CN106832001A - A kind of desinsection fusion protein, encoding gene and its application - Google Patents

Abstract

The invention discloses a kind of desinsection fusion protein, the desinsection fusion protein includes IPD072 albumen and Vip3 albumen.IPD072 albumen and a Vip3 toxin fusion designed by the present invention into artificial proteins molecule, compared with original IPD072 albumen and Vip3 albumen, have the following advantages that：Insecticidal spectrum is wide, can simultaneously prevent and treat various important pests (such as beet armyworm, mythimna separata, corn rootworm) in Lepidoptera and coleoptera, and insecticide efficiency is up to 50% 100%；Be conducive to albumen and other insect resistance proteins (such as ICPs) with above-mentioned difference in functionality to be used in combination, further expand insecticidal spectrum, delay pest resistance to produce.

Description

A kind of desinsection fusion protein, encoding gene and its application

(1) technical field

The present invention relates to the application of a kind of desinsection fusion protein, the encoding gene of desinsection fusion, and above-mentioned fusion protein.

(2) background technology

Insect brings huge loss to Global Agriculture production, and current control of insect relies primarily on chemical pesticide, but agriculture The use of medicine has aggravated production cost, and residues of pesticides bring serious harm to health.Therefore, using genetic engineering side Method pest control has great economy, environment and social value.

The key for obtaining insect-resistant transgenic crops is clone's excellent pesticidal protein.Insect-killing protein has a lot, uses Most commonly used is bacillus thuringiensis (Bacillus thuringiensis, abbreviation Bt) secreted one kind during born of the same parents are produced Insecticidal crystal proteins (insecticidalcrystal proteins, ICP), such as Cry1Ab, Cry1C etc., these albumen are to squama The insects such as wing mesh, Diptera, coleoptera (such as diamondback moth, corn borer) have very strong lethal effect (Schnepf, E., Crickmore,N.,Van,R.J.,Lereclus,D.,Baum,J.,&Feitelson,J.,et al.1998,62(3),775- 806.), furtherd investigate and widely used at present, the trans Bt gene crops such as corn and soybean, potato, cotton are advised greatly Mould commercial growth.Thuringiensis can secrete a kind of and ICPs without amino acid sequence homologous during nutrient growth, also The entirely different albumen of property, insecticidal mechanism, i.e. Vegetative Insecticidal Proteins (vegetative insecticidal proteins, VIPs), such as Vip3A, Vip3B, Vip3C, Vip3D, Vip3H, to some, the insect insensitive to ICPs also has insecticidal activity, and And will not occur cross tolerance (Estruch, J.J., Warren, G.W., Mullins, M.A., Nye, G.J., Craig, J.A.,&Koziel,M.G.1996,Proceedings of the National Academy of Sciences of the United States of America,93(11),5389-94.)。

Vip3 albumen as a kind of new insecticidal proteins, to current the most widely used ICP albumen from insecticidal mechanism, Insecticidal spectrum is to being all a supplement well in insecticidal activity.Such as, ICPs is very weak to the lethal effect of prodenia litura and mythimna separata, Vip3 then has extraordinary prevention effect to prodenia litura and mythimna separata.Even so, in the practical operation of genetically modified crops research and development In, however it remains some are badly in need of the technical matters for solving.For example, researcher has found the plant of the single Vip3 genes of expression high Strain growth fraction is slower, albinism easily occurs.This be probably due in genetically modified plants directly expression Vip3 albumen after, should Albumen is assembled because the secretion of signal peptide is a large amount of and combines on plant cell membrane and form duct, so as to be caused to cell Damage, influence it to grow.

Corn is worldwide production highest cereal crops, while being also faced with the threat of many insects.And in these evils In the middle of worm, the chrysomelid name of root firefly especially allows people terrified --- and they are one of most strong Corn Pests of destructive power.Root firefly is chrysomelid Larva invade host rhizome after, can eat tissue, cause root rot, plant lodging so that the plant underproduction or even death.And Adult can also search for food leaf, flower and the seed of host.Before nineteen fifty-five, they are distributed only in a limited number of of U.S. state, But after this, they have invaded this unsuitable northern US that they survive.Nineteen ninety, Eastern Europe is agitated, and this insect is just Serbia is introduced into during this time, then, Continental Europe especially Eastern Europe, also into their domain.And it is near Also have in year and spread to the domestic of China.It is the general designation of Diabroticaspp (Diabrotica sp.) insect that root firefly is chrysomelid.In the U.S., Several fireflies for endangering corn are chrysomelid referred to as corn rootworm (Corn Rootworm), wherein three kinds that endanger maximum are called " western corn rootworm ", " northern com rootworm " and " southern corn rootworm ".Have now been found that with corn rootworm killing effect Albumen be mainly from the Cry albumen and Vip albumen in Dipel.Wherein, mCry3A, Cry3Bb1, eCry3.1Ab Applied in commercialized transgenic strain with protein complexes Cry34Ab1/Cry35Ab1, and generated not With resistance (Lefko S A, Nowatzki T M, Thompson S D, et al.2008, the Journal of of degree Applied Entomology,132(3),189–204；Zhao,J.Z.,Oneal,M.A.,Richtman,N.M., Thompson,S.D.,Cowart,M.C.,&Nelson,M.E.,et al.2016,Journal of Economic Entomology(3)).Also there are some researches show, RNAi technology can be used for the coleopteran pests such as corn rootworm preventing and treating (Baum, J.A.,Bogaert,T.,Clinton,W.,Heck,G.R.,Feldmann,P.,&Ilagan,O.,et al.2007,Nature Biotechnology,25(11),1322-6.).Recently, E.I.Du Pont Company from the pseudomonad (Pseudomonas) clone one Individual gene IPD072Aa have kill corn rootworm effect (Schellenberger, U., Oral, J., Rosen, B.A., Wei,J.Z.,Zhu,G.,&Xie,W.,et al.2016,Science,354(6312),635-637.)。

First generation genetically modified crops mostly only with anti-lepidoptera pest characteristic, and second generation genetically modified crops to The complex character development of anti-various pests simultaneously.Obtaining the genetically modified crops with complex character has various methods, such as pass through Hybridization to the genetically modified crops with single traits；By by multiple gene expression frame constructions inside same expression cassette； By cotransformation, multiple is mixed containing monogenic Agrobacterium, carry out mixing conversion, filter out multiple genes simultaneously whole The transfer-gen plant of two or more plasmid T-DNA is closed.But the above method all also has one in practical operation and application A little problems.Therefore, it is to need to cut instantly to obtain the more simple efficient method for cultivating the genetically modified crops with complex character The real problem for solving.

(3) content of the invention

It is an object of the present invention to provide one kind by Gene Fusion cause same desinsection fusion protein simultaneously to Lepidoptera and The method that coleopteran pest has fragmentation effect.

The technical solution adopted by the present invention is：

The present invention provides a kind of desinsection fusion protein, and the desinsection fusion protein is respectively IPD072 albumen from N-terminal to C-terminal With Vip3 toxin.

Further, the IPD072 albumen be IPD072Aa albumen, IPD072Bb albumen, IPD072Ca albumen or One of IPD072Da albumen；The Vip toxin is Vip3A toxin, Vip3B toxin, Vip3C toxin, Vip3D toxin or Vip3H One kind in toxin.

Further, the desinsection fusion protein is formed by IPD072Aa albumen and Vip3A toxin fusions, and amino acid sequence is SEQ ID NO：Shown in 2.

Further, the desinsection fusion protein is formed by IPD072Aa albumen and Vip3H toxin fusions, and amino acid sequence is SEQ ID NO：Shown in 4.

The present invention also provides a kind of encoding gene of the desinsection fusion protein, and described gene is followed successively by volume from 5 ' -3 ' The nucleotide sequence of code IPD072 albumen and the nucleotide sequence of coding Vip3 toxin；And above-mentioned 2 nucleotide sequences are located at together One open reading inframe.

Further, the gene of described coding IPD072 albumen be IPD072Aa, IPD072Bb, IPD072Ca, One of IPD072Da；The gene of the coding Vip3 toxin is one of Vip3A, Vip3B, Vip3C, Vip3D or Vip3H.It is more excellent Choosing, the nucleotides sequence of the encoding gene is classified as SEQ ID NO：1 or SEQ ID NO：Shown in 3.

The present invention also provides a kind of described desinsection fusion protein in prepare transgenosis anti-pest crop, the micro- life of transgenic insecticidal Application in thing or antibody.

Further, the insect-resistant transgenic crops are prepared from by fusion protein joint BT crystal toxin conversions.

Compared with prior art, beneficial effect of the present invention is mainly reflected in：IPD072 albumen and one designed by the present invention Individual Vip3 toxin fusions into artificial proteins molecule, compared with original IPD072 albumen and Vip3 albumen, with following excellent Point：Insecticidal spectrum is wide, can simultaneously prevent and treat various important pests (such as beet armyworm, mythimna separata, corn rootworm) in Lepidoptera and coleoptera, Insecticide efficiency is up to 50%-100%；Albumen and other insect resistance proteins (such as ICPs) with above-mentioned difference in functionality is conducive to combine Use, further expand insecticidal spectrum, delay pest resistance to produce.

(4) illustrate

Fig. 1 is the structure chart of desinsection fusion protein of the invention, and N-terminal is IPD072 albumen in desinsection fusion protein, and C-terminal is Vip3 toxin.

Fig. 2 is the expression mount structure figure imported in plant desinsection antigen-4 fusion protein gene in the present invention；PUBI is that corn is general Plain promoter, desinsection antigen-4 fusion protein gene is IPD072-Vip3 toxin fusion genes.

Fig. 3 is the expression mount structure figure imported in plant desinsection fusion protein and ICPs joints in the present invention；PUBI is Maize ubiquitin promoter, desinsection antigen-4 fusion protein gene is IPD072-Vip3 toxin fusion genes, and p35S is cauliflower mosaic virus 35S promoter, ICPs is insecticidal crystal proteins encoding gene.

(5) specific embodiment

With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in This：

The structure of embodiment 1, IPD072Aa-Vip3A desinsection fusion protein expression vectors

The gene of IPD072Aa and Vip3A insecticidal proteins synthesizes by Shanghai life work, and its DNA sequence dna is respectively SEQ ID NO：5 and Chinese patent 200610049611.0 in SEQ ID NO：7, and it is cloned in the restricted interior of pET28a expression vectors Between enzyme cutting BamHI and SacI sites.The carrier for building is respectively designated as pET28a-IPD072Aa and pET28a-Vip3A.

IPD072Aa-Vip3A synthesis is comprised the following steps that：

1st, with Vip3A (the SEQ ID NO in Chinese patent 200610049611.0：7) entered PCR as template to obtain Vip3A genetic fragments.Primer is：Vip3A-F：5 ' CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip3A-R：5’CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA.The two primers are respectively comprising restricted interior The site of enzyme cutting site XmalI and ScaI.

2nd, process PCR primer with XmalI and ScaI, and with the pET28a-IPD072Aa carriers crossed with identical ferment treatment Connection.

3rd, Escherichia coli are transferred to, acquisition plasmid is pET28a-IPD072Aa-Vip3A.Antigen-4 fusion protein gene IPD072Aa- Vip3A(SEQ ID NO：1) it has been cloned into pET28a expression vectors, the fusion protein of antigen-4 fusion protein gene coding IPD072Aa-Vip3A(SEQ ID NO：2) molecular weight is about 98kD.

The structure of embodiment 2, IPD072Aa-Vip3H fusion protein expression vectors

The gene of IPD072Aa and Vip3H insecticidal proteins synthesizes by Shanghai life work, and its DNA sequence dna is respectively SEQ ID NO：5 and SEQ ID NO：6, and be cloned between the restriction enzyme BamHI and SacI sites of pET28a expression vectors.Structure The carrier built up is respectively designated as pET28a-IPD072Aa and pET28a-Vip3H.

IPD072Aa-Vip3H synthesis is comprised the following steps that：

4th, with Vip3H (SEQ ID NO：6) enter PCR as template and obtain Vip3A genetic fragments.Primer is：Vip3H- F：5 ' CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip3H-R：5’ CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT.The two primers include restriction endonuclease sites respectively The site of XmalI and ScaI.

5th, process PCR primer with XmalI and ScaI, and with the pET28a-IPD072Aa carriers crossed with identical ferment treatment Connection.

6th, Escherichia coli are transferred to, acquisition plasmid is pET28a-IPD072Aa-Vip3H.Antigen-4 fusion protein gene IPD072Aa- Vip3H(SEQ ID NO：3) it has been cloned into pET28a expression vectors, the fusion protein of antigen-4 fusion protein gene coding IPD072Aa-Vip3H(SEQ ID NO：4) molecular weight is about 98kD.

The expression of embodiment 3, insecticidal proteins

Using universal standard method by it is above-mentioned containing antigen-4 fusion protein gene expression vector (pET28a-IPD072Aa-Vip3A, PET28a-IPD072Aa-Vip3H, pET28a-IPD072Aa, pET28a-Vip3A and pET28a-Vip3H) large intestine is transferred to respectively Bacillus BL21star.Picking monoclonal colony inoculation in 100ml LB inoculums, 37 DEG C of vibrations cultures to OD₆₀₀= 0.6, IPTG to 0.5mM is added, continue to cultivate 4 hours under the same conditions.Collect nutrient solution 5000g and 10 minutes precipitations are centrifuged greatly Coli cell, then abandons supernatant and collects precipitation.Add 30 milliliters of pH7.5,20mM Tris-HCL buffer solutions, ultrasonic powder in precipitation Can be used for the measure of insecticidal activity after broken.

Embodiment 4, IPD072Aa-Vip3A and IPD072Aa-Vip3H have to many Lepidopterous and coleopteran pest and kill Wound is acted on

Insecticidal proteins (IPD072Aa-Vip3A, IPD072Aa-Vip3H, IPD072Aa, Vip3A that embodiment 3 is obtained And Vip3H) surface of insect artificial diet is coated in respectively, newborn first-instar young is used for carrying out pesticidal measure.Negative control is PET28a empty carriers, preparation method is same as Example 3.Insecticidal activity result is as shown in table 1：

The insecticide efficiency of table 1, fusion protein

	Mythimna separata	Beet armyworm	Western corn rootworm
				IPD072Aa	0%	0%	100%
Vip3A	100%	100%	0%
				Vip3H	100%	100%	0%
IPD072Aa-Vip3A	100%	100%	100%
				IPD072Aa-Vip3H	100%	100%	100%
Negative control	0%	0%	0%

Embodiment 5, IPD072Aa-Vip3A plant conversion carriers build

With IPD072Aa-Vip3A (SEQ ID NO：1) IPD072Aa-Vip3A gene pieces are obtained by PCR as template Section.Primer is：IVA-F：5 ' AGGATCCAACAATGGGCATCACCGTGACCAAC and IVA-R：5’ CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTC.The two primers respectively comprising restriction endonuclease sites BamH1 and The site of ScaI.Artificial synthesized terminator sequence ter (SEQ ID NO：8), 5 ' ends and 3 ' ends are respectively arranged with ScaI and KpnI Site.With the IPD072Aa-Vip3A after BamH1 and ScaI digestions and with the terminator after ScaI and KpnI digestions be connected into through In the pCambia1300 carriers of BamH1 and KpnI digestions, pCambia1300-IPD072Aa-Vip3A-ter is obtained.

PUBI is maize ubiquitin protein promoter, is obtained by PCR.With the genomic DNA of commercial corn kind Zheng Dan 958 It is template, is expanded by PCR and obtain pUBI.PCR reaction conditions are：95 DEG C 3 minutes；95 DEG C 15 seconds, 68 DEG C 15 seconds, 72 DEG C 2 points Clock, repeats 32 circulations；Then 72 DEG C 10 minutes.The PCR primer of the about 2.0Kb for obtaining is cloned into T- carriers pMD19. Sequence is obtained correctly to clone for following experiment.PCR primer is pUBI-F (5 ' ) and pUBI-R (5 ' GAAGCTTGCATGCCTACAGTGCAGCGTGACCC GGGTGGATCCTCTAGAGTCGACCTGCAGAAGTAAC), HindIII and BamHI restriction enzymes are respectively provided with primer Enzyme restriction enzyme site.

With HindIII and BamHI digestion pUBI, the fragment after digestion is connected into the pCambia1300- with identical digestion In IPD072Aa-Vip3A-ter carriers, whole carrier is obtained.This carrier is named as：pCambia1300-pUBI-IPD072Aa- Vip3A。

Finally, the method for being turned by electricity is transferred to above-mentioned T-DNA plasmids in Agrobacterium LBA4404, by containing 15 μ g/ml The YEP solid mediums of the kanamycins of tetracycline and 50 μ g/mL filter out positive colony, and protect bacterium, for ensuing plant Thing is converted.

Embodiment 6, IPD072Aa-Vip3H plant conversion carriers build

With IPD072Aa-Vip3H (SEQ ID NO：3) IPD072Aa-Vip3H gene pieces are obtained by PCR as template Section.Primer is：IVH-F：5 ' AGGATCCAACAATGGGCATCACCGTGACCAAC and IVH-R：5’ CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGG.The two primers respectively comprising restriction endonuclease sites BamH1 and The site of ScaI.Artificial synthesized terminator sequence ter (SEQ ID NO：8), 5 ' ends and 3 ' ends are respectively arranged with ScaI and KpnI Site.With the IPD072Aa-Vip3H after BamH1 and ScaI digestions and with the terminator after ScaI and KpnI digestions be connected into through In the pCambia1300 carriers of BamH1 and KpnI digestions, pCambia1300-IPD072Aa-Vip3H-ter is obtained.

PUBI is the preparation method of maize ubiquitin protein promoter with embodiment 5.

With HindIII and BamHI digestion pUBI, the fragment after digestion is connected into the pCambia1300- with identical digestion In IPD072Aa-Vip3H-ter carriers, whole carrier is obtained.This carrier is named as：pCambia1300-pUBI-IPD072Aa- Vip3H。

Finally, the method for being turned by electricity is transferred to above-mentioned T-DNA plasmids in Agrobacterium LBA4404, by containing 15 μ g/ml The YEP solid mediums of the kanamycins of tetracycline and 50 μ g/mL filter out positive colony, and protect bacterium, for ensuing plant Thing is converted.

Embodiment 7, IPD072Aa-Vip3A and ICPs protein plants conversion carrier build

With Cry1Ab (SEQ ID NO：7) gene of insecticidal proteins is synthesized by Shanghai life work, and 5 ' ends and 3 ' ends are respectively provided with There are BamH1 and ScaI sites.Artificial synthesized terminator sequence ter (SEQ ID NO：8), 5 ' end and 3 ' end be respectively provided with ScaI and EcoRI sites.With the Cry1Ab after BamHI and ScaI digestions and with the terminator after ScaI and EcoRI digestions be connected into through In the pCambia1300 carriers of BamH1 and EcoRI digestions, pCambia1300-Cry1Ab-ter is obtained.

P35S promoters are cauliflower mosaic virus CaMV 35S promoters, are synthesized by Shanghai life work, sequence such as SEQ ID NO：9,5 ' ends and 3 ' ends are respectively arranged with KpnI and BamHI sites.

With BamH1 and EcoRI digestion pCambia1300-Cry1Ab-ter, with KpnI and BamHI digestion p35S, above-mentioned Two fragments and through KpnI and EcoRI digestions carrier pCambia1300-IPD072Aa-Vip3A-ter carry out three sections connection, Obtain whole carrier.This carrier is named as：pCambia1300-pUBI-IPD072Aa-Vip3A-p35S-Cry1Ab.

Finally, the method for being turned by electricity is transferred to above-mentioned T-DNA plasmids in Agrobacterium LBA4404, by containing 15 μ g/ml The YEP solid mediums of the kanamycins of tetracycline and 50 μ g/mL filter out positive colony, and protect bacterium, for ensuing plant Thing is converted.

Embodiment 8, IPD072Aa-Vip3H and ICPs protein plants conversion carrier build

With Cry1Ab (SEQ ID NO：7) gene of insecticidal proteins is synthesized by Shanghai life work, and 5 ' ends and 3 ' ends are respectively provided with There are BamH1 and ScaI sites.Artificial synthesized terminator sequence ter (SEQ ID NO：8), 5 ' end and 3 ' end be respectively provided with ScaI and EcoRI sites.With the Cry1Ab after BamHI and ScaI digestions and with the terminator after ScaI and EcoRI digestions be connected into through In the pCambia1300 carriers of BamH1 and EcoRI digestions, pCambia1300-Cry1Ab-ter is obtained.

P35S promoters are cauliflower mosaic virus CaMV 35S promoters, are synthesized by Shanghai life work, sequence such as SEQID NO：9,5 ' ends and 3 ' ends are respectively arranged with KpnI and BamHI sites.

With BamH1 and EcoRI digestion pCambia1300-Cry1Ab-ter, with KpnI and BamHI digestion p35S, above-mentioned Two fragments and through KpnI and EcoRI digestions carrier pCambia1300-IPD072Aa-Vip3H-ter carry out three sections connection, Obtain whole carrier.This carrier is named as：pCambia1300-pUBI-IPD072Aa-Vip3H-p35S-Cry1Ab.

Finally, the method for being turned by electricity is transferred to above-mentioned T-DNA plasmids in Agrobacterium LBA4404, by containing 15 μ g/ml The YEP solid mediums of the kanamycins of tetracycline and 50 μ g/mL filter out positive colony, and protect bacterium, for ensuing plant Thing is converted.

Embodiment 9, transgenic corns

The transformation technology of corn comparative maturity.Bibliography is such as:Vladimir Sidorov&David Duncan (inM.Paul Scott(ed.),Methods in Molecular Biology:Transgenic Maize,vol:526； YujiIshida,YukohHiei&Toshihiko Komari(2007)Agrobacterium-mediated transformation of maize.NatureProtocols2:1614-1622.Basic skills is as follows：

Take the Hi-II corncob of 8-10 days after pollinating, collect all of immature embryo (size is 1.0-1.5mm).Will be real The recombinational agrobacterium obtained containing T-DNA carriers conversion Agrobacterium and immature embryo that are built in example 3 are applied in co-cultivation culture medium Upper (MS+2mg/L 2,4-D+30g/L sucrose+3g/L agar (sigma 7921)+40mg/L acetosyringones) is co-cultured 2-3 days (22℃).Shift immature embryo to (MS+2mg/L 2,4-D+30g/L sucrose+2.5g/L gelrite on calli induction media + 5mg/L AgNO3+200mg/L acetosyringones), 28 DEG C of light cultures 10-14 days.All of callus is gone to sweet with 2mM grass On the screening and culturing medium (identical with calli induction media) of phosphine, 28 DEG C of light cultures 2-3 weeks.The all of tissue of transfer contains to fresh On the screening and culturing medium of 2mM glyphosates, 28 DEG C of light cultures 2-3 weeks.Then, the embryonal connective tissue survived after all screenings is shifted to again On raw culture medium (MS+30g/L sucrose+0.5mg/Lkinetin+2.5g/L gelrite+200mg/L acetosyringones), 28 DEG C Light culture 10-14 days, per one strain of ware.Embryonal connective tissue is shifted to fresh regeneration culture medium, 26 DEG C of illumination cultivation 10-14 My god.Shift all full-grown plants to root media (1/2MS+20g/L sucrose+2.5g/L gelrite+200mg/L Acetosyringone) on, 26 DEG C of illumination cultivations are complete until root development.Obtain the transgenic corn plant containing above-mentioned conversion carrier.

Embodiment 10, transgenic corns can be with desinsection

During the T0 of transgenic corn plant prepared by embodiment 9 is for plantlet of transplant to greenhouse, with commercial varieties " Zheng Dan 958 " female parent, the pollen of " Zheng 58 " (Z58) is pollinated, and harvests T0 for seed.Then by these strains and commercial varieties The female parent of " Zheng Dan 958 ", " Zheng 58 " (Z58) carries out backcross transformation, obtains Z58 near-isogenic lines.Again to these nearly equipotential bases Because the Herbicid resistant for being is compared analysis.

Our 98 transgenic lines for the turning pCambia1300-IPD072Aa-Vip3A-ter carriers (names to obtaining Be IV3A) and 105 transgenic lines for turning pCambia1300-IPD072Aa-Vip3H-ter carriers (being named as IV3H) enter Row insect resistace is determined, and its insecticidal effect effect is as shown in table 2：

Table 2*：

* note：Table 2 is the insecticidal effect detection that different insects are carried out to the maize leaf extract of after planting 30 days.Each Experiment is all at least provided with 3 repetitions.

69 transgenosis for turning pCambia1300-IPD072Aa-Vip3A-p35S-Cry1Ab carriers that we are obtained Strain (being named as IV3A1Ab) and 73 transgenosis for turning pCambia1300-IPD072Aa-Vip3H-p35S-Cry1Ab carriers Strain (being named as IV3H1Ab) carries out insect resistace measure, and its insecticidal effect effect is as shown in table 3：

Table 3*：

Insect	Killing rate
		Corn borer	100%
Bollworm	100%
		Mythimna separata	100%
Beet armyworm	100%
		Western corn rootworm	100%

* note：Table 3 is the insecticidal effect detection that different insects are carried out to the maize leaf extract of after planting 30 days.Each Experiment is all at least provided with 3 repetitions.

Finally, in addition it is also necessary to it is noted that listed above is only specific embodiment of the invention.Obviously, the present invention is not limited In above example, there can also be many deformations.One of ordinary skill in the art can directly lead from present disclosure The all deformations for going out or associating, are considered as protection scope of the present invention.

SEQUENCE LISTING

<110>Zhejiang University

<120>A kind of desinsection fusion protein, encoding gene and its application

<130>

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 2652

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 1

atgggcatca ccgtgaccaa caacagcagc aacccgatcg aggtggccat caaccactgg 60

ggcagcgacg gcgacaccag cttcttcagc gtgggcaacg gcaagcagga gacctgggac 120

aggagcgaca gcaggggctt cgtgctgagc ctgaagaaga acggcgccca gcacccgtac 180

tacgtgcagg ccagcagcaa gatcgaggtg gacaacaacg ccgtgaagga ccagggcagg 240

ctgatcgagc cgctgagccg aggccccggg aagggtggag gaatgaacaa gaacaacacc 300

aagctgagca ccagggccct gccgagcttc atcgactact tcaacggcat ctacggcttc 360

gccaccggca tcaaggacat catgaacatg atcttcaaga ccgacaccgg cggcgacctg 420

accctggacg agatcctgaa gaaccagcag ctgctgaacg acatcagcgg caagctggac 480

ggcgtgaacg gcagcctgaa cgacctgatc gcccagggca acctgaacac cgagctgagc 540

aaggagatcc tgaagatcgc caacgagcag aaccaggtgc tgaacgacgt gaacaacaag 600

ctggacgcca tcaacaccat gctgagggtg tacctgccga agatcaccag catgctgagc 660

gacgtgatga agcagaacta cgccctgagc ctgcagatcg agtacctgag caagcagctg 720

caggagatca gcgacaagct ggacatcatc aacgtgaacg tgctgatcaa cagcaccctg 780

accgagatca ccccggccta ccagaggatc aagtacgtga acgagaagtt cgaggagctg 840

accttcgcca ccgagaccag cagcaaggtg aagaaggacg gcagcccggc cgacatcctg 900

gacgagctga ccgagctgac cggcctggcc aagagcgtgc cgaagaacga cgtggacggc 960

ttcgagttct acctgaacac cttccacgac gtgatggtgg gcaacaacct gttcggcagg 1020

agcgccctga agaccgccag cgagctgatc accaaggaga acgtgaagac cagcggcagc 1080

gaggtgggca acgtgtacaa cagcctgatc gtgctgaccc tgctgcaggc caaggccttc 1140

ctgaccctga ccacctgcag gaagctgctg ggcctggccg acatcgacta caccagcatc 1200

atgaacgagc acctgaacaa ggagaaggag gagttcaggg tgaacatccc gccgaccctg 1260

agcaacacct tcagcaaccc gaactacgcc aaggtgaagg gcagcgacga ggacgccaag 1320

atgatcgtgg aggccaagcc gggccacgcc ctggtgggct tcgagatcag caacgacagc 1380

atcaccgtgc tgaaggtgta cgaggccaag ctgaagcaga actaccaggt ggacaaggac 1440

agcctgagcg aggtgatcta cggcgacatg gacaagctgc tgggcccgga ccagagcggc 1500

ccgatctact acccgaacaa catcgtgttc ccgaacgagt acgtgatcac caagatcgac 1560

ttcaccaaga agatgaagac cctgaggtac gaggtgaccg ccaacttcta cgacagcagc 1620

accggcgaga tcgacctgaa caagaagaag gtggagagca gcgaggccga gtacaggacc 1680

ctgagcgcca acgacgacgg cgtgtacatg ccgctgggcg tgatcagcga gaccttcctg 1740

accccgatca acggcttcgg cctgcaggcc gacgagaaca gcaggctgat caccctgacc 1800

tgcaagagct acctgaggga gctgctgctg gccaccgacc tgagcaacaa ggagaccaag 1860

ctgatcgtgc cgccgagcgg cttcatcaag aacatcgtgg agaacggcag catcgaggag 1920

gacaacctgg agccgtggaa ggccaacaac aagaacgcct acgtggacca caccggcggc 1980

gtgaacggca ccaaggccct gtacgtgcac aaggacggcg gcatcagcca gttcatcggc 2040

gacaagctga agccgaagac cgagtacgtg atccagtaca ccgtgaaggg caagccgagc 2100

atccacctga aggacgagaa caccggctac atccactacg aggacaccaa caacaacctg 2160

gaggactacc agaccatcac caagaggttc accaccggca ccgacctgaa gggcgtgtac 2220

ctgatcctga agagccagaa cggcgacgag gcctggggcg acaacttcat catcctggag 2280

atcagcccga gcgagaagct gctgagcccg gagctgatca acaccaacaa ctggaccagc 2340

accggcagca ccaacatcag cggcaacacc ctgaccctgt accagggcgg caggggcatc 2400

ctgaagcaga acctgcagct ggacagcttc agcacctaca gggtgtactt cagcgtgagc 2460

ggcgacgcca acgtgaggat caggaacagc agggaggtgc tgttcgagaa gaggtacatg 2520

agcggcgcca aggacgtgag cgagatcttc accaccaagc tgggcaagga caacttctac 2580

atcgagctga gccagggcaa caacctgaac ggcggcccga tcgtgaagtt ctacgacgtg 2640

agcatcaagt ag 2652

<210> 2

<211> 883

<212> PRT

<213> unknown

<220>

<223>Artificial sequence

<400> 2

Met Gly Ile Thr Val Thr Asn Asn Ser Ser Asn Pro Ile Glu Val Ala

1 5 10 15

Ile Asn His Trp Gly Ser Asp Gly Asp Thr Ser Phe Phe Ser Val Gly

20 25 30

Asn Gly Lys Gln Glu Thr Trp Asp Arg Ser Asp Ser Arg Gly Phe Val

35 40 45

Leu Ser Leu Lys Lys Asn Gly Ala Gln His Pro Tyr Tyr Val Gln Ala

50 55 60

Ser Ser Lys Ile Glu Val Asp Asn Asn Ala Val Lys Asp Gln Gly Arg

65 70 75 80

Leu Ile Glu Pro Leu Ser Arg Gly Pro Gly Lys Gly Gly Gly Met Asn

85 90 95

Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe Ile Asp

100 105 110

Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp Ile Met

115 120 125

Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu Asp Glu

130 135 140

Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys Leu Asp

145 150 155 160

Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn Leu Asn

165 170 175

Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln Asn Gln

180 185 190

Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr Met Leu

195 200 205

Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val Met Lys

210 215 220

Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys Gln Leu

225 230 235 240

Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val Leu Ile

245 250 255

Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile Lys Tyr

260 265 270

Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr Ser Ser

275 280 285

Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu Leu Thr

290 295 300

Glu Leu Thr Gly Leu Ala Lys Ser Val Pro Lys Asn Asp Val Asp Gly

305 310 315 320

Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly Asn Asn

325 330 335

Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile Thr Lys

340 345 350

Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr Asn Ser

355 360 365

Leu Ile Val Leu Thr Leu Leu Gln Ala Lys Ala Phe Leu Thr Leu Thr

370 375 380

Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr Ser Ile

385 390 395 400

Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val Asn Ile

405 410 415

Pro Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala Lys Val

420 425 430

Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys Pro Gly

435 440 445

His Ala Leu Val Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr Val Leu

450 455 460

Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp Lys Asp

465 470 475 480

Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu Gly Pro

485 490 495

Asp Gln Ser Gly Pro Ile Tyr Tyr Pro Asn Asn Ile Val Phe Pro Asn

500 505 510

Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys Thr Leu

515 520 525

Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly Glu Ile

530 535 540

Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr Arg Thr

545 550 555 560

Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val Ile Ser

565 570 575

Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala Asp Glu

580 585 590

Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg Glu Leu

595 600 605

Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile Val Pro

610 615 620

Pro Ser Gly Phe Ile Lys Asn Ile Val Glu Asn Gly Ser Ile Glu Glu

625 630 635 640

Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr Val Asp

645 650 655

His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His Lys Asp

660 665 670

Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys Thr Glu

675 680 685

Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His Leu Lys

690 695 700

Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn Asn Leu

705 710 715 720

Glu Asp Tyr Gln Thr Ile Thr Lys Arg Phe Thr Thr Gly Thr Asp Leu

725 730 735

Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu Ala Trp

740 745 750

Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys Leu Leu

755 760 765

Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly Ser Thr

770 775 780

Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg Gly Ile

785 790 795 800

Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg Val Tyr

805 810 815

Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser Arg Glu

820 825 830

Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val Ser Glu

835 840 845

Ile Phe Thr Thr Lys Leu Gly Lys Asp Asn Phe Tyr Ile Glu Leu Ser

850 855 860

Gln Gly Asn Asn Leu Asn Gly Gly Pro Ile Val Lys Phe Tyr Asp Val

865 870 875 880

Ser Ile Lys

<210> 3

<211> 2646

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 3

atgggcatca ccgtgaccaa caacagcagc aacccgatcg aggtggccat caaccactgg 60

ggcagcgacg gcgacaccag cttcttcagc gtgggcaacg gcaagcagga gacctgggac 120

aggagcgaca gcaggggctt cgtgctgagc ctgaagaaga acggcgccca gcacccgtac 180

tacgtgcagg ccagcagcaa gatcgaggtg gacaacaacg ccgtgaagga ccagggcagg 240

ctgatcgagc cgctgagccg aggccccggg aagggtggag gaatgaacaa gaacaacagt 300

aagctctcca cccgcgccct cccgtccttc atcgactact tcaacggcat ctacggcttc 360

gccaccggca tcaaggacat catgaacatg atcttcaaga ccgacaccgg cggcaacgtc 420

accctcgacg agatcctcaa gaaccagcag ctcctcaacg agatcagcgg caagctcgac 480

ggcgtgaacg gctccctcaa cgagctgatc gcccaggtca acctcaacac cgagctgtcc 540

aaggagatcc tcaagatctc caacgagcag aaccaggtgc tcaacgacgt gaacaacaag 600

ctggacgcca tcaacaccat gctgcacatc tacctcccga agatcacctc catgctctcc 660

gacgtgatga agcagaacta cgccctctcc ctccagatcg agtacctctc caagcagctc 720

caggagatca gcgacaagct cgacatcatc aacgtgaacg tgctcatcaa ctccaccctc 780

accgagatca ccccggccta ccagcgcatc aagtacgtga acgagaagtt cgaggagctg 840

accttcgcca ccgagaccac cctcaaggtg aagaaggact cctccccggc cgacatcctc 900

gacgagctga ccgagctgac cgagctggcc aagtccgtga ccaagaacga cgtggacggc 960

ttcgagttct acctcaacac cttgcacgac gtgatggtgg gcaacaacct cttcggccgc 1020

tccgccctca agaccgcctc cgagctgatc gccaaggaga acgtgaagac ctccggctcc 1080

gaggtgggca acgtgtacaa cttcctcatc gtgctcaccg ccctgcaggc caaggccttc 1140

ctcaccctca ccacctgccg caagctcctc ggcctcgccg gcatcgacta cacctccatc 1200

atgaacgagc acctcaacaa ggagaaggag gagttccgcg tgaacatcct cccgaccctc 1260

tccaacacct tctccaaccc gaactacgcc aaggtgaagg gctccgacga ggacgccaag 1320

atgatcgtgg aggccaagcc gggccacgcc ctcgtgggct tcgagatgtc caacgactcc 1380

atcaccgtgc tcaaggtgta cgaggccaag ctcaagcaga actaccaggt ggacaaggac 1440

tccctctccg aggtgatcta cggcgacacc gacaagctct tctgcccgga ccagtccgag 1500

cagatatact acaccaacaa catcgtgttc ccgaacgagt acgtgatcac caagatcgac 1560

ttcaccaaga agatgaagac cctccgctac gaggtgaccg ccaacttcta cgactcctcc 1620

accggcgaga tcgacctcaa caagaagaag gtggagtcct ccgaggccga gtaccgcacc 1680

ctctccgcca acgacgacgg cgtgtacatg ccgctcggcg tgatctccga aaccttcctc 1740

accccgatca acggcttcgg cctccaggcc gacgagaact cccgcctcat caccctcacc 1800

tgcaagtcct acctccgcga gctgctcctc gccaccgacc tctccaacaa ggagaccaag 1860

ctcatcgtgc cgccgtccgg cttcatctcc aacatcgtgg agaacggcgg catcgaggag 1920

gacaacctcg agccgtggaa ggccaacaac aagaacgcct acgtggacca caccggcggc 1980

gtgaacggca ccaaggccct ctacgtgcac aaggacggcg gcttctccca gttcatcggc 2040

gacaagctca agccgaagac cgagtacgtg atccagtaca ccgtgaaggg caaggccagc 2100

atctacctga aggacgagaa gaacaacgag ggcatctacg aggagatcaa caacgacctg 2160

gaggacttcc agaccgtgac caagaggttc atcaccggca ccgacagcag cggcgtgcac 2220

ctgatcttca ccagccagaa cggcgacgag gccttcggcg gcaacttcat catcagcgag 2280

atcaggagca gcgaggagct gctgagcccg gagctgatca agagcgacgc ctgggtgggc 2340

agccagggca cctggatcag cggcaacagc ctgaccatca acagcaacgc caacggcacc 2400

ttcaggcaga acctgccgct ggagagctac agcacctaca gcatgaactt caacgtgaac 2460

ggcttcgcca aggtgaccgt gaggaacagc agggaggtgc tgttcgagaa gaacttcagc 2520

cagctgagcc cgaaggacta cagcgagaag ttcaccaccg ccgccaacaa caccggcttc 2580

tacgtggagc tgagcagggg cacccagggc ggcaacatca ccttcaggga cttcagcatc 2640

aagtag 2646

<210> 4

<211> 881

<212> PRT

<213> unknown

<220>

<223>Artificial sequence

<400> 4

Met Gly Ile Thr Val Thr Asn Asn Ser Ser Asn Pro Ile Glu Val Ala

1 5 10 15

Ile Asn His Trp Gly Ser Asp Gly Asp Thr Ser Phe Phe Ser Val Gly

20 25 30

Asn Gly Lys Gln Glu Thr Trp Asp Arg Ser Asp Ser Arg Gly Phe Val

35 40 45

Leu Ser Leu Lys Lys Asn Gly Ala Gln His Pro Tyr Tyr Val Gln Ala

50 55 60

Ser Ser Lys Ile Glu Val Asp Asn Asn Ala Val Lys Asp Gln Gly Arg

65 70 75 80

Leu Ile Glu Pro Leu Ser Arg Gly Pro Gly Lys Gly Gly Gly Met Asn

85 90 95

Lys Asn Asn Ser Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe Ile Asp

100 105 110

Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp Ile Met

115 120 125

Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asn Val Thr Leu Asp Glu

130 135 140

Ile Leu Lys Asn Gln Gln Leu Leu Asn Glu Ile Ser Gly Lys Leu Asp

145 150 155 160

Gly Val Asn Gly Ser Leu Asn Glu Leu Ile Ala Gln Val Asn Leu Asn

165 170 175

Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ser Asn Glu Gln Asn Gln

180 185 190

Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr Met Leu

195 200 205

His Ile Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val Met Lys

210 215 220

Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys Gln Leu

225 230 235 240

Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val Leu Ile

245 250 255

Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile Lys Tyr

260 265 270

Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr Thr Leu

275 280 285

Lys Val Lys Lys Asp Ser Ser Pro Ala Asp Ile Leu Asp Glu Leu Thr

290 295 300

Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val Asp Gly

305 310 315 320

Phe Glu Phe Tyr Leu Asn Thr Leu His Asp Val Met Val Gly Asn Asn

325 330 335

Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile Ala Lys

340 345 350

Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr Asn Phe

355 360 365

Leu Ile Val Leu Thr Ala Leu Gln Ala Lys Ala Phe Leu Thr Leu Thr

370 375 380

Thr Cys Arg Lys Leu Leu Gly Leu Ala Gly Ile Asp Tyr Thr Ser Ile

385 390 395 400

Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val Asn Ile

405 410 415

Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala Lys Val

420 425 430

Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys Pro Gly

435 440 445

His Ala Leu Val Gly Phe Glu Met Ser Asn Asp Ser Ile Thr Val Leu

450 455 460

Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp Lys Asp

465 470 475 480

Ser Leu Ser Glu Val Ile Tyr Gly Asp Thr Asp Lys Leu Phe Cys Pro

485 490 495

Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe Pro Asn

500 505 510

Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys Thr Leu

515 520 525

Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly Glu Ile

530 535 540

Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr Arg Thr

545 550 555 560

Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val Ile Ser

565 570 575

Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala Asp Glu

580 585 590

Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg Glu Leu

595 600 605

Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile Val Pro

610 615 620

Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Gly Ile Glu Glu

625 630 635 640

Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr Val Asp

645 650 655

His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His Lys Asp

660 665 670

Gly Gly Phe Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys Thr Glu

675 680 685

Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Ala Ser Ile Tyr Leu Lys

690 695 700

Asp Glu Lys Asn Asn Glu Gly Ile Tyr Glu Glu Ile Asn Asn Asp Leu

705 710 715 720

Glu Asp Phe Gln Thr Val Thr Lys Arg Phe Ile Thr Gly Thr Asp Ser

725 730 735

Ser Gly Val His Leu Ile Phe Thr Ser Gln Asn Gly Asp Glu Ala Phe

740 745 750

Gly Gly Asn Phe Ile Ile Ser Glu Ile Arg Ser Ser Glu Glu Leu Leu

755 760 765

Ser Pro Glu Leu Ile Lys Ser Asp Ala Trp Val Gly Ser Gln Gly Thr

770 775 780

Trp Ile Ser Gly Asn Ser Leu Thr Ile Asn Ser Asn Ala Asn Gly Thr

785 790 795 800

Phe Arg Gln Asn Leu Pro Leu Glu Ser Tyr Ser Thr Tyr Ser Met Asn

805 810 815

Phe Asn Val Asn Gly Phe Ala Lys Val Thr Val Arg Asn Ser Arg Glu

820 825 830

Val Leu Phe Glu Lys Asn Phe Ser Gln Leu Ser Pro Lys Asp Tyr Ser

835 840 845

Glu Lys Phe Thr Thr Ala Ala Asn Asn Thr Gly Phe Tyr Val Glu Leu

850 855 860

Ser Arg Gly Thr Gln Gly Gly Asn Ile Thr Phe Arg Asp Phe Ser Ile

865 870 875 880

Lys

<210> 5

<211> 261

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 5

atgggcatca ccgtgaccaa caacagcagc aacccgatcg aggtggccat caaccactgg 60

ggcagcgacg gcgacaccag cttcttcagc gtgggcaacg gcaagcagga gacctgggac 120

aggagcgaca gcaggggctt cgtgctgagc ctgaagaaga acggcgccca gcacccgtac 180

tacgtgcagg ccagcagcaa gatcgaggtg gacaacaacg ccgtgaagga ccagggcagg 240

ctgatcgagc cgctgagcta g 261

<210> 6

<211> 2364

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 6

atgaacaaga acaacagtaa gctctccacc cgcgccctcc cgtccttcat cgactacttc 60

aacggcatct acggcttcgc caccggcatc aaggacatca tgaacatgat cttcaagacc 120

gacaccggcg gcaacgtcac cctcgacgag atcctcaaga accagcagct cctcaacgag 180

atcagcggca agctcgacgg cgtgaacggc tccctcaacg agctgatcgc ccaggtcaac 240

ctcaacaccg agctgtccaa ggagatcctc aagatctcca acgagcagaa ccaggtgctc 300

aacgacgtga acaacaagct ggacgccatc aacaccatgc tgcacatcta cctcccgaag 360

atcacctcca tgctctccga cgtgatgaag cagaactacg ccctctccct ccagatcgag 420

tacctctcca agcagctcca ggagatcagc gacaagctcg acatcatcaa cgtgaacgtg 480

ctcatcaact ccaccctcac cgagatcacc ccggcctacc agcgcatcaa gtacgtgaac 540

gagaagttcg aggagctgac cttcgccacc gagaccaccc tcaaggtgaa gaaggactcc 600

tccccggccg acatcctcga cgagctgacc gagctgaccg agctggccaa gtccgtgacc 660

aagaacgacg tggacggctt cgagttctac ctcaacacct tgcacgacgt gatggtgggc 720

aacaacctct tcggccgctc cgccctcaag accgcctccg agctgatcgc caaggagaac 780

gtgaagacct ccggctccga ggtgggcaac gtgtacaact tcctcatcgt gctcaccgcc 840

ctgcaggcca aggccttcct caccctcacc acctgccgca agctcctcgg cctcgccggc 900

atcgactaca cctccatcat gaacgagcac ctcaacaagg agaaggagga gttccgcgtg 960

aacatcctcc cgaccctctc caacaccttc tccaacccga actacgccaa ggtgaagggc 1020

tccgacgagg acgccaagat gatcgtggag gccaagccgg gccacgccct cgtgggcttc 1080

gagatgtcca acgactccat caccgtgctc aaggtgtacg aggccaagct caagcagaac 1140

taccaggtgg acaaggactc cctctccgag gtgatctacg gcgacaccga caagctcttc 1200

tgcccggacc agtccgagca gatatactac accaacaaca tcgtgttccc gaacgagtac 1260

gtgatcacca agatcgactt caccaagaag atgaagaccc tccgctacga ggtgaccgcc 1320

aacttctacg actcctccac cggcgagatc gacctcaaca agaagaaggt ggagtcctcc 1380

gaggccgagt accgcaccct ctccgccaac gacgacggcg tgtacatgcc gctcggcgtg 1440

atctccgaaa ccttcctcac cccgatcaac ggcttcggcc tccaggccga cgagaactcc 1500

cgcctcatca ccctcacctg caagtcctac ctccgcgagc tgctcctcgc caccgacctc 1560

tccaacaagg agaccaagct catcgtgccg ccgtccggct tcatctccaa catcgtggag 1620

aacggcggca tcgaggagga caacctcgag ccgtggaagg ccaacaacaa gaacgcctac 1680

gtggaccaca ccggcggcgt gaacggcacc aaggccctct acgtgcacaa ggacggcggc 1740

ttctcccagt tcatcggcga caagctcaag ccgaagaccg agtacgtgat ccagtacacc 1800

gtgaagggca aggccagcat ctacctgaag gacgagaaga acaacgaggg catctacgag 1860

gagatcaaca acgacctgga ggacttccag accgtgacca agaggttcat caccggcacc 1920

gacagcagcg gcgtgcacct gatcttcacc agccagaacg gcgacgaggc cttcggcggc 1980

aacttcatca tcagcgagat caggagcagc gaggagctgc tgagcccgga gctgatcaag 2040

agcgacgcct gggtgggcag ccagggcacc tggatcagcg gcaacagcct gaccatcaac 2100

agcaacgcca acggcacctt caggcagaac ctgccgctgg agagctacag cacctacagc 2160

atgaacttca acgtgaacgg cttcgccaag gtgaccgtga ggaacagcag ggaggtgctg 2220

ttcgagaaga acttcagcca gctgagcccg aaggactaca gcgagaagtt caccaccgcc 2280

gccaacaaca ccggcttcta cgtggagctg agcaggggca cccagggcgg caacatcacc 2340

ttcagggact tcagcatcaa gtaa 2364

<210> 7

<211> 1848

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 7

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacaa acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactag 1848

<210> 8

<211> 208

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 8

gagctctaga tgggccctgt tctgcacaaa gtggagtagt cagtcatcga tcaggaacca 60

gacaccagac ttttattcat acagtgaagt gaagtgaagt gcagtgcagt gagttgctgg 120

tttttgtaca acttagtatg tatttgtatt tgtaaaatac ttctatcaat aaaatttcta 180

attcctaaaa ccaaaatcca ggggtacc 208

<210> 9

<211> 792

<212> DNA

<213> unknown

<220>

<223>Artificial sequence

<400> 9

ggtacctggt ggagcacgac actctcgtct actccaagaa tatcaaagat acagtctcag 60

aagaccaaag ggctattgag acttttcaac aaagggtaat atcgggaaac ctcctcggat 120

tccattgccc agctatctgt cacttcatca aaaggacagt agaaaaggaa ggtggcacct 180

acaaatgcca tcattgcgat aaaggaaagg ctatcgttca agatgcctct gccgacagtg 240

gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 300

cgtcttcaaa gcaagtggat tgatgtgata acatggtgga gcacgacact ctcgtctact 360

ccaagaatat caaagataca gtctcagaag accaaagggc tattgagact tttcaacaaa 420

gggtaatatc gggaaacctc ctcggattcc attgcccagc tatctgtcac ttcatcaaaa 480

ggacagtaga aaaggaaggt ggcacctaca aatgccatca ttgcgataaa ggaaaggcta 540

tcgttcaaga tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca 600

tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgatatct 660

ccactgacgt aagggatgac gcacaatccc actatccttc gcaagacctt cctctatata 720

aggaagttca tttcatttgg agaggacacg ctgaaatcac cagtctctct ctacaaatct 780

atctctggat cc 792

Claims (10)

1. a kind of desinsection fusion protein, it is characterised in that the desinsection fusion protein be followed successively by from N-terminal to C-terminal IPD072 albumen and Vip3 albumen.

2. desinsection fusion protein as claimed in claim 1, it is characterised in that the IPD072 albumen be IPD072Aa albumen, One of IPD072Bb albumen, IPD072Ca albumen or IPD072Da albumen；The Vip toxin be Vip3A toxin, Vip3B toxin, One of Vip3C toxin, Vip3D toxin or Vip3H toxin.

3. desinsection fusion protein as claimed in claim 1, it is characterised in that the desinsection fusion protein is by IPD072Aa albumen Formed with Vip3A toxin fusions.

4. desinsection fusion protein as claimed in claim 3, it is characterised in that the desinsection fusion protein amino acid sequence is SEQ ID NO：Shown in 2.

5. desinsection fusion protein as claimed in claim 1, it is characterised in that the desinsection fusion protein is by IPD072Aa albumen Formed with Vip3H toxin fusions.

6. desinsection fusion protein as claimed in claim 6, it is characterised in that the desinsection fusion protein amino acid sequence is SEQ ID NO：Shown in 4.

7. the encoding gene of desinsection fusion protein described in a kind of claim 1, it is characterised in that described gene from 5 ' -3 ' successively To encode the nucleotide sequence of IPD072 albumen and the nucleotide sequence of coding Vip3 toxin；And above-mentioned 2 nucleotide sequences position In same open reading inframe.

8. encoding gene as claimed in claim 1, it is characterised in that the nucleotides sequence of the encoding gene is classified as SEQ ID NO：1 or SEQ ID NO：Shown in 3.

9. the desinsection fusion protein described in a kind of claim 1 prepare transgenosis anti-pest crop, transgenic insecticidal microorganism or Application in antibody.

10. application as claimed in claim 9, it is characterised in that the insect-resistant transgenic crops are brilliant by fusion protein joint BT The conversion of body toxin is prepared from.