 2017-06-13
CN106834135B true CN106834135B (en) 2019-11-22

Family

ID=59136476

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611220119.5A Active CN106834135B (en) 2016-12-26 2016-12-26 A method of induction grape Elsinochrome produces spore

Country Status (1)

Country Link
CN (1) CN106834135B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108103001A (en) * 2018-02-08 2018-06-01 云南农业大学 A kind of method that phytophthora infestans is promoted to generate a large amount of sporangiums
CN108998404B (en) * 2018-09-13 2022-02-25 安徽农业大学 Method for inducing anthrax bacteria to produce conidia

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1683536A (en) * 2005-03-07 2005-10-19 西北农林科技大学 Black spot disease resistant candidate gene sequence of wild vitis amurensis of vitis China and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007011022A1 (en) * 2005-07-22 2007-01-25 Sankyo Agro Company, Limited 3-(isoquinoline-1-yl)quinoline derivative

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1683536A (en) * 2005-03-07 2005-10-19 西北农林科技大学 Black spot disease resistant candidate gene sequence of wild vitis amurensis of vitis China and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Atsushi Kono, et al..Effect of Culture Conditions on Conidia Formation by Elsinoëampelina, the Causal Organism of Grapevine Anthracnose.《Plant Disease》.2009,第93卷(第5期),第481-484页. *
田间自然条件下葡萄黑痘病抗性鉴定;刘晓娟 等;《西北农业学报》;20151231;第24卷(第6期);第138-142页 *
葡萄黑痘病病原菌生长特性研究;林玲 等;《南方农业学报》;20160430;第47卷(第4期);第571-575页 *

Also Published As

Publication number Publication date
CN106834135A (en) 2017-06-13

Similar Documents

Publication Publication Date Title
CN101955886B (en) Bbeauveria bassaria Bb-N1 strain, preparation method and application thereof
CN101319193B (en) Verticillium lecanii strain and uses thereof
CN109762777A (en) One plant of Paenibacillus polymyxa bacterial strain and its application
CN105861330B (en) A kind of bacterial strain of the promotion with leaf pocket orchid plant strain growth and its application
CN107460133B (en) Dark color has every endogenetic fungus HS40 and its application in dendrobium candidum production
CN105861332B (en) A kind of bacterial strain of the promotion with leaf pocket orchid plant strain growth and its application
CN105039414B (en) A kind of preparation method of mould fermented liquid that preventing and treating tobacco black shank
CN107475130A (en) Thin handle Isaria novel bacterial and its cultural method and purposes
KR101056952B1 (en) Mass production method of black scale mushroom using lumber cultivation
CN102119629A (en) Mutagenesis method for new low-temperature type bacterial strain of straw mushroom and application thereof
CN106834135B (en) A method of induction grape Elsinochrome produces spore
CN104195064B (en) The Oryza sativa L. endogeny rayungus of the one external efficient antagonism Pyricularia oryzae of strain
CN114164137B (en) Streptomyces diastochromogenes for resisting banana vascular wilt and application thereof
CN114921345A (en) Conifera bacterial strain SGSF767 and application thereof in preventing and treating plant diseases
CN101451108B (en) Verticillium lecanii for preventing and controlling fly type pests and use thereof
CN102960369B (en) Preparation method of granular paecilomyces lilacinus biological nematocide
CN105441332A (en) Beauveria bassiana separated from tussah and application of beauveria bassiana
CN103340156B (en) Novel strain of lyophyllum decastes
CN111394507A (en) Biocontrol fungus identification method for betel nut taro soft rot disease
CN105462854B (en) Application of the sophora tonkinensis Gapnep endogenetic fungus SDTE-P in prevention and treatment Radix Notoginseng anthracnose
CN103843580A (en) Paecilomyces hepialid mycelium and preparation method thereof
CN114874917B (en) Trichoderma atroviride T3, microbial inoculum prepared from same, microbial inoculum preparation method and application of microbial inoculum
CN109220514B (en) Separation and artificial domestication cultivation method of new wild edible fungi
CN107211727B (en) A kind of method and application of wild reed mushroom artificial culture
CN106032523A (en) Simple method for separating and purifying apple ring spot bacteria

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant