CN106811476B

CN106811476B - A kind of complete carrier and its application for the expression of multielement protein compound

Info

Publication number: CN106811476B
Application number: CN201510847331.3A
Authority: CN
Inventors: 戴俊彪; 陈柱成; 吴庆余; 秦怡然; 林继伟
Original assignee: Wuxi Qinglan Biological Science & Technology Co Ltd; Tsinghua University
Current assignee: Wuxi Qinglan Biological Science & Technology Co Ltd; Tsinghua University
Priority date: 2015-11-27
Filing date: 2015-11-27
Publication date: 2019-09-27
Anticipated expiration: 2035-11-27
Also published as: CN106811476A

Abstract

The invention discloses a kind of complete carrier for the expression of multielement protein compound and its applications.The complete carrier is divided into single-gene expression vector and coexpression received vector two parts, albumen composition each component can be cloned into parallel in different single-gene expression vectors, then single-gene expression vector and coexpression vector are subjected in same pipe a group reaction cartridge, albumen composition coexpression vector can be obtained.Proved by test: the present invention passes through the design of IIs type restriction enzyme, it can make digestion and be connected in same pipe to carry out, centre does not need the manipulations such as digestion products purifying, simultaneously, the transcriptional units of multiple albumen can once be tested while are assembled on coexpression vector by design of the invention, therefore the assembling of coexpression vector highly shortened clone-time, and different resistances and ccdB are screened, improve the efficiency of clone, in addition, coexpression vector transcribes out monocistronic mRNA, and expressing quantity can be improved.

Description

A kind of complete carrier and its application for the expression of multielement protein compound

Technical field

The invention belongs to field of biotechnology, and in particular to it is a kind of for multielement protein compound expression complete carrier and It is applied.

Background technique

Compared to single protein component, scientists sight has gradually been transferred to structure and function be more difficult research but On even more important multielement protein compound.Multielement protein compound is all important controlling element in many bioprocess, In addition to this, some albumen are only used as the group timesharing of compound just active.Therefore, if compound can be directly researched Structure and function, then many biological questions can be explained more intuitively.

Expression and purifying protein complex are the necessary links of structural research.Escherichia coli are still most common table so far Up to the host of recombinant protein.Firstly, using Escherichia coli a large amount of egg can be obtained with very short time and seldom cost It is white；Second, either in terms of gene cloning or protein purification, coli expression system is all highly developed, is convenient for Carry out the selection and detection of a variety of conditions；Third, as prokaryotes, Escherichia coli lack some posttranslational modifications, this is sometimes It is more advantageous to research.Obtaining albumen composition currently with coli expression system has following several approach: first, by albumen Compound each component is individually purified (purifying of some components may further relate to denaturation and renaturation process), and recombination is multiple in vitro Close object；Second, compound is co-expressed in vivo.In the first method, certain component can when single expression in compound Can be insoluble, while assembled in vitro may also form the compound of mistake.However, if compound to be realized to table altogether in vivo It reaches, correct interaction between the correct folding and compound each component of each albumen can be conducive to, more likely formed solvable Compound.In conclusion coexpression system has big advantage during studying albumen composition in Escherichia coli body.

Coexpression can be realized by single or multiple carriers.In single-gene vectors coexpression method, each carrier is taken One gene of band.When using multiple carriers, each carrier is required with different selected markers, compatible replicon With similar copy number.However, the label of Escherichia coli is usually antibiotic, in culture, addition Multiple Classes of Antibiotics be will affect carefully The growth rate of bacterium.And above-mentioned strict requirements are also that selection multichip carrier increases difficulty.Compared to single-gene vectors, more bases Because carrier can will co-express in several gene clonings to single carrier.Under normal conditions, this carrier needs more complicated Multiple cloning sites realize the clone of each step using different groups of restriction enzymes.In terms of the transcription of gene, several genes can To be located under the same promoter, obtained mRNA is polycistron；If each individual promoter control of gene, Obtained mRNA is monocistron.Some researchs report, it is inconsistent that polycistron expression vector will lead to different expressing quantities, Expressing quantity close to promoter is higher than downstream albumen, will affect must measuring for compound different component in this way.

In monocistron expression vector, each albumen is controlled by individual promoter, can control expression, from And obtain the higher albumen of expression quantity.This kind of carrier has: the pETDuet of Novagen series, pET-MCP series and PQLink series etc..These expression vectors need a variety of restriction endonuclease sites, increase difficulty for clone.In addition, at present These carriers are essentially all in series successively to be connected into each albumen one by one, therefore with number of components required in compound Purpose increases, and the building time of coexpression vector needs continuous extend.So construct one kind can by each component in compound into Row the splice, coexpression vector with multiple transcriptional units in parallel is current urgent need.

Summary of the invention

It is an object of the present invention to provide a kind of complete sets of products for the expression of multielement protein compound.

Provided by the present invention for multielement protein compound expression complete sets of products by m core fragment and coexpression vector Composition；

The m is the integer more than or equal to 1；The m core fragment is sequentially named as core sheet according to Arabic numerals Section A1, core fragment A2 ... and core fragment Am；

The core fragment A1 successively includes the identification sequence of IIs type restriction enzyme 1 from 5 ' ends, single base N, glues Property end 1x, the DNA fragmentation for constructing exogenous gene expression box and cohesive end 1y, single base N and the IIs type are restricted The identification sequence of restriction endonuclease 1；

The core fragment A2 successively includes the identification sequence of IIs type restriction enzyme 1 from 5 ' ends, single base N, glues Property end 2x, the DNA fragmentation for constructing exogenous gene expression box and cohesive end 2y, single base N and the IIs type are restricted The identification sequence of restriction endonuclease 1；

And so on,

Successively the identification sequence including IIs type restriction enzyme 1, single base N are viscous from 5 ' ends by the core fragment Am Property end mx, the DNA fragmentation for constructing exogenous gene expression box, cohesive end my, single base N and the IIs type are restricted The identification sequence of restriction endonuclease 1；

Each core fragment is used to construct foreign gene by what 1 digestion of IIs type restriction enzyme generated The DNA fragmentation upstream cohesive terminus,cohesive termini of expression cassette and the DNA fragmentation downstream cohesive terminus,cohesive termini for being used to construct exogenous gene expression box Different and mismatch；

The coexpression vector is made of core fragment A and skeleton carrier；

The core fragment A of the coexpression vector successively includes cohesive end Ax, single base N, the IIs type from 5 ' ends Identification sequence, riddled basins, the identification sequence of the IIs type restriction enzyme 1, single base N of restriction enzyme 1 With cohesive end Ay；

The skeleton carrier upstream stickiness end that the coexpression vector is generated by 1 digestion of IIs type restriction enzyme It holds different with skeleton carrier downstream cohesive terminus,cohesive termini and mismatches；

