CN106832001A - A kind of desinsection fusion protein, encoding gene and its application - Google Patents

Abstract

The invention discloses an insecticidal fusion protein, which comprises IPD072 protein and Vip3 protein. Compared with the original IPD072 protein and Vip3 protein, the artificial protein molecule fused into the IPD072 protein and a Vip3 toxin designed by the present invention has the following advantages: it has a wide insecticidal spectrum and can simultaneously prevent and control various insecticides in Lepidoptera and Coleoptera. For important pests (such as beet armyworm, armyworm, and corn rootworm), the insecticidal efficiency is as high as 50%‑100%; it is beneficial for the combined use of proteins with the above-mentioned different functions and other insect-resistant proteins (such as ICPs) to further expand insecticide Spectrum, delaying the emergence of pest resistance.

Description

A kind of insecticidal fusion protein, coding gene and application thereof

(1) Technical field

The invention relates to an insecticidal fusion protein, an encoding gene of the insecticidal fusion, and the application of the fusion protein.

(2) Background technology

Pests have brought huge losses to global agricultural production. At present, pest control mainly relies on chemical pesticides, but the use of pesticides has increased production costs, and pesticide residues have caused serious harm to human health. Therefore, the use of genetic engineering methods to control pests has great economic, environmental and social value.

The key to obtaining transgenic insect-resistant crops is to clone good insecticidal proteins. There are many insecticidal proteins, and the most widely used one is a kind of accompanying cell crystal protein (insecticidalcrystal proteins, ICP) secreted by Bacillus thuringiensis (Bt) during cell production, such as Cry1Ab, Cry1C, etc. Lepidoptera, Diptera, Coleoptera and other insects (such as diamondback moth, corn borer) have a strong killing effect (Schnepf, E., Crickmore, N., Van, R.J., Lereclus, D., Baum, J. , & Feitelson, J., et al.1998,62 (3), 775-806.), has been deeply studied and widely used at present, and Bt genetically modified crops such as corn, soybean, potato, cotton have been commercially planted on a large scale . During vegetative growth, Bacillus thuringiensis also secretes a protein that has no amino acid sequence homology with ICPs and has a completely different insecticidal mechanism, namely vegetative insecticidal proteins (VIPs), such as Vip3A, Vip3B, and Vip3C , Vip3D, Vip3H, also have insecticidal activity to some pests insensitive to ICPs, and cross resistance will not occur (Estruch, J.J., Warren, G.W., Mullins, M.A., Nye, G.J., Craig, J.A., & Koziel, M.G.1996 , Proceedings of the National Academy of Sciences of the United States of America, 93(11), 5389-94.).

As a new type of insecticidal protein, Vip3 protein is a good supplement to the most widely used ICP protein in terms of insecticidal mechanism, insecticidal spectrum and insecticidal activity. For example, ICPs have a weak killing effect on Spodoptera litura and Armyworm, and Vip3 has a very good control effect on Spodoptera litura and Armyworm. Nevertheless, there are still some technical problems that need to be solved urgently in the actual operation of the research and development of genetically modified crops. For example, the researchers found that plants with high expression of a single Vip3 gene grew more slowly and were prone to albinism. This may be due to the direct expression of Vip3 protein in transgenic plants, due to the secretion of the signal peptide, the protein aggregates in large quantities and binds to the plant cell membrane to form pores, thereby causing damage to the cells and affecting their growth and development.

Corn is the most productive food crop in the world, but it is also threatened by many pests. Among these pests, the root firefly has a particularly chilling name—they are one of the most destructive corn pests. After the larvae of the root firefly beetle invade the rhizome of the host, they will devour the tissue, causing the root to rot, the plant to fall, and the plant to reduce yield or even die. Adults also feed on the leaves, flowers, and seeds of their hosts. Before 1955, they were distributed in a limited number of states in the United States, but after that, they invaded the northern United States that was not suitable for their survival. In 1990, when Eastern Europe was in turmoil, this pest was accidentally introduced into Serbia at this time, so the European continent, especially Eastern Europe, also became their territory. In recent years, it has also spread to China. Diabrotica sp. is a general term for insects of the genus Diabrotica sp. In the United States, several species of root fireflies that harm corn are called corn rootworms (Corn Rootworm), and the three most harmful are called "Western Corn Rootworm", "Northern Corn Rootworm" and "Southern Corn Rootworm" ". The proteins found to have the effect of killing corn rootworms are mainly Cry protein and Vip protein from Bacillus thuringiensis. Among them, mCry3A, Cry3Bb1, eCry3.1Ab and protein complex Cry34Ab1/Cry35Ab1 have been applied in commercial transgenic lines, and have produced different degrees of resistance (Lefko S A, Nowatzki TM, Thompson S D, et al.2008, Journal of Applied Entomology, 132(3), 189–204; Zhao, J.Z., Oneal, M.A., Richtman, N.M., Thompson, S.D., Cowart, M.C., & Nelson, M.E., et al. 2016, Journal of Economic Entomology(3)). Studies have also shown that RNAi technology can be used in the control of coleopteran pests such as corn rootworms (Baum, J.A., Bogaert, T., Clinton, W., Heck, G.R., Feldmann, P., & Ilagan, O., et al. 2007, Nature Biotechnology, 25(11), 1322-6.). Recently, a gene IPD072Aa cloned from Pseudomonas by DuPont has the effect of killing corn rootworm (Schellenberger, U., Oral, J., Rosen, B.A., Wei, J.Z., Zhu, G., & Xie, W., et al. 2016, Science, 354(6312), 635-637.).

Most of the first-generation transgenic crops only have the characteristics of resistance to Lepidopteran pests, while the second-generation transgenic crops are developing towards compound traits of resistance to multiple pests at the same time. There are many ways to obtain transgenic crops with complex traits, such as through hybridization of transgenic crops with a single trait; by constructing multiple gene expression cassettes in the same expression cassette; Agrobacteria are mixed together for mixed transformation, and transgenic plants with multiple genes integrated with two or more plasmid T-DNAs are screened out. However, there are still some problems in the actual operation and application of the above method. Therefore, obtaining a simpler and more efficient method of cultivating transgenic crops with complex traits is an urgent problem that needs to be solved.

(3) Contents of the invention

The purpose of the present invention is to provide a method for making the same insecticidal fusion protein simultaneously have killing effects on Lepidoptera and Coleoptera pests through gene fusion.

The technical scheme adopted in the present invention is:

The invention provides an insecticidal fusion protein. The insecticidal fusion protein is IPD072 protein and Vip3 toxin from N-terminal to C-terminal respectively.

Further, the IPD072 protein is one of IPD072Aa protein, IPD072Bb protein, IPD072Ca protein or IPD072Da protein; the Vip toxin is one of Vip3A toxin, Vip3B toxin, Vip3C toxin, Vip3D toxin or Vip3H toxin.

Further, the insecticidal fusion protein is formed by fusion of IPD072Aa protein and Vip3A toxin, and its amino acid sequence is shown in SEQ ID NO:2.

Further, the insecticidal fusion protein is formed by fusion of IPD072Aa protein and Vip3H toxin, and its amino acid sequence is shown in SEQ ID NO:4.

The present invention also provides a gene encoding the insecticidal fusion protein, the gene from 5' to 3' is the nucleotide sequence encoding the IPD072 protein and the nucleotide sequence encoding the Vip3 toxin; and the above two The nucleotide sequences are in the same open reading frame.

Further, the gene encoding IPD072 protein is one of IPD072Aa, IPD072Bb, IPD072Ca, IPD072Da; the gene encoding Vip3 toxin is one of Vip3A, Vip3B, Vip3C, Vip3D or Vip3H. More preferably, the nucleotide sequence of the coding gene is shown in SEQ ID NO:1 or SEQ ID NO:3.

The present invention also provides an application of the insecticidal fusion protein in the preparation of transgenic insect-resistant crops, transgenic insecticidal microorganisms or antibodies.

Furthermore, the transgenic insect-resistant crop is prepared by transforming fusion protein combined with BT crystal toxin.

Compared with the prior art, the beneficial effect of the present invention is mainly reflected in: the artificial protein molecule fused with the IPD072 protein designed in the present invention and a Vip3 toxin, compared with the original IPD072 protein and Vip3 protein, has the following advantages: It has a wide spectrum and can simultaneously control many important pests in Lepidoptera and Coleoptera (such as beet armyworm, armyworm, corn rootworm), and the insecticidal efficiency is as high as 50%-100%; it is beneficial to proteins and The combined use of other insect-resistant proteins (such as ICPs) further expands the insecticidal spectrum and delays the generation of pest resistance.

(4) Description of drawings

Fig. 1 is a structural diagram of the insecticidal fusion protein of the present invention, in which the N-terminal of the insecticidal fusion protein is the IPD072 protein, and the C-terminal is the Vip3 toxin.

Fig. 2 is the structure diagram of the expression cassette for introducing the insecticidal fusion protein gene into plants in the present invention; pUBI is the maize ubiquitin promoter, and the insecticidal fusion protein gene is the IPD072-Vip3 toxin fusion gene.

Fig. 3 is the structure diagram of the expression cassette of combining insecticidal fusion protein and ICPs into plants in the present invention; pUBI is the maize ubiquitin promoter, insecticidal fusion protein gene is IPD072-Vip3 toxin fusion gene, and p35S is cauliflower mosaic virus 35S promoter, ICPs is the gene encoding parasporal crystal protein.

(5) Specific implementation methods

The present invention is further described below in conjunction with specific embodiment, but protection scope of the present invention is not limited thereto:

Example 1, Construction of IPD072Aa-Vip3A insecticidal fusion protein expression vector

Both IPD072Aa and Vip3A insecticidal protein genes were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 7 in Chinese patent 200610049611.0, and were cloned into the pET28a expression vector with restriction enzymes BamHI and Between SacI sites. The constructed vectors were named pET28a-IPD072Aa and pET28a-Vip3A, respectively.

The specific steps of IPD072Aa-Vip3A synthesis are as follows:

1. Using Vip3A (SEQ ID NO: 7 in Chinese patent 200610049611.0) as a template to obtain the Vip3A gene fragment by PCR. The primers were: Vip3A-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip3A-R: 5'CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.

2. The PCR product was treated with XmalI and ScaI, and ligated with the pET28a-IPD072Aa vector treated with the same enzymes.

3. Transform into Escherichia coli and obtain the plasmid pET28a-IPD072Aa-Vip3A. The fusion protein gene IPD072Aa-Vip3A (SEQ ID NO: 1) was cloned into the pET28a expression vector, and the molecular weight of the fusion protein IPD072Aa-Vip3A (SEQ ID NO: 2) encoded by the fusion protein gene was about 98kD.

Example 2, Construction of IPD072Aa-Vip3H fusion protein expression vector

Both IPD072Aa and Vip3H insecticidal protein genes were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 6, respectively, and were cloned between the restriction endonuclease BamHI and SacI sites of the pET28a expression vector . The constructed vectors were named pET28a-IPD072Aa and pET28a-Vip3H, respectively.

The specific steps for the synthesis of IPD072Aa-Vip3H are as follows:

4. Using Vip3H (SEQ ID NO: 6) as a template to perform PCR to obtain the Vip3A gene fragment. The primers were: Vip3H-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip3H-R: 5'CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.

5. The PCR product was treated with XmalI and ScaI, and ligated with the pET28a-IPD072Aa vector treated with the same enzymes.

6. Transform into Escherichia coli and obtain the plasmid pET28a-IPD072Aa-Vip3H. The fusion protein gene IPD072Aa-Vip3H (SEQ ID NO: 3) was cloned into the pET28a expression vector, and the molecular weight of the fusion protein IPD072Aa-Vip3H (SEQ ID NO: 4) encoded by the fusion protein gene was about 98kD.

Embodiment 3, the expression of insecticidal protein

The expression vectors (pET28a-IPD072Aa-Vip3A, pET28a-IPD072Aa-Vip3H, pET28a-IPD072Aa, pET28a-Vip3A and pET28a-Vip3H) containing the fusion protein gene were transformed into Escherichia coli BL21star using general standard methods. Pick a monoclonal colony and inoculate it into 100ml of LB bacterial culture medium, shake culture at 37°C until OD ₆₀₀ =0.6, add IPTG to 0.5mM, and continue to cultivate under the same conditions for 4 hours. The collected culture solution was centrifuged at 5000 g for 10 minutes to precipitate E. coli cells, and then the supernatant was discarded to collect the precipitate. Add 30 ml of pH 7.5, 20 mM Tris-HCL buffer solution to the precipitate, and ultrasonically pulverize it, then it can be used for the determination of insecticidal activity.

Example 4, IPD072Aa-Vip3A and IPD072Aa-Vip3H have killing effects on various Lepidoptera and Coleoptera pests

The insecticidal proteins obtained in Example 3 (IPD072Aa-Vip3A, IPD072Aa-Vip3H, IPD072Aa, Vip3A and Vip3H) were respectively coated on the surface of the artificial diet for insects, and the newborn first instar larvae were used for insecticidal determination. The negative control is pET28a empty vector, and the preparation method is the same as that in Example 3. The insecticidal activity results are shown in Table 1:

Table 1. Insecticidal efficiency of fusion protein

Armyworm beet armyworm western corn rootworm IPD072Aa 0% 0% 100% Vip3A 100% 100% 0% Vip3H 100% 100% 0% IPD072Aa-Vip3A 100% 100% 100% IPD072Aa-Vip3H 100% 100% 100% negative control 0% 0% 0%

Embodiment 5, IPD072Aa-Vip3A plant transformation vector construction

The IPD072Aa-Vip3A gene fragment was obtained by PCR using IPD072Aa-Vip3A (SEQ ID NO: 1) as a template. The primers were: IVA-F: 5'AGGATCCAACAATGGGCATCACCGTGACCAAC and IVA-R: 5'CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTC. These two primers contain restriction endonuclease sites BamH1 and ScaI sites, respectively. The artificially synthesized terminator sequence ter (SEQ ID NO: 8) is provided with ScaI and KpnI sites at the 5' end and 3' end respectively. The IPD072Aa-Vip3A digested with BamH1 and ScaI and the terminator digested with ScaI and KpnI were ligated into the pCambia1300 vector digested with BamH1 and KpnI to obtain pCambia1300-IPD072Aa-Vip3A-ter.

pUBI is a maize ubiquitin promoter obtained by PCR. Using the genomic DNA of commercial maize variety Zhengdan 958 as a template, pUBI was amplified by PCR. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 68°C for 15 seconds, 72°C for 2 minutes, repeating 32 cycles; and then 72°C for 10 minutes. The obtained PCR product of about 2.0 Kb was cloned into the T-vector pMD19. Sequence correct clones were obtained for the following experiments. PCR primers were pUBI-F (5'GAAGCTTGCATGCCTACAGTGCAGCGTGACCC) and pUBI-R (5'GGGTGGATCCTCTAGAGTCGACCTGCAGAAGTAAC), and HindIII and BamHI restriction endonuclease sites were set on the primers, respectively.

Digest pUBI with HindIII and BamHI, and connect the digested fragment into the pCambia1300-IPD072Aa-Vip3A-ter vector digested with the same enzyme to obtain the final vector. This vector was named: pCambia1300-pUBI-IPD072Aa-Vip3A.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15 μg/ml tetracycline and 50 μg/mL kanamycin, and kept for inoculation. The plants that come down are transformed.

Example 6, IPD072Aa-Vip3H Plant Transformation Vector Construction

The IPD072Aa-Vip3H gene fragment was obtained by PCR using IPD072Aa-Vip3H (SEQ ID NO: 3) as a template. The primers were: IVH-F: 5'AGGATCCAACAATGGGCATCACCGTGACCAAC and IVH-R: 5'CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGG. These two primers contain restriction endonuclease sites BamH1 and ScaI sites, respectively. The artificially synthesized terminator sequence ter (SEQ ID NO: 8) is provided with ScaI and KpnI sites at the 5' end and 3' end respectively. The IPD072Aa-Vip3H digested with BamH1 and ScaI and the terminator digested with ScaI and KpnI were ligated into the pCambia1300 vector digested with BamH1 and KpnI to obtain pCambia1300-IPD072Aa-Vip3H-ter.

pUBI is the maize ubiquitin promoter. The method for obtaining it is the same as that in Example 5.

Digest pUBI with HindIII and BamHI, and connect the digested fragment into the pCambia1300-IPD072Aa-Vip3H-ter vector digested with the same enzyme to obtain the final vector. This vector was named: pCambia1300-pUBI-IPD072Aa-Vip3H.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15 μg/ml tetracycline and 50 μg/mL kanamycin, and kept for inoculation. The plants that come down are transformed.

Embodiment 7, IPD072Aa-Vip3A and ICPs protein plant transformation vector construction

The insecticidal protein gene of Cry1Ab (SEQ ID NO: 7) was synthesized by Shanghai Sangong, and BamH1 and ScaI sites were set at the 5' end and 3' end respectively. Artificially synthesized terminator sequence ter (SEQ ID NO: 8), ScaI and EcoRI sites are set at the 5' end and 3' end respectively. The Cry1Ab digested with BamHI and ScaI and the terminator digested with ScaI and EcoRI were ligated into the pCambia1300 vector digested with BamH1 and EcoRI to obtain pCambia1300-Cry1Ab-ter.

The p35S promoter is cauliflower mosaic virus CaMV 35S promoter, which was synthesized by Shanghai Sangong. The sequence is as shown in SEQ ID NO: 9, and KpnI and BamHI sites are set at the 5' end and 3' end respectively.

Digest pCambia1300-Cry1Ab-ter with BamH1 and EcoRI, digest p35S with KpnI and BamHI, and connect the above two fragments with the vector pCambia1300-IPD072Aa-Vip3A-ter digested with KpnI and EcoRI in three segments to obtain the final vector. This vector was named: pCambia1300-pUBI-IPD072Aa-Vip3A-p35S-Cry1Ab.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15 μg/ml tetracycline and 50 μg/mL kanamycin, and kept for inoculation. The plants that come down are transformed.

Embodiment 8, IPD072Aa-Vip3H and ICPs protein plant transformation vector construction

The insecticidal protein gene of Cry1Ab (SEQ ID NO: 7) was synthesized by Shanghai Sangong, and BamH1 and ScaI sites were set at the 5' end and 3' end respectively. Artificially synthesized terminator sequence ter (SEQ ID NO: 8), ScaI and EcoRI sites are set at the 5' end and 3' end respectively. The Cry1Ab digested with BamHI and ScaI and the terminator digested with ScaI and EcoRI were ligated into the pCambia1300 vector digested with BamH1 and EcoRI to obtain pCambia1300-Cry1Ab-ter.

The p35S promoter is cauliflower mosaic virus CaMV 35S promoter, which was synthesized by Shanghai Sangong. The sequence is as shown in SEQ ID NO: 9, and KpnI and BamHI sites are set at the 5' end and 3' end respectively.

Digest pCambia1300-Cry1Ab-ter with BamH1 and EcoRI, digest p35S with KpnI and BamHI, and connect the above two fragments with the vector pCambia1300-IPD072Aa-Vip3H-ter digested with KpnI and EcoRI to obtain the final vector. This vector was named: pCambia1300-pUBI-IPD072Aa-Vip3H-p35S-Cry1Ab.

Finally, the above T-DNA plasmid was transferred into Agrobacterium LBA4404 by electroporation, and positive clones were selected by YEP solid medium containing 15 μg/ml tetracycline and 50 μg/mL kanamycin, and kept for inoculation. The plants that come down are transformed.

Embodiment 9, transgenic corn

Maize transformation technology is relatively mature. References such as: Vladimir Sidorov & David Duncan (in M. Paul Scott (ed.), Methods in Molecular Biology: Transgenic Maize, vol: 526; Yuji Ishida, Yukoh Hiei & Toshihiko Komari (2007) Agrobacterium-mediated transformation of maize. Nature Protocols 2: 1614-1622. Basic methods as follows:

Hi-II corn ears 8-10 days after pollination were taken, and all immature embryos (1.0-1.5 mm in size) were collected. The recombinant Agrobacterium obtained by transforming Agrobacterium containing the T-DNA vector constructed in Example 3 and immature embryos on a co-cultivation medium (MS+2mg/L 2,4-D+30g/L sucrose+3g/L Agar (sigma 7921) + 40mg/L acetosyringone) co-cultured for 2-3 days (22°C). Transfer immature embryos to callus induction medium (MS+2mg/L 2,4-D+30g/L sucrose+2.5g/L gelrite+5mg/L AgNO3+200mg/L acetosyringone), 28°C in the dark Culture for 10-14 days. All callus were transferred to selection medium (same as callus induction medium) with 2mM glyphosate, and cultured in dark at 28°C for 2-3 weeks. All tissues were transferred to fresh selection medium containing 2mM glyphosate, and cultured in the dark at 28°C for 2-3 weeks. Then, transfer all the embryogenic tissues that survived after screening to the regeneration medium (MS+30g/L sucrose+0.5mg/Lkinetin+2.5g/L gelrite+200mg/L acetosyringone), and culture them in the dark at 28°C for 10-14 day, one strain per dish. Transfer the embryogenic tissue to fresh regeneration medium, and culture in the light at 26°C for 10-14 days. Transfer all fully developed plants to rooting medium (1/2MS+20g/L sucrose+2.5g/L gelrite+200mg/L acetosyringone), and cultivate under light at 26°C until the roots are fully developed. A transgenic maize plant containing the above-mentioned transformation vector is obtained.

Embodiment 10, transgenic corn can kill insects

The T0 generation plants of the transgenic maize plants prepared in Example 9 were transplanted into the greenhouse, pollinated with the pollen of "Zheng 58" (Z58), the female parent of the commercial variety "Zheng Dan 958", and the T0 generation seeds were harvested. These lines were then backcrossed with the female parent of the commercial variety "Zheng Dan 958", "Zheng 58" (Z58), to obtain Z58 near-allelic lines. The herbicide resistance of these near-allelic lines was then compared and analyzed.

We carried out insect resistance determination on 98 transgenic lines (named IV3A) and 105 transgenic lines (named IV3H) transfected with pCambia1300-IPD072Aa-Vip3A-ter vector obtained , its insecticidal effect is as shown in table 2:

Table 2*:

*Note: Table 2 shows the insecticidal effect of different pests on the corn leaf extract 30 days after sowing. At least 3 repetitions were set up for each experiment.

69 transgenic lines (named IV3A1Ab) and 73 transgenic lines (named IV3H1Ab) transfected with pCambia1300-IPD072Aa-Vip3A-p35S-Cry1Ab vector obtained by us were carried out Determination of insect resistance, its insecticidal effect is as shown in table 3:

table 3*:

pest Insecticidal rate corn borer 100% Cotton bollworm 100% Armyworm 100% beet armyworm 100% western corn rootworm 100%

*Note: Table 3 shows the insecticidal effect of different pests on the corn leaf extract 30 days after sowing. At least 3 repetitions were set up for each experiment.

Finally, it should also be noted that what is listed above are only specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and many variations are possible. All deformations that can be directly derived or associated by those skilled in the art from the content disclosed in the present invention should be considered as the protection scope of the present invention.

SEQUENCE LISTING

<110> Zhejiang University

<120> An insecticidal fusion protein, coding gene and application thereof

<130>

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 2652

<212>DNA

<213> unknown

<220>

<223> Artificial sequence

<400> 1

atgggcatca ccgtgaccaa caacagcagc aacccgatcg aggtggccat caaccactgg 60

ggcagcgacg gcgacaccag cttcttcagc gtgggcaacg gcaagcagga gacctgggac 120

aggagcgaca gcaggggctt cgtgctgagc ctgaagaaga acggcgccca gcacccgtac 180

tacgtgcagg ccagcagcaa gatcgaggtg gacaacaacg ccgtgaagga ccagggcagg 240

ctgatcgagc cgctgagccg aggccccggg aagggtggag gaatgaacaa gaacaacacc 300

aagctgagca ccagggccct gccgagcttc atcgactact tcaacggcat ctacggcttc 360

gccaccggca tcaaggacat catgaacatg atcttcaaga ccgacaccgg cggcgacctg 420

accctggacg agatcctgaa gaaccagcag ctgctgaacg acatcagcgg caagctggac 480

ggcgtgaacg gcagcctgaa cgacctgatc gcccagggca acctgaacac cgagctgagc 540

aaggagatcc tgaagatcgc caacgagcag aaccaggtgc tgaacgacgt gaacaacaag 600

ctggacgcca tcaacaccat gctgagggtg tacctgccga agatcaccag catgctgagc 660

gacgtgatga agcagaacta cgccctgagc ctgcagatcg agtacctgag caagcagctg 720

caggagatca gcgacaagct ggacatcatc aacgtgaacg tgctgatcaa cagcaccctg 780

accgagatca ccccggccta ccagaggatc aagtacgtga acgagaagtt cgaggagctg 840

accttcgcca ccgagaccag cagcaaggtg aagaaggacg gcagcccggc cgacatcctg 900

gacgagctga ccgagctgac cggcctggcc aagagcgtgc cgaagaacga cgtggacggc 960

ttcgagttct acctgaacac cttccacgac gtgatggtgg gcaacaacct gttcggcagg 1020

agcgccctga agaccgccag cgagctgatc accaaggaga acgtgaagac cagcggcagc 1080

gaggtgggca acgtgtacaa cagcctgatc gtgctgaccc tgctgcaggc caaggccttc 1140

ctgaccctga ccacctgcag gaagctgctg ggcctggccg acatcgacta caccagcatc 1200

atgaacgagc acctgaacaa ggagaaggag gagttcaggg tgaacatccc gccgaccctg 1260

agcaacacct tcagcaaccc gaactacgcc aaggtgaagg gcagcgacga ggacgccaag 1320

atgatcgtgg aggccaagcc gggccacgcc ctggtgggct tcgagatcag caacgacagc 1380

atcaccgtgc tgaaggtgta cgaggccaag ctgaagcaga actaccaggt ggacaaggac 1440

agcctgagcg aggtgatcta cggcgacatg gacaagctgc tgggcccgga ccagagcggc 1500

ccgatctact acccgaacaa catcgtgttc ccgaacgagt acgtgatcac caagatcgac 1560

ttcaccaaga agatgaagac cctgaggtac gaggtgaccg ccaacttcta cgacagcagc 1620

accggcgaga tcgacctgaa caagaagaag gtggagagca gcgaggccga gtacaggacc 1680

ctgagcgcca acgacgacgg cgtgtacatg ccgctgggcg tgatcagcga gaccttcctg 1740

accccgatca acggcttcgg cctgcaggcc gacgagaaca gcaggctgat caccctgacc 1800

tgcaagagct acctgaggga gctgctgctg gccaccgacc tgagcaacaa ggagaccaag 1860

ctgatcgtgc cgccgagcgg cttcatcaag aacatcgtgg agaacggcag catcgaggag 1920

gacaacctgg agccgtggaa ggccaacaac aagaacgcct acgtggcacca caccggcggc 1980

gtgaacggca ccaaggccct gtacgtgcac aaggacggcg gcatcagcca gttcatcggc 2040

gacaagctga agccgaagac cgagtacgtg atccagtaca ccgtgaaggg caagccgagc 2100

atccacctga aggacgagaa caccggctac atccactacg aggaccacaa caacaacctg 2160

gaggactacc agaccatcac caagaggttc accaccggca ccgacctgaa gggcgtgtac 2220

ctgatcctga agagccagaa cggcgacgag gcctggggcg acaacttcat catcctggag 2280

atcagcccga gcgagaagct gctgagcccg gagctgatca acaccaacaa ctggaccagc 2340

accggcagca ccaacatcag cggcaacacc ctgaccctgt accagggcgg caggggcatc 2400

ctgaagcaga acctgcagct ggacagcttc agcacctaca gggtgtactt cagcgtgagc 2460

ggcgacgcca acgtgaggat caggaacagc aggggaggtgc tgttcgagaa gaggtacatg 2520

agcggcgcca aggacgtgag cgagatcttc accaccaagc tgggcaagga caacttctac 2580

atcgagctga gccagggcaa caacctgaac ggcggcccga tcgtgaagtt ctacgacgtg 2640

agcatcaagt ag 2652

<210> 2

<211> 883

<212> PRT

<213> unknown

<220>

<223> Artificial sequence

<400> 2

Met Gly Ile Thr Val Thr Asn Asn Ser Ser Asn Pro Ile Glu Val Ala

1 5 10 15

Ile Asn His Trp Gly Ser Asp Gly Asp Thr Ser Phe Phe Ser Val Gly

20 25 30

Asn Gly Lys Gln Glu Thr Trp Asp Arg Ser Asp Ser Arg Gly Phe Val

35 40 45

Leu Ser Leu Lys Lys Asn Gly Ala Gln His Pro Tyr Tyr Val Gln Ala

50 55 60

Ser Ser Lys Ile Glu Val Asp Asn Asn Ala Val Lys Asp Gln Gly Arg

65 70 75 80

Leu Ile Glu Pro Leu Ser Arg Gly Pro Gly Lys Gly Gly Gly Met Asn

85 90 95

Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe Ile Asp

100 105 110

Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp Ile Met

115 120 125

Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu Asp Glu

130 135 140

Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys Leu Asp

145 150 155 160

Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn Leu Asn

165 170 175

Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln Asn Gln

180 185 190

Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr Met Leu

195 200 205

Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val Met Lys

210 215 220

Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys Gln Leu

225 230 235 240

Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val Leu Ile

245 250 255

Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile Lys Tyr

260 265 270

Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr Ser Ser

275 280 285

Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu Leu Thr

290 295 300

Glu Leu Thr Gly Leu Ala Lys Ser Val Pro Lys Asn Asp Val Asp Gly

305 310 315 320

Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly Asn Asn

325 330 335

Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile Thr Lys

340 345 350

Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr Asn Ser

355 360 365

Leu Ile Val Leu Thr Leu Leu Gln Ala Lys Ala Phe Leu Thr Leu Thr

370 375 380

Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr Ser Ile

385 390 395 400

Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val Asn Ile

405 410 415

Pro Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala Lys Val

420 425 430

Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys Pro Gly

435 440 445

His Ala Leu Val Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr Val Leu

450 455 460

Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp Lys Asp

465 470 475 480

Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu Gly Pro

485 490 495

Asp Gln Ser Gly Pro Ile Tyr Tyr Pro Asn Asn Ile Val Phe Pro Asn

500 505 510

Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys Thr Leu

515 520 525

Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly Glu Ile

530 535 540

Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr Arg Thr

545 550 555 560

Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val Ile Ser

565 570 575

Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala Asp Glu

580 585 590

Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg Glu Leu

595 600 605

Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile Val Pro

610 615 620

Pro Ser Gly Phe Ile Lys Asn Ile Val Glu Asn Gly Ser Ile Glu Glu

625 630 635 640

Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr Val Asp

645 650 655

His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His Lys Asp

660 665 670

Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys Thr Glu

675 680 685

Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His Leu Lys

690 695 700

Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn Asn Asn Leu

705 710 715 720

Glu Asp Tyr Gln Thr Ile Thr Lys Arg Phe Thr Thr Gly Thr Asp Leu

725 730 735

Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu Ala Trp

740 745 750

Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys Leu Leu

755 760 765

Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly Ser Thr

770 775 780

Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg Gly Ile

785 790 795 800

Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg Val Tyr

805 810 815

Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser Arg Glu

820 825 830

Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val Ser Glu

835 840 845

Ile Phe Thr Thr Lys Leu Gly Lys Asp Asn Phe Tyr Ile Glu Leu Ser

850 855 860

Gln Gly Asn Asn Leu Asn Gly Gly Pro Ile Val Lys Phe Tyr Asp Val

865 870 875 880

Ser Ile Lys

<210> 3

<211> 2646

<212>DNA

<213> unknown

<220>

<223> Artificial sequence

<400> 3

atgggcatca ccgtgaccaa caacagcagc aacccgatcg aggtggccat caaccactgg 60

ggcagcgacg gcgacaccag cttcttcagc gtgggcaacg gcaagcagga gacctgggac 120

aggagcgaca gcaggggctt cgtgctgagc ctgaagaaga acggcgccca gcacccgtac 180

tacgtgcagg ccagcagcaa gatcgaggtg gacaacaacg ccgtgaagga ccagggcagg 240

ctgatcgagc cgctgagccg aggccccggg aagggtggag gaatgaacaa gaacaacagt 300

aagctctcca cccgcgccct cccgtccttc atcgactact tcaacggcat ctacggcttc 360

gccaccggca tcaaggacat catgaacatg atcttcaaga ccgacaccgg cggcaacgtc 420

accctcgacg agatcctcaa gaaccagcag ctcctcaacg agatcagcgg caagctcgac 480

ggcgtgaacg gctccctcaa cgagctgatc gcccaggtca acctcaacac cgagctgtcc 540

aaggagatcc tcaagatctc caacgagcag aaccaggtgc tcaacgacgt gaacaacaag 600

ctggacgcca tcaacaccat gctgcacatc tacctcccga agatcacctc catgctctcc 660

gacgtgatga agcagaacta cgccctctcc ctccagatcg agtacctctc caagcagctc 720

caggagatca gcgacaagct cgacatcatc aacgtgaacg tgctcatcaa ctccaccctc 780

accgagatca ccccggccta ccagcgcatc aagtacgtga acgagaagtt cgaggagctg 840

accttcgcca ccgagaccac cctcaaggtg aagaaggact cctccccggc cgacatcctc 900

gacgagctga ccgagctgac cgagctggcc aagtccgtga ccaagaacga cgtggacggc 960

ttcgagttct acctcaacac cttgcacgac gtgatggtgg gcaacaacct cttcggccgc 1020

tccgccctca agaccgcctc cgagctgatc gccaaggaga acgtgaagac ctccggctcc 1080

gaggtgggca acgtgtacaa cttcctcatc gtgctcaccg ccctgcaggc caaggccttc 1140

ctcaccctca ccacctgccg caagctcctc ggcctcgccg gcatcgacta cacctccatc 1200

atgaacgagc acctcaacaa ggagaaggag gagttccgcg tgaacatcct cccgaccctc 1260

tccaacacct tctccaaccc gaactacgcc aaggtgaagg gctccgacga ggacgccaag 1320

atgatcgtgg aggccaagcc gggccacgcc ctcgtgggct tcgagatgtc caacgactcc 1380

atcaccgtgc tcaaggtgta cgaggccaag ctcaagcaga actaccaggt ggacaaggac 1440

tccctctccg aggtgatcta cggcgacacc gacaagctct tctgcccgga ccagtccgag 1500

cagatatact acaccaacaa catcgtgttc ccgaacgagt acgtgatcac caagatcgac 1560

ttcaccaaga agatgaagac cctccgctac gaggtgaccg ccaacttcta cgactcctcc 1620

accggcgaga tcgacctcaa caagaagaag gtggagtcct ccgaggccga gtaccgcacc 1680

ctctccgcca acgacgacgg cgtgtacatg ccgctcggcg tgatctccga aaccttcctc 1740

accccgatca acggcttcgg cctccaggcc gacgagaact cccgcctcat caccctcacc 1800

tgcaagtcct acctccgcga gctgctcctc gccaccgacc tctccaacaa ggagaccaag 1860

ctcatcgtgc cgccgtccgg cttcatctcc aacatcgtgg agaacggcgg catcgaggag 1920

gacaacctcg agccgtggaa ggccaacaac aagaacgcct acgtggcacca caccggcggc 1980

gtgaacggca ccaaggccct ctacgtgcac aaggacggcg gcttctccca gttcatcggc 2040

gacaagctca agccgaagac cgagtacgtg atccagtaca ccgtgaaggg caaggccagc 2100

atctacctga aggacgagaa gaacaacgag ggcatctacg aggagatcaa caacgacctg 2160

gaggacttcc agaccgtgac caagaggttc atcaccggca ccgacagcag cggcgtgcac 2220

ctgatcttca ccagccagaa cggcgacgag gccttcggcg gcaacttcat catcagcgag 2280

atcaggagca gcgaggagct gctgagcccg gagctgatca agagcgacgc ctgggtgggc 2340

agccagggca cctggatcag cggcaacagc ctgaccatca acagcaacgc caacggcacc 2400

ttcaggcaga acctgccgct ggagagctac agcacctaca gcatgaactt caacgtgaac 2460

ggcttcgcca aggtgaccgt gaggaacagc aggggaggtgc tgttcgagaa gaacttcagc 2520

cagctgagcc cgaaggacta cagcgagaag ttcaccaccg ccgccaacaa caccggcttc 2580

tacgtggagc tgagcagggg cacccagggc ggcaacatca ccttcaggga cttcagcatc 2640

aagtag 2646

<210> 4

<211> 881

<212> PRT

<213> unknown

<220>

<223> Artificial sequence

<400> 4

Met Gly Ile Thr Val Thr Asn Asn Ser Ser Asn Pro Ile Glu Val Ala

1 5 10 15

Ile Asn His Trp Gly Ser Asp Gly Asp Thr Ser Phe Phe Ser Val Gly

20 25 30

Asn Gly Lys Gln Glu Thr Trp Asp Arg Ser Asp Ser Arg Gly Phe Val

35 40 45

Leu Ser Leu Lys Lys Asn Gly Ala Gln His Pro Tyr Tyr Val Gln Ala

50 55 60

Ser Ser Lys Ile Glu Val Asp Asn Asn Ala Val Lys Asp Gln Gly Arg

65 70 75 80

Leu Ile Glu Pro Leu Ser Arg Gly Pro Gly Lys Gly Gly Gly Met Asn

85 90 95

Lys Asn Asn Ser Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe Ile Asp

100 105 110

Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp Ile Met

115 120 125

Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asn Val Thr Leu Asp Glu

130 135 140

Ile Leu Lys Asn Gln Gln Leu Leu Asn Glu Ile Ser Gly Lys Leu Asp

145 150 155 160

Gly Val Asn Gly Ser Leu Asn Glu Leu Ile Ala Gln Val Asn Leu Asn

165 170 175

Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ser Asn Glu Gln Asn Gln

180 185 190

Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr Met Leu

195 200 205

His Ile Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val Met Lys

210 215 220

Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys Gln Leu

225 230 235 240

Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val Leu Ile

245 250 255

Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile Lys Tyr

260 265 270

Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr Thr Leu

275 280 285

Lys Val Lys Lys Asp Ser Ser Pro Ala Asp Ile Leu Asp Glu Leu Thr

290 295 300

Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val Asp Gly

305 310 315 320

Phe Glu Phe Tyr Leu Asn Thr Leu His Asp Val Met Val Gly Asn Asn

325 330 335

Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile Ala Lys

340 345 350

Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr Asn Phe

355 360 365

Leu Ile Val Leu Thr Ala Leu Gln Ala Lys Ala Phe Leu Thr Leu Thr

370 375 380

Thr Cys Arg Lys Leu Leu Gly Leu Ala Gly Ile Asp Tyr Thr Ser Ile

385 390 395 400

Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val Asn Ile

405 410 415

Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala Lys Val

420 425 430

Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys Pro Gly

435 440 445

His Ala Leu Val Gly Phe Glu Met Ser Asn Asp Ser Ile Thr Val Leu

450 455 460

Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp Lys Asp

465 470 475 480

Ser Leu Ser Glu Val Ile Tyr Gly Asp Thr Asp Lys Leu Phe Cys Pro

485 490 495

Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe Pro Asn

500 505 510

Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys Thr Leu

515 520 525

Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly Glu Ile

530 535 540

Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr Arg Thr

545 550 555 560

Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val Ile Ser

565 570 575

Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala Asp Glu

580 585 590

Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg Glu Leu

595 600 605

Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile Val Pro

610 615 620

Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Gly Ile Glu Glu

625 630 635 640

Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr Val Asp

645 650 655

His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His Lys Asp

660 665 670

Gly Gly Phe Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys Thr Glu

675 680 685

Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Ala Ser Ile Tyr Leu Lys

690 695 700

Asp Glu Lys Asn Asn Glu Gly Ile Tyr Glu Glu Ile Asn Asn Asp Leu

705 710 715 720

Glu Asp Phe Gln Thr Val Thr Lys Arg Phe Ile Thr Gly Thr Asp Ser

725 730 735

Ser Gly Val His Leu Ile Phe Thr Ser Gln Asn Gly Asp Glu Ala Phe

740 745 750

Gly Gly Asn Phe Ile Ile Ser Glu Ile Arg Ser Ser Glu Glu Leu Leu

755 760 765

Ser Pro Glu Leu Ile Lys Ser Asp Ala Trp Val Gly Ser Gln Gly Thr

770 775 780

Trp Ile Ser Gly Asn Ser Leu Thr Ile Asn Ser Asn Ala Asn Gly Thr

785 790 795 800

Phe Arg Gln Asn Leu Pro Leu Glu Ser Tyr Ser Thr Tyr Ser Met Asn

805 810 815

Phe Asn Val Asn Gly Phe Ala Lys Val Thr Val Arg Asn Ser Arg Glu

820 825 830

Val Leu Phe Glu Lys Asn Phe Ser Gln Leu Ser Pro Lys Asp Tyr Ser

835 840 845

Glu Lys Phe Thr Thr Ala Ala Asn Asn Thr Gly Phe Tyr Val Glu Leu

850 855 860

Ser Arg Gly Thr Gln Gly Gly Asn Ile Thr Phe Arg Asp Phe Ser Ile

865 870 875 880

Lys

<210> 5

<211> 261

<212>DNA

<213> unknown

<220>

<223> Artificial sequence

<400> 5

atgggcatca ccgtgaccaa caacagcagc aacccgatcg aggtggccat caaccactgg 60

ggcagcgacg gcgacaccag cttcttcagc gtgggcaacg gcaagcagga gacctgggac 120

aggagcgaca gcaggggctt cgtgctgagc ctgaagaaga acggcgccca gcacccgtac 180

tacgtgcagg ccagcagcaa gatcgaggtg gacaacaacg ccgtgaagga ccagggcagg 240

ctgatcgagc cgctgagcta g 261

<210> 6

<211> 2364

<212>DNA

<213> unknown

<220>

<223> Artificial sequence

<400> 6

atgaacaaga acaacagtaa gctctccacc cgcgccctcc cgtccttcat cgactacttc 60

aacggcatct acggcttcgc caccggcatc aaggacatca tgaacatgat cttcaagacc 120

gacaccggcg gcaacgtcac cctcgacgag atcctcaaga accagcagct cctcaacgag 180

atcagcggca agctcgacgg cgtgaacggc tccctcaacg agctgatcgc ccaggtcaac 240

ctcaacaccg agctgtccaa ggagatcctc aagatctcca acgagcagaa ccaggtgctc 300

aacgacgtga acaacaagct ggacgccatc aacaccatgc tgcacatcta cctcccgaag 360

atcacctcca tgctctccga cgtgatgaag cagaactacg ccctctccct ccagatcgag 420

tacctctcca agcagctcca ggagatcagc gacaagctcg acatcatcaa cgtgaacgtg 480

ctcatcaact ccaccctcac cgagatcacc ccggcctacc agcgcatcaa gtacgtgaac 540

gagaagttcg aggagctgac cttcgccacc gagaccaccc tcaaggtgaa gaaggactcc 600

tccccggccg acatcctcga cgagctgacc gagctgaccg agctggccaa gtccgtgacc 660

aagaacgacg tggacggctt cgagttctac ctcaacacct tgcacgacgt gatggtgggc 720

aacaacctct tcggccgctc cgccctcaag accgcctccg agctgatcgc caaggagaac 780

gtgaagacct ccggctccga ggtgggcaac gtgtacaact tcctcatcgt gctcaccgcc 840

ctgcaggcca aggccttcct caccctcacc acctgccgca agctcctcgg cctcgccggc 900

atcgactaca cctccatcat gaacgagcac ctcaacaagg agaaggagga gttccgcgtg 960

aacatcctcc cgaccctctc caacaccttc tccaacccga actacgccaa ggtgaagggc 1020

tccgacgagg acgccaagat gatcgtggag gccaagccgg gccacgccct cgtggggcttc 1080

gagatgtcca acgactccat caccgtgctc aaggtgtacg aggccaagct caagcagaac 1140

taccaggtgg acaaggactc cctctccgag gtgatctacg gcgacaccga caagctcttc 1200

tgcccggacc agtccgagca gatatactac accaacaaca tcgtgttccc gaacgagtac 1260

gtgatcacca agatcgactt caccaagaag atgaagaccc tccgctacga ggtgaccgcc 1320

aacttctacg actcctccac cggcgagatc gacctcaaca agaagaaggt gagtcctcc 1380

gaggccgagt accgcaccct ctccgccaac gacgacggcg tgtacatgcc gctcggcgtg 1440

atctccgaaa ccttcctcac cccgatcaac ggcttcggcc tccaggccga cgagaactcc 1500

cgcctcatca ccctcacctg caagtcctac ctccgcgagc tgctcctcgc caccgacctc 1560

tccaacaagg agaccaagct catcgtgccg ccgtccggct tcatctccaa catcgtggag 1620

aacggcggca tcgaggagga caacctcgag ccgtggaagg ccaacaacaa gaacgcctac 1680

gtggaccaca ccggcggcgt gaacggcacc aaggccctct acgtgcacaa ggacggcggc 1740

ttctcccagttcatcggcga caagctcaag ccgaagaccg agtacgtgat ccagtacacc 1800

gtgaagggca aggccagcat ctacctgaag gacgagaaga acaacgaggg catctacgag 1860

gagatcaaca acgacctgga ggacttccag accgtgacca agaggtcat caccggcacc 1920

gacagcagcg gcgtgcacct gatcttcacc agccagaacg gcgacgaggc cttcggcggc 1980

aacttcatca tcagcgagat caggagcagc gaggagctgc tgagcccgga gctgatcaag 2040

agcgacgcct gggtgggcag ccagggcacc tggatcagcg gcaacagcct gaccatcaac 2100

agcaacgcca acggcacctt caggcagaac ctgccgctgg agagctacag cacctacagc 2160

atgaacttca acgtgaacgg cttcgccaag gtgaccgtga ggaacagcag ggaggtgctg 2220

ttcgagaaga acttcagcca gctgagcccg aaggactaca gcgagaagtt caccaccgcc 2280

gccaacaaca ccggcttcta cgtggagctg agcaggggca cccaggggcgg caacatcacc 2340

ttcagggact tcagcatcaa gtaa 2364

<210> 7

<211> 1848

<212>DNA

<213> unknown

<220>

<223> Artificial sequence

<400> 7

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa ctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attackggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacaa acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactag 1848

<210> 8

<211> 208

<212>DNA

<213> unknown

<220>

<223> Artificial sequence

<400> 8

gagctctaga tgggccctgt tctgcacaaa gtggagtagt cagtcatcga tcaggaacca 60

gacaccagac ttttattcat acagtgaagt gaagtgaagt gcagtgcagt gagttgctgg 120

tttttgtaca acttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta 180

attcctaaaa ccaaaatcca ggggtacc 208

<210> 9

<211> 792

<212>DNA

<213> unknown

<220>

<223> Artificial sequence

<400> 9

ggtacctggt ggagcacgac actctcgtct actccaagaa tatcaaagat acagtctcag 60

aagaccaaag ggctattgag acttttcaac aaagggtaat atcgggaaac ctcctcggat 120

tccattgccc agctatctgt cacttcatca aaaggacagt agaaaaggaa ggtggcacct 180

acaaatgcca tcattgcgat aaaggaaagg ctatcgttca agatgcctct gccgacagtg 240

gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 300

cgtcttcaaa gcaagtggat tgatgtgata acatggtgga gcacgacact ctcgtctact 360

ccaagaatat caaagataca gtctcagaag accaaagggc tattgagact tttcaacaaa 420

gggtaatatc gggaaacctc ctcggattcc attgcccagc tatctgtcac ttcatcaaaa 480

ggacagtaga aaaggaaggt ggcacctaca aatgccatca ttgcgataaa ggaaaggcta 540

tcgttcaaga tgcctctgcc gacagtggtc ccaaagatgg accccccaccc acgaggagca 600

tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgatatct 660

ccactgacgt aagggatgac gcacaatccc actatccttc gcaagacctt cctctatata 720

aggaagttca tttcatttgg agaggacacg ctgaaatcac cagtctctct ctacaaatct 780

atctctggat cc 792

Claims (10)

1. An insecticidal fusion protein, characterized in that the insecticidal fusion protein is followed by IPD072 protein and Vip3 protein from N-terminal to C-terminal. 2. The insecticidal fusion protein according to claim 1, wherein the IPD072 protein is one of the IPD072Aa protein, the IPD072Bb protein, the IPD072Ca protein or the IPD072Da protein; the Vip toxin is a Vip3A toxin, a Vip3B toxin, a Vip3C toxin, One of the Vip3D toxin or the Vip3H toxin. 3. The insecticidal fusion protein according to claim 1, characterized in that the insecticidal fusion protein is formed by fusion of IPD072Aa protein and Vip3A toxin. 4. The insecticidal fusion protein according to claim 3, characterized in that the amino acid sequence of the insecticidal fusion protein is shown in SEQ ID NO:2. 5. The insecticidal fusion protein according to claim 1, characterized in that the insecticidal fusion protein is formed by fusion of IPD072Aa protein and Vip3H toxin. 6. The insecticidal fusion protein according to claim 6, characterized in that the amino acid sequence of the insecticidal fusion protein is shown in SEQ ID NO:4. 7. A coding gene for the described insecticidal fusion protein of claim 1, characterized in that the gene from 5'-3' is successively the nucleotide sequence of the coding IPD072 protein and the nucleotide sequence of the coding Vip3 toxin; And the above two nucleotide sequences are located in the same open reading frame. 8. The coding gene according to claim 1, characterized in that the nucleotide sequence of the coding gene is shown in SEQ ID NO: 1 or SEQ ID NO: 3. 9. The application of the insecticidal fusion protein according to claim 1 in the preparation of transgenic insect-resistant crops, transgenic insecticidal microorganisms or antibodies. 10. The application according to claim 9, characterized in that the transgenic insect-resistant crops are prepared by transformation of fusion protein combined with BT crystal toxin.