The core fragment A1 passes through the cohesive end 1y and the core that 1 digestion of IIs type restriction enzyme generates The cohesive end 2x matching that lamination section A2 is generated by 1 digestion of IIs type restriction enzyme；

The core fragment A2 passes through the cohesive end 2y and the core that 1 digestion of IIs type restriction enzyme generates The cohesive end 3x matching that lamination section A3 is generated by 1 digestion of IIs type restriction enzyme；

And so on；

The core fragment A m-1 by 1 digestion of IIs type restriction enzyme generate cohesive end (m-1) y and The cohesive end mx matching that the core fragment A m is generated by 1 digestion of IIs type restriction enzyme；

The coexpression vector passes through the cohesive end Ax and the core that 1 digestion of IIs type restriction enzyme generates The cohesive end 1x matching that lamination section A1 is generated by 1 digestion of IIs type restriction enzyme；

The coexpression vector passes through the cohesive end Ay and the core that 1 digestion of IIs type restriction enzyme generates The cohesive end my matching that lamination section A m is generated by 1 digestion of IIs type restriction enzyme.

In above-mentioned complete sets of products, the DNA fragmentation for constructing exogenous gene expression box successively includes driving from 5 ' ends In cohesive end, single base N, the IIs type that the promoter of dynamic exogenous gene expression, IIs type restriction enzyme 2 generate are restricted Identification sequence, riddled basins, the identification sequence of the restriction enzyme 2, single base N, the IIs type of enzyme cutting 2 are restricted The terminator of cohesive end and the termination exogenous gene expression that restriction endonuclease 2 generates；

Or, the DNA fragmentation for constructing exogenous gene expression box successively includes driving foreign gene table from 5 ' ends Promoter, ribosome bind site, the cohesive end of the generation of IIs type restriction enzyme 2, single base N, the IIs type reached limits Property the identification sequence of restriction endonuclease 2, riddled basins, the identification sequence of the restriction enzyme 2, single base N, IIs type limit The terminator of cohesive end and the termination exogenous gene expression that property restriction endonuclease 2 processed generates；

Or, the DNA fragmentation for constructing exogenous gene expression box successively includes driving foreign gene table from 5 ' ends Cohesive end that the promoter that reaches, lactose operon, ribosome bind site, IIs type restriction enzyme 2 generate, single base N, the identification sequence of IIs type restriction enzyme 2, riddled basins, the identification sequence of the restriction enzyme 2, single alkali The terminator of cohesive end and the termination exogenous gene expression that base N, IIs type restriction enzyme 2 generates；

Or, the DNA fragmentation for constructing exogenous gene expression box successively includes driving foreign gene table from 5 ' ends The promoter that reaches, lactose operon, ribosome bind site, protein purification label, IIs type restriction enzyme 2 generate viscous Property end, the identification sequence of single base N, IIs type restriction enzyme 2, riddled basins, the restriction enzyme 2 Identify the cohesive end and the termination for terminating the exogenous gene expression that sequence, single base N, IIs type restriction enzyme 2 generate Son.

In above-mentioned complete sets of products, each core fragment passes through the sieve that 2 digestion of IIs type restriction enzyme generates It selects marker gene upstream cohesive terminus,cohesive termini different with riddled basins downstream cohesive terminus,cohesive termini and mismatches；

Palindrome cannot be formed inside the cohesive end that each IIs type digestion with restriction enzyme generates；

For the core fragment in addition to the position of description, other parts are free of the identification sequence of the IIs type restriction enzyme 2 Column；

For the coexpression vector in addition to the position of description, other parts are free of the identification of the IIs type restriction enzyme 1 Sequence；

The single base N is any one in A, G, C and T.

In above-mentioned complete sets of products, the IIs type restriction enzyme 1 is BsmBI；

The IIs type restriction enzyme 2 is BsaI；

The riddled basins are ccdB gene.

In above-mentioned complete sets of products,

The identification sequence of the IIs type restriction enzyme 1 is as shown in sequence 1 in sequence table；

The identification sequence of the IIs type restriction enzyme 2 is as shown in sequence 2 in sequence table.

In above-mentioned complete sets of products, the m is 1,2,3,4,5 or 6；

When m is 1, complete sets of products is made of core fragment A1 and the coexpression vector；

When m is 2, complete sets of products is made of core fragment A2, core fragment A3 and the coexpression vector；

When m is 3, complete sets of products is by core fragment A2, core fragment A4, core fragment A5 and the coexpression vector group At；

When m is 4, complete sets of products is by core fragment A2, core fragment A4, core fragment A6, core fragment A7 and described total Expression vector composition；

When m is 5, complete sets of products is by core fragment A2, core fragment A4, core fragment A6, core fragment A8, core fragment A9 and coexpression vector composition；

When m is 6, complete sets of products is by core fragment A2, core fragment A4, core fragment A6, core fragment A8, core fragment A10, core fragment A11 and coexpression vector composition；

Cohesive end 1x in the core fragment A1 is as shown in sequence 3 in sequence table；

Cohesive end 1y in the core fragment A1 is as shown in sequence 4 in sequence table；

Cohesive end 2x in the core fragment A2 is as shown in sequence 5 in sequence table；

Cohesive end 2y in the core fragment A2 is as shown in sequence 6 in sequence table；

Cohesive end 3x in the core fragment A3 is as shown in sequence 7 in sequence table；

Cohesive end 3y in the core fragment A3 is as shown in sequence 8 in sequence table；

Cohesive end 4x in the core fragment A4 is as shown in sequence 9 in sequence table；

Cohesive end 4y in the core fragment A4 is as shown in sequence 10 in sequence table；

Cohesive end 5x in the core fragment A5 is as shown in sequence 11 in sequence table；

Cohesive end 5y in the core fragment A5 is as shown in sequence 12 in sequence table；

Cohesive end 6x in the core fragment A6 is as shown in sequence 13 in sequence table；

Cohesive end 6y in the core fragment A6 is as shown in sequence 14 in sequence table；

Cohesive end 7x in the core fragment A7 is as shown in sequence 15 in sequence table；

Cohesive end 7y in the core fragment A7 is as shown in sequence 16 in sequence table；

Cohesive end 8x in the core fragment A8 is as shown in sequence 17 in sequence table；

Cohesive end 8y in the core fragment A8 is as shown in sequence 18 in sequence table；

Cohesive end 9x in the core fragment A9 is as shown in sequence 19 in sequence table；

Cohesive end 9y in the core fragment A9 is as shown in sequence 20 in sequence table；

Cohesive end 10x in the core fragment A10 is as shown in sequence 21 in sequence table；

Cohesive end 10y in the core fragment A10 is as shown in sequence 22 in sequence table；

Cohesive end 11x in the core fragment A11 is as shown in sequence 23 in sequence table；

Cohesive end 11y in the core fragment A11 is as shown in sequence 24 in sequence table；

Cohesive end Ax in the core fragment A is as shown in sequence 25 in sequence table；

Cohesive end Ay in the core fragment A is as shown in sequence 26 in sequence table.

Above-mentioned cohesive end sequence refers both to that template DNA chain from 5 ' to 3 ' above core fragment as shown in Fig. 1 and holds Sequence.

It is a further object to provide a kind of complete carriers for the expression of multielement protein compound.

Provided by the present invention for the expression of multielement protein compound complete carrier by m single-gene expression vector and above-mentioned Coexpression vector composition；

The m is the integer more than or equal to 1；The m single-gene expression vector is sequentially named as 1 according to Arabic numerals Number single-gene expression vector, No. 2 single-gene expression vectors ... and m single-gene expression vector；

No. 1 single-gene expression vector is that the core fragment A1 in claim 1 is inserted into skeleton carrier to obtain The carrier arrived；

No. 2 single-gene expression vectors are that the core fragment A2 in claim 1 is inserted into skeleton carrier to obtain The carrier arrived；

And so on；

The m single-gene expression vector is that the core fragment Am in claim 1 is inserted into skeleton carrier to obtain The carrier arrived.

In above-mentioned complete carrier, the skeleton carrier in the single-gene expression vector does not contain IIs type restriction enzyme 2 Identification sequence.

In above-mentioned complete carrier, the m is 1,2,3,4,5 or 6；

When m is 1, complete carrier is made of No. 1 single-gene expression vector and above-mentioned coexpression vector；

When m is 2, complete carrier is by No. 2 single-gene expression vectors, No. 3 single-gene expression vectors and above-mentioned coexpression vector Composition；

When m is 3, complete carrier is carried by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 5 single-gene expression Body and above-mentioned coexpression vector composition；

When m is 4, complete carrier is carried by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 6 single-gene expression Body, No. 7 single-gene expression vectors and above-mentioned coexpression vector composition；

When m is 5, complete carrier is carried by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 6 single-gene expression Body, No. 8 single-gene expression vectors, No. 9 single-gene expression vectors and above-mentioned coexpression vector composition；

When m is 6, complete carrier is carried by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 6 single-gene expression Body, No. 8 single-gene expression vectors, No. 10 single-gene expression vectors, No. 11 single-gene expression vectors and above-mentioned coexpression vector group At；

No. 1 single-gene expression vector be by sequence 27 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 2 single-gene expression vectors be by sequence 28 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 3 single-gene expression vectors be by sequence 29 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 4 single-gene expression vectors be by sequence 30 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 5 single-gene expression vectors be by sequence 31 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 6 single-gene expression vectors be by sequence 32 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 7 single-gene expression vectors be by sequence 33 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 8 single-gene expression vectors be by sequence 34 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 9 single-gene expression vectors be by sequence 35 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 10 single-gene expression vectors be by sequence 36 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 11 single-gene expression vectors be by sequence 37 be inserted into expression vector A SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

The coexpression vector is to be inserted into sequence 38 between SphI and XhoI the identification sequence of expression vector B, and protect The other sequences for holding expression vector B are constant, obtained carrier；

The expression vector A is pET-28b；The expression vector B is that BsmBI and BsaI identifies what sequence was fallen by mutation PET-15b carrier.

It is a still further object of the present invention to provide a kind of methods of the recombinant vector of building coexpression multielement protein compound.

It is provided by the invention building coexpression multielement protein compound recombinant vector method be using the said goods into Row building, for as follows (A) or (B):

(A) include the following steps:

1) encoding gene of several foreign proteins is loaded into respectively in above-mentioned single-gene expression vector, if respectively obtaining The single-gene expression vector of dry expression foreign protein；

2) the single-gene expression vector of several expression foreign proteins and above-mentioned coexpression vector IIs type are limited Property restriction endonuclease 1 carry out digestion and connection, obtain connection product, as co-express the recombinant vector of multielement protein compound；

(B) include the following steps:

1) encoding gene of several foreign proteins is loaded into respectively in above-mentioned core fragment, respectively obtains several tables Up to the single-gene core fragment of foreign protein；

2) the single-gene core fragment of several expression foreign proteins and above-mentioned coexpression vector IIs type are limited Property restriction endonuclease 1 carry out digestion and connection, obtain connection product, as co-express the recombinant vector of multielement protein compound.

In the above method, the method for the load are as follows: use the encoding gene of the single-gene expression vector, foreign protein IIs type restriction enzyme 2 and ligase carry out digestion and connection simultaneously, make described in the encoding gene replacement of the foreign protein Screening-gene in single-gene expression vector realizes load.

In the above method,

The IIs type restriction enzyme 1 is BsmBI；

The IIs type restriction enzyme 2 is BsaI.

In the above method, feasible to operate, the upstream and downstream both ends of the core fragment also need to add protection base.

In the above method, described several express the single-gene expression vector of foreign proteins by the list of expression foreign protein 1 Expression vector, the single-gene expression vector for expressing foreign protein 2, the single-gene expression vector for expressing foreign protein 3, expression The single-gene expression vector of foreign protein 4 and the single-gene expression vector composition of expression foreign protein 5.

The single-gene expression vector of the expression foreign protein 1 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The Partial Fragment of the encoding gene of Cps25 albumen replaces the riddled basins in above-mentioned No. 2 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 2 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The encoding gene of Cps30 albumen replaces the riddled basins in above-mentioned No. 4 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 3 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The encoding gene of Cps50 albumen replaces the riddled basins in above-mentioned No. 6 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 4 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The Partial Fragment of the encoding gene of Cps60 albumen replaces the riddled basins in above-mentioned No. 8 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 5 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The Partial Fragment of the encoding gene of Set1 albumen replaces the riddled basins in above-mentioned No. 9 single-gene expression vectors.

In the above method,

The Partial Fragment sequence of the encoding gene of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps25 albumen It is classified as sequence 39；

The coding gene sequence of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps30 albumen is sequence 41；

The coding gene sequence of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps50 albumen is sequence 43；

The Partial Fragment sequence of the encoding gene of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps60 albumen 25-1467 are classified as in sequence 45；

The Partial Fragment sequence of the encoding gene of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Set1 albumen It is 19-576 in sequence 47.

Final object of the present invention is to provide a kind of method for co-expressing multielement protein compound.

The method of coexpression multielement protein compound provided by the invention includes the following steps: to construct according to the method described above To the recombinant vector of coexpression multielement protein compound；The recombinant vector of the coexpression multielement protein compound is transformed into greatly In enterobacteria bacterial strain, identifies correct clone, extract plasmid；The plasmid is transferred in expression system, realizes coexpression.

In the above method or above-mentioned complete carrier or above-mentioned complete sets of products, the matching is complementary pairing, i.e. viscosity end Hold the complementary strand of (m-1) y and cohesive end mx can be with complementary pairing.

The present invention provides a kind of complete carrier for the expression of multielement protein compound and its applications.The complete carrier point For single-gene expression vector and coexpression received vector two parts, single-gene cloning vector is kalamycin resistance, in promoter There is BsmBI restriction enzyme site in trip and terminator downstream, ccdB selectable marker gene are inserted between promoter and terminator, the two sides ccdB have BsaI restriction enzyme site；And co-expressing received vector is amicillin resistance, and ccdB is also selected alternatively to mark, the two sides ccdB There is BsmBI restriction enzyme site.Proved by test: albumen composition each component can be cloned into different single-gene expression vectors parallel In, single-gene expression vector and coexpression vector are then subjected to a group reaction cartridge in a pipe, albumen composition can be obtained Coexpression vector.The present invention passes through the design of IIs type restriction enzyme, can make digestion and be connected in same pipe to carry out, in Between do not need digestion products purifying etc. manipulation, meanwhile, design of the invention can once test the transcriptional units of multiple albumen It is assembled on coexpression vector simultaneously, therefore the assembling of coexpression vector highly shortened clone-time, and different resistances And ccdB screening, the efficiency of clone is improved, in addition, coexpression vector transcribes out monocistronic mRNA, albumen table can be improved Up to amount.

Detailed description of the invention

Fig. 1 is single-gene expression vector structural schematic diagram.Wherein, BioBrick prefix: biological brick prefix sequence； BsmBI:BsmBI identifies sequence；Fx:BsmBI cleavage sequence；T7 promoter:T7 promoter；Lac operator: lactose behaviour Vertical gene；RBS: ribosome bind site；Tag: protein purification label；BsaI:BsaI identifies sequence；CcdB: toxin protein CcdB gene；T7 terminator:T7 terminator；Fy:BsmBI cleavage sequence；BioBrick suffix: biological brick suffix sequence Column.

Fig. 2 is that albumen composition co-expresses received vector structural schematic diagram.Wherein, BioBrick prefix: before biological brick Sew sequence；BsmBI:BsmBI identifies sequence；CcdB: toxin protein CcdB gene；BioBrick suffix: biological brick suffix sequence Column.

Fig. 3 is single-gene expression vector establishment flow chart.

Fig. 4 is that compound co-expresses received vector building flow chart.

Fig. 5 is the schematic diagram that albumen composition component is cloned into single-gene expression vector.

Fig. 6 is clone's schematic diagram of albumen composition coexpression vector.

Fig. 7 is the SDS-PAGE image through molecular-exclusion chromatography after purification, and wherein number represents collecting pipe number.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

The construction method of the complete carrier for the expression of multielement protein compound in following embodiments specifically includes as follows Step:

1, m core fragment is designed；

M core fragment be sequentially named as according to Arabic numerals core fragment A1, core fragment A2 ... and core sheet Section Am；

Successively the identification sequence including IIs type restriction enzyme 1, single base N, viscosity are last from 5 ' ends by core fragment A1 Hold 1x, the DNA fragmentation for constructing exogenous gene expression box, cohesive end 1y, single base N and identification sequence；

Successively the identification sequence including IIs type restriction enzyme 1, single base N, viscosity are last from 5 ' ends by core fragment A2 Hold 2x, the DNA fragmentation for constructing exogenous gene expression box, cohesive end 2y, single base N and identification sequence；

And so on,

Successively the identification sequence including IIs type restriction enzyme 1, single base N, viscosity are last from 5 ' ends by core fragment Am Hold mx, the DNA fragmentation for constructing exogenous gene expression box, cohesive end my, single base N and identification sequence；

Each core fragment is used to construct exogenous gene expression box by what 1 digestion of IIs type restriction enzyme generated DNA fragmentation upstream cohesive terminus,cohesive termini and the DNA fragmentation downstream cohesive terminus,cohesive termini for constructing exogenous gene expression box are different and not complementary；

Coexpression vector is made of core fragment A and skeleton carrier；

The core fragment of coexpression vector successively includes cohesive end Ax, the list of IIs type restriction enzyme 1 from 5 ' ends Base N, identification sequence, riddled basins, the identification sequence of IIs type restriction enzyme 1, single base N and cohesive end Ay；

Coexpression vector passes through the skeleton carrier upstream cohesive terminus,cohesive termini and skeleton that 1 digestion of IIs type restriction enzyme generates Carrier downstream cohesive terminus,cohesive termini is different and not complementary；

The cohesive end 1y and core fragment A2 that core fragment A1 is generated by 1 digestion of IIs type restriction enzyme pass through The cohesive end 2x matching that 1 digestion of IIs type restriction enzyme generates；

The cohesive end 2y and core fragment A3 that core fragment A2 is generated by 1 digestion of IIs type restriction enzyme pass through The cohesive end 3x matching that 1 digestion of IIs type restriction enzyme generates；

And so on；

The downstream cohesive end (m-1) the y stickiness end that core fragment A m-1 is generated by 1 digestion of IIs type restriction enzyme The cohesive end mx matching that end and core fragment A m are generated by 1 digestion of IIs type restriction enzyme；

The cohesive end Ax and core fragment A1 that coexpression vector is generated by 1 digestion of IIs type restriction enzyme pass through The cohesive end 1x matching that 1 digestion of IIs type restriction enzyme generates；

The cohesive end Ay and core fragment A m that coexpression vector is generated by 1 digestion of IIs type restriction enzyme pass through The cohesive end my matching that 1 digestion of IIs type restriction enzyme generates.

DNA fragmentation for constructing exogenous gene expression box successively includes the starting of driving exogenous gene expression from 5 ' ends Son, lactose operon, ribosome bind site, the cohesive end of the generation of IIs type restriction enzyme 2, single base N, IIs type limit The identification sequence of property restriction endonuclease 2 processed, riddled basins, the identification sequence of restriction enzyme 2, the limitation of single base N, IIs type Property restriction endonuclease 2 generate cohesive end and terminate exogenous gene expression terminator；

Each core fragment passes through the riddled basins upstream cohesive terminus,cohesive termini that 2 digestion of IIs type restriction enzyme generates It is different with riddled basins downstream cohesive terminus,cohesive termini and not complementary；

Single base N is any one in A, G, C and T.

2, the building of single-gene expression vector

Above-mentioned m core fragment is inserted into skeleton carrier respectively, respectively obtains each single-gene expression vector.

The building and its application of embodiment 1, the complete carrier expressed for multielement protein compound

One, the building of single-gene expression vector

The present embodiment constructs 11 single-gene expression vectors altogether, specific as follows:

No. 1 single-gene expression vector is to be inserted into sequence 27 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 2 single-gene expression vectors are to be inserted into sequence 28 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 3 single-gene expression vectors are to be inserted into sequence 29 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 4 single-gene expression vectors are to be inserted into sequence 30 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 5 single-gene expression vectors are to be inserted into sequence 31 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 6 single-gene expression vectors are to be inserted into sequence 32 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 7 single-gene expression vectors are to be inserted into sequence 33 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 8 single-gene expression vectors are to be inserted into sequence 34 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 9 single-gene expression vectors are to be inserted into sequence 35 between SphI and XhoI the identification sequence of pET-28b carrier, And keep the other sequences of expression vector A constant, obtained carrier；

No. 10 single-gene expression vectors be sequence 36 is inserted into pET-28b carrier SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

No. 11 single-gene expression vectors be sequence 37 is inserted into pET-28b carrier SphI and XhoI identify sequence it Between, and keep the other sequences of expression vector A constant, obtained carrier；

The construction method of above-mentioned each single-gene expression vector is as shown in Figure 3, the specific steps are as follows:

1, the building of No. 1 single-gene expression intermediate vector

(1) synthesis of characteristic sequence

5‘-CAGGAAACAGCTATGACGCATGCGAATTCGCGGCCGCTTCTAGAGCGTCTCATGGATAATACGAC TCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGtAATAATTTTGTTTAACTTTAAGAAGGAGATATA CGATGCGAGACCATGCGGTCTCCTAGCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTC ACTGAGACGTACTAGTAGCGGCCGCTGCAGCTCGAGACTGGCCGTCGTTTTAC-3 ' (sequence 1)；

Utilize the Building Block Design of the website gene design (http: // 54.235.254.95/gd/) The function of (constant length overlap), nucleic acid molecule shown in list entries 3, obtains following oligos:

5'-CAGGAAACAGCTATGACGCATGCGAATTCGCGGCCGCTTCTAGAGCGTCTC-3'；

5'-GCTCACAATTCCCCTATAGTGAGTCGTATTATCCATGAGACGCTCTAGAAGCGGC-3'；

5’-CTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGTAATAATTTTGTTTAACTTTA AG-3'；

5'-GTCTCGCATCGTATATCTCCTTCTTAAAGTTAAACAAAATTATTACTAGAGGGGAA-3'；

5'-AGAAGGAGATATACGATGCGAGACCATGCGGTCTCCTAGCTAGCATAACCCCT-3'；

5'-CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGCTAGGAG-3'；

5'-AACGGGTCTTGAGGGGTTTTTTGTCACTGAGACGTACTAGTAGCGGCCGCTG-3'；

5’-GTAAAACGACGGCCAGTCTCGAGCTGCAGCGGCCGCTACTAGTAC-3’。

(2) PCR amplification

PCR is carried out in two steps:

First step PCR is that the characteristic sequence synthesized using above-mentioned steps (1) carries out PCR amplification as template, obtains first step PCR Amplified production.

First step PCR reaction system (final concentration): dNTP (GenStar A114-01) 0.2mM, 1xQ5reaction buffer(NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S)0.02units/μ L, primer (final concentration is 30nM).First step PCR reaction condition is as follows: 98 DEG C, 2min, 55 DEG C, 30s；72℃,20s；1 Circulation；98℃,10s,69℃,30s,72℃,20s；5 circulations；98℃,10s,65℃,30s,72℃,20s；5 circulations；98 ℃,10s,61℃,30s,72℃,20s；20 circulations；72℃2min；10 DEG C of preservations.

Second step PCR is to dilute 5 times of first step pcr amplification product as template, with M13Forward and M13Reverse Universal primer amplification carries out PCR amplification, obtains second step pcr amplification product.

Second step PCR reaction system (final concentration): dNTP (GenStar A114-01) 0.2mM, 1xQ5reaction buffer(NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S)0.02units/μ L, primer (final concentration is 0.5mM), template be 5 times of above-mentioned dilution on the basis of dilute 10 times again.

Second step PCR reaction condition is as follows: 98 DEG C of 2min, 55 DEG C of 30s, and 72 DEG C, 20s；1 circulation；98℃20s；55℃, 30s；72℃,20s；25 circulations；72℃3min；10 DEG C of preservations.

Second step pcr amplification product is analyzed with agarose gel electrophoresis, recycles purpose band.

(3) with SphI (SphI-HF NEB R3182L) and XhoI (NEB R0146L) to second step pcr amplification product with PET-28b carrier (Novagen company) carries out double digestion, and connection obtains recombinant vector, is named as No. 1 single-gene expression Intermediate vector, and bacillus coli DH 5 alpha is converted, sequencing is sent after digestion is identified.

Sequencing result shows: No. 1 single-gene expression intermediate vector is by SphI the and XhoI restriction enzyme site of pET-28b carrier Between DNA fragmentation replace with DNA molecular shown in sequence 49 and keep the constant obtained carrier of pET-28b carrier other sequences.

2, the building of 2-11 single-gene expression intermediate vector

Using No. 1 single-gene expression intermediate vector as template, PCR is carried out with the corresponding primer of 2-11 carrier in table 1 respectively Amplification, respectively obtains pcr amplification product (cohesive end direction is the direction according to support template chain 5 ' -3 ').

Table 1,2-11 single-gene express the primer of the building of intermediate vector

PCR reaction system (final concentration): dNTP (GenStar A114-01) 0.2mM, 1xQ5reaction buffer (NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S) 0.02units/ μ l, primer (final concentration is 0.5mM), plasmid template 30ng.PCR reaction condition is as follows: 98 DEG C, 2min；1 circulation；98 DEG C, 30s, 54 DEG C, 30s, 72 DEG C, 20s；30 circulations；72℃3min；10 DEG C of preservations.

Pcr amplification product is analyzed with agarose gel electrophoresis respectively, recycles purpose band, PCR recycling is respectively obtained and produces Object.It is produced respectively with EcoRI (EcoRI-HF NEB R3101L) and SpeI (SpeI-HF NEB R3133L) double digestion PCR recycling Object and No. 1 single-gene express intermediate vector, and connection respectively obtains recombinant vector, is named as 2-11 single-gene table respectively Up to intermediate vector, and bacillus coli DH 5 alpha is converted, sequencing is sent after digestion is identified.

Sequencing result shows: No. 2 single-genes expression intermediate vectors be No. 1 single-gene is expressed intermediate vector EcoRI and DNA fragmentation between SpeI identification sequence replaces with DNA molecular shown in sequence 50 in sequence table, and keeps No. 1 single-gene expression The constant carrier of the other sequences of intermediate vector；

No. 3 single-gene expression intermediate vectors are between the EcoRI and SpeI of No. 1 single-gene expression intermediate vector to be identified to sequence DNA fragmentation replace with DNA molecular shown in sequence 51 in sequence table, and keep No. 1 single-gene expression intermediate vector other The constant carrier of sequence；

No. 4 single-gene expression intermediate vectors are between the EcoRI and SpeI of No. 1 single-gene expression intermediate vector to be identified to sequence DNA fragmentation replace with DNA molecular shown in sequence 52 in sequence table, and keep No. 1 single-gene expression intermediate vector other The constant carrier of sequence；

No. 5 single-gene expression intermediate vectors are between the EcoRI and SpeI of No. 1 single-gene expression intermediate vector to be identified to sequence DNA fragmentation replace with DNA molecular shown in sequence 53 in sequence table, and keep No. 1 single-gene expression intermediate vector other The constant carrier of sequence；

No. 6 single-gene expression intermediate vectors are between the EcoRI and SpeI of No. 1 single-gene expression intermediate vector to be identified to sequence DNA fragmentation replace with DNA molecular shown in sequence 54 in sequence table, and keep No. 1 single-gene expression intermediate vector other The constant carrier of sequence；

No. 7 single-gene expression intermediate vectors are between the EcoRI and SpeI of No. 1 single-gene expression intermediate vector to be identified to sequence DNA fragmentation replace with DNA molecular shown in sequence 55 in sequence table, and keep No. 1 single-gene expression intermediate vector other The constant carrier of sequence；

No. 8 single-gene expression intermediate vectors are between the EcoRI and SpeI of No. 1 single-gene expression intermediate vector to be identified to sequence DNA fragmentation replace with DNA molecular shown in sequence 56 in sequence table, and keep No. 1 single-gene expression intermediate vector other The constant carrier of sequence；

No. 9 single-gene expression intermediate vectors are between the EcoRI and SpeI of No. 1 single-gene expression intermediate vector to be identified to sequence DNA fragmentation replace with DNA molecular shown in sequence 57 in sequence table, and keep No. 1 single-gene expression intermediate vector other The constant carrier of sequence；

No. 10 single-gene expression intermediate vectors are that No. 1 single-gene is expressed to EcoRI and SpeI the identification sequence of intermediate vector Between DNA fragmentation replace with DNA molecular shown in sequence 58 in sequence table, and keep No. 1 single-gene expression intermediate vector its The constant carrier of his sequence；

No. 11 single-gene expression intermediate vectors are that No. 1 single-gene is expressed to EcoRI and SpeI the identification sequence of intermediate vector Between DNA fragmentation replace with DNA molecular shown in sequence 59 in sequence table, and keep No. 1 single-gene expression intermediate vector its The constant carrier of his sequence.

3, the building of 1-11 single-gene expression vector

The sequence (inside identifies sequence without BsaI) of the gene containing ccdB shown in sequence 60 in artificial synthesized sequence table, and It is inserted respectively between BsaI (BsaI-HF NEB R3535L) the identification sequence of 1-11 single-gene expression intermediate vector, point Recombinant vector is not obtained, is named as 1-11 single-gene expression vector (sequence signature is shown in Fig. 1) respectively, and respectively by its turn Change Escherichia coli OneccdB Survival^TM2 T1R send sequencing after digestion is identified.

Sequence verification shows: No. 1 single-gene expression vector is the SphI and XhoI that sequence 27 is inserted into pET-28b carrier It identifies between sequence, and keeps the other sequences of expression vector A constant, obtained carrier；

Two, the building of received vector is co-expressed

In order sequence 38 is inserted into pET-15b carrier, (BsaI and BsmBI identifies that sequence is mutated to coexpression vector on carrier Fall) SphI and XhoI identification sequence between, and keep expression vector B other sequences it is constant, obtained carrier.Coexpression connects The structural schematic diagram of body is recorded as shown in Fig. 2, the construction method of coexpression received vector is as shown in Figure 4, the specific steps are as follows:

1, the site BsaI and BsmBI on pET-15b is removed

With pET-15b carrier (Novagen company) for template, following three pairs of primers are respectively adopted and carry out PCR amplification, respectively Obtain pcr amplification product.

YQO001:5'-GCTAGGTCTCGCACAGCTTGTCTGTAAGCGGATGCCG-3'；

YQO002:5'-CGATGGTCTCCTGTGACCTTCTCCGGGAGCTGCATGTG-3'；

YQO003:5'-GCTAGGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCC-3'；

YQO004:5'-GCTAGGTCTCACCAGTGATACGGGCAACAGCTGATTGCCC-3'；

YLO006:5'-CTGCAATGATACCGCggtctcgactacCACGCTCACCGG-3'；

YLO005:5’-CCGGTGAGCGTGggtctcgtagtcGCGGTATCATTGCAG-3’。

PCR reaction system (final concentration): dNTP (GenStar A114-01) 0.2mM, 1xQ5reaction buffer (NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S) 0.02units/ μ l, draw Object (final concentration is 0.5mM), plasmid template 30ng.PCR reaction condition is as follows: 98 DEG C, 2min；1 circulation；98 DEG C, 30s, 54 DEG C, 30s, 72 DEG C, 1min；30 circulations；72℃7min；10 DEG C of preservations.

Pcr amplification product is analyzed with agarose gel electrophoresis respectively, recycles purpose band, 3 PCR recycling is obtained and produces Object；With 3 PCR recovery products of BsaI digestion, glue carries out conventional connection after recycling purpose band, obtains recombinant vector, and by its Bacillus coli DH 5 alpha is converted, sequencing is sent after digestion is identified.

2, it is inserted into ccdB gene

Using the ccdB gene in sequence 60 as template, PCR amplification is carried out using following primer, obtains pcr amplification product.

YQO040:CATGCATGCGAATTCGCGGCCGCTTCTAGAGTGGAAGAGACGCTCTAGAGGATCCGGCTT AC；

YQO041:GGCTCGAGCTGCAGCGGCCGCTACTAGTAGTGATGAGACGGTCGACCTGCAGACTGGCTG。

The recombinant vector obtained respectively with SphI and XhoI double digestion PCR recovery product and above-mentioned steps 1, connection, obtains Received vector is co-expressed, and is converted bacillus coli DH 5 alpha, sequencing is sent after digestion is identified.

Sequence verification shows: coexpression received vector is SphI the and XhoI digestion position for the recombinant vector for obtaining step 1 DNA fragmentation between point replaces with the sequence in sequence table containing ccdB gene shown in sequence 60, and (inside identifies sequence without BsaI Column), and the constant obtained carrier of other sequences for the recombinant vector for keeping step 1 to obtain.

Three, albumen composition is expressed using single-gene expression vector and coexpression received vector

1, the building of the single-gene expression vector of foreign protein is expressed

The single-gene expression vector of expression foreign protein replaces will to express the encoding gene of foreign protein or part thereof segment The carrier that the riddled basins changed in the single-gene expression vector of step 1 obtain.Albumen composition in the present embodiment by A, B, five components of C, D and E are constituted, and the single-gene expression vector of expression foreign protein of the invention shares 5, specific as follows:

The single-gene expression vector for expressing foreign protein A is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The Partial Fragment of the encoding gene of Cps25 albumen replaces the riddled basins in above-mentioned No. 2 single-gene expression vectors；

The single-gene expression vector for expressing foreign protein B is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The encoding gene of Cps30 albumen replaces the riddled basins in above-mentioned No. 4 single-gene expression vectors；

The single-gene expression vector for expressing foreign protein C is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The encoding gene of Cps50 albumen replaces the riddled basins in above-mentioned No. 6 single-gene expression vectors；

The single-gene expression vector for expressing foreign protein D is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The Partial Fragment of the encoding gene of Cps60 albumen replaces the riddled basins in above-mentioned No. 8 single-gene expression vectors；

The single-gene expression vector for expressing foreign protein E is by Saccharomyces Cerevisiae in S accharomyces cerevisiae The Partial Fragment of the encoding gene of Set1 albumen replaces the riddled basins in above-mentioned No. 9 single-gene expression vectors.

The building process of the single-gene expression vector of above-mentioned each expression foreign protein is specific as follows:

(1) building of the single-gene expression vector of foreign protein A is expressed

It is with the genomic DNA (BioVector NTCC Inc, article No.: ATCC 201388D-5) of saccharomyces cerevisiae BY4741 Template carries out PCR amplification using YQO052 and YQO053 primer, obtains pcr amplification product, as component A (saccharomyces cerevisiae Saccharomyces cerevisiae Cps25 protein coding gene Partial Fragment), sequence in nucleotide sequence such as sequence table Shown in column 23.Primer sequence is as follows:

YQO052:5 '-AGCGTGGGTCTCAGATGAATGTGAACCTTGCCGCGACGG-3 '；YQO053:5 '-GTGCT GGGTCTCGGCTATTTACTAGCATTACTCTCTTTTTCTCC-3’。

PCR reaction system (final concentration): dNTP (GenStar A114-01) 0.2mM, 1xbuffer for KOD-Plus- (TOYOBO)、MgSO₄(TOYOBO) (final concentration is for 2mM, KOD-Plus- (TOYOBO) 0.02units/ μ l, primer 0.5mM), genomic templates 150ng.PCR reaction condition is as follows: 94 DEG C, 4min；1 circulation；94 DEG C, 30s, 55 DEG C, 30s, 68 ℃,40s；30 circulations；68℃7min；10 DEG C of preservations.

Pcr amplification product is analyzed with agarose gel electrophoresis, purpose band is recycled, obtains recovery product.

No. 2 single-gene expression vectors (20ng) prepared by recovery product (100ng) and above-mentioned steps one are added to reaction It is reacted in system, obtains reaction product A (expressing the single-gene expression vector of foreign protein A).Reaction system: 5units BsaI (BsaI-HF NEB R3535L), 1U T4DNA ligase (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solution (Thermo Scientific B69)；Response procedures: 37 DEG C, 60min； 50 DEG C, 15min；80 DEG C, 15min；10 DEG C of preservations.

Reaction product A is directly converted into bacillus coli DH 5 alpha, sequencing is sent after digestion is identified.

Show through being sequenced: the single-gene expression vector of expression foreign protein A is by the BsaI enzyme of No. 2 single-gene expression vectors DNA fragmentation between enzyme site replaces with the volume of component A shown in sequence 39 in sequence (Cps25 protein coding gene Partial Fragment) Code gene and obtained carrier after keeping No. 2 single-gene expression vector other sequences constant.The amino acid sequence of the component A of expression As shown in sequence 40 in sequence table.

(2) building of the single-gene expression vector of foreign protein B is expressed

There is BsmBI and BsaI restriction enzyme site in component B, designs two pairs of primers and expanded to remove BsmBI Restriction enzyme site.

Using the genomic DNA of saccharomyces cerevisiae BY4741 as template, primer YQO058 and YQO060, primer is respectively adopted YQO061 and YQO059 carries out PCR amplification, respectively obtains pcr amplification product.

YQO058:5 '-AgcgtgGGTCTCaGATGTTCCAGTTTGTTACTCCTGTG-3 '；

YQO059:5'-GtgctgGGTCTCgGCTAAACCCATCTCCATAAACAGC-3'；

YQO060:5'-AgcgtgGGTCTCGTTTCTGCATCAAAGATCCGTATGAG-3'；

YQO061:5’-GtgctgGGTCTCaGAAACGGGCCATTGTTTGAAG-3’。

PCR reaction system (final concentration): dNTP (GenStar A114-01) 0.2mM, 1xbuffer for KOD-Plus- (TOYOBO)、MgSO₄(TOYOBO) (final concentration is for 2mM, KOD-Plus- (TOYOBO) 0.02units/ μ l, primer 0.5mM), genomic templates 150ng.

The PCR reaction condition of pair of primers is as follows: 94 DEG C, 5min；1 circulation；94 DEG C, 30s, 45 DEG C, 30s, 68 DEG C, 1min；10 circulations；94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 1min；20 circulations；68℃7min；10 DEG C of preservations.

The PCR reaction condition of second pair of primer is as follows: 94 DEG C, 4min；1 circulation；94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 2min；30 circulations；68℃7min；10 DEG C of preservations.

Two pcr amplification products are analyzed with agarose gel electrophoresis, purpose band is recycled, obtains two recovery products.

By two recovery products (larger segment 100ng, another and its equimolar number) and No. 4 single-gene expression vectors (20ng), which is added in reaction system, to react, and obtains reaction product B (expressing the single-gene expression vector of foreign protein B).Instead Answer system: 2units BsaI (BsaI-HF NEB R3535L), 0.5U T4DNA ligase (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solution (Thermo Scientific B69)；Instead Answer program: 37 DEG C, 5min；1 circulation；37 DEG C, 5min, 25 DEG C 5min；3 circulations；50 DEG C, 5min；80 DEG C, 5min；Cooling 1unit ligase is added afterwards；25℃40min；10 DEG C of preservations.

Reaction product B is directly converted into bacillus coli DH 5 alpha, sequencing is sent after digestion is identified.

Show through being sequenced: the single-gene expression vector of expression foreign protein B is by the BsaI enzyme of No. 4 single-gene expression vectors DNA fragmentation between enzyme site replaces with the encoding gene (site BsmBI of component B shown in sequence 41 (Cps30 albumen) in sequence It is mutated) keep the carrier obtained after No. 4 single-gene expression vector other sequences are constant.The amino acid sequence of the component B of expression As shown in sequence 42 in sequence table.

(3) building of the single-gene expression vector of foreign protein C is expressed

Using the genomic DNA of saccharomyces cerevisiae BY4741 as template, PCR amplification is carried out using YQO056 and YQO057 primer, Obtain pcr amplification product, as component C (encoding gene of Cps50 albumen), nucleotide sequence such as 27 institute of sequence in sequence table Show.

YQO056:5 '-agcgtgGGTCTCaGATGAACATCCTTTTACAGGATCC-3 '；

YQO057:5’-GtgctgGGTCTCgGCTATGATGACTGCATCTTAATTATC-3’。

PCR reaction condition is as follows: 94 DEG C, 4min；1 circulation；94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 2min；30 are followed Ring；68℃7min；10 DEG C of preservations.

Recovery product (100ng) and No. 6 single-gene expression vectors (20ng) are added in reaction system and are reacted, is obtained anti- Answer product C (expressing the single-gene expression vector of foreign protein C).Reaction system: 2units BsaI (BsaI-HF NEB R3535L), 0.5U T4DNA ligase (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solution (Thermo Scientific B69)；Response procedures: 37 DEG C, 5min；1 circulation；37 DEG C, 5min,25℃5min；3 circulations；50 DEG C, 5min；80 DEG C, 5min；1unit ligase is added after cooling；25℃40min；10 DEG C save.

Reaction product C is directly converted into bacillus coli DH 5 alpha, sequencing is sent after digestion is identified.

Show through being sequenced: the single-gene expression vector of expression foreign protein C is by the BsaI enzyme of No. 6 single-gene expression vectors The encoding gene that DNA fragmentation between enzyme site replaces with component C shown in sequence 43 (Cps50 albumen) in sequence keeps No. 6 lists The carrier obtained after expression vector other sequences are constant.Sequence 44 in the amino acid sequence of the component C of expression such as sequence table It is shown.

(4) building of the single-gene expression vector of foreign protein D is expressed

Using the genomic DNA of saccharomyces cerevisiae BY4741 as template, PCR amplification is carried out using YQO054 and YQO055 primer, Obtain pcr amplification product, as component D (Cps60 protein coding gene Partial Fragment and N-terminal has FLAG fusion tag), Its nucleotide sequence is as shown in sequence 29 in sequence table.

YQO054:5 '-AGCGTGGGTCTCAGATGGATTATAAAGACGATGATGACAAGGAAGGGAAGAGACCT AA TT-3'；

YQO055:5 '-GTGCTGGGTCTCGGCTATTGCTGTAGGGCAATTTGCTCCAAC-3 '.

PCR reaction condition is as follows: 94 DEG C, 5min；1 circulation；94 DEG C, 30s, 45 DEG C, 30s, 68 DEG C, 2min30s；5 Circulation；94 DEG C, 30s, 50 DEG C, 30s, 68 DEG C, 2min30s；5 circulations；94 DEG C, 30s, 52 DEG C, 30s, 68 DEG C, 2min30s；20 A circulation；68℃7min；10 DEG C of preservations.

Recovery product (100ng) and No. 8 single-gene expression vectors (20ng) are added in reaction system and are reacted, is obtained anti- Answer product D (expressing the single-gene expression vector of foreign protein D).Reaction system: 2units BsaI (BsaI-HF NEB R3535L), 0.5U T4DNA ligase (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solution (Thermo Scientific B69)；Response procedures: 37 DEG C, 5min；1 circulation；37 DEG C, 5min,25℃5min；3 circulations；50 DEG C, 5min；80 DEG C, 5min；1unit ligase is added after cooling；25℃40min；10 DEG C save.

Reaction product D is directly converted into bacillus coli DH 5 alpha, sequencing is sent after digestion is identified.

Show through being sequenced: the single-gene expression vector of expression foreign protein D is by the BsaI enzyme of No. 8 single-gene expression vectors DNA fragmentation between enzyme site replaces with component D (Cps60 protein coding gene Partial Fragment and N shown in sequence 45 in sequence End has FLAG fusion tag) encoding gene keep No. 8 single-gene expression vector other sequences constant after obtained carrier.Table The amino acid sequence of the component D reached is as shown in sequence 46 in sequence table.

(5) building of the single-gene expression vector of foreign protein E is expressed

Using the genomic DNA of saccharomyces cerevisiae BY4741 as template, PCR amplification is carried out using YQO050 and YQO051 primer, Obtain pcr amplification product, as component E (Set1 protein coding gene Partial Fragment and N-terminal has His fusion tag), Nucleotide sequence is as shown in sequence 31 in sequence table.

YQO050:5 '-AGCGTGGGTCTCAGATGCATCATCATCACCACCACCAAGAAGTTTCATCCTCTAGA G- 3'；

YQO051:5 '-GTGCTGGGTCTCGGCTAGTTCAAGAAACCTTTACAATTAGG-3 '.

PCR reaction condition is as follows: 94 DEG C, 4min；1 circulation；94 DEG C, 30s, 45 DEG C, 30s, 68 DEG C, 2min；5 are followed Ring；94 DEG C, 30s, 50 DEG C, 30s, 68 DEG C, 2min；5 circulations；94 DEG C, 30s, 52 DEG C, 30s, 68 DEG C, 2min；20 circulations； 68℃7min；10 DEG C of preservations.

Recovery product (100ng) and No. 9 single-gene expression vectors (20ng) are added in reaction system and are reacted, is obtained anti- Answer product E (expressing the single-gene expression vector of foreign protein E).Reaction system: 2units BsaI (BsaI-HF NEB R3535L), 0.5U T4DNA ligase (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solution (Thermo Scientific B69)；Response procedures: 37 DEG C, 60min；50 DEG C, 15min；80 DEG C, 15min；10 DEG C of preservations.

Reaction product E is directly converted into bacillus coli DH 5 alpha, sequencing is sent after digestion is identified.

Show through being sequenced: the single-gene expression vector of expression foreign protein E is by the BsaI enzyme of No. 9 single-gene expression vectors DNA fragmentation between enzyme site replaces with component E (Set1 protein coding gene Partial Fragment and N shown in sequence 47 in sequence End has His fusion tag) encoding gene keep No. 9 single-gene expression vector other sequences constant after obtained carrier.Table The amino acid sequence of the component E reached is as shown in sequence 48 in sequence table.

2, the building (Fig. 5) of compound coexpression vector

The single-gene expression of the single-gene expression vector, expression foreign protein B of the expression foreign protein A that step 1 is obtained Carrier, the single-gene expression vector for expressing foreign protein C, the single-gene expression vector for expressing foreign protein D and expression external source egg The single-gene expression vector of white E and coexpression received vector (coexpression received vector 150ng, remaining single-gene vectors and its etc. Mole) it is added in reaction system and reacts, obtain compound coexpression vector (Fig. 6).

Reaction system: 5units BsmBI (NEB R0580S), 0.1mg/ml BSA (NEB B9001S), 1x T4 connection Enzyme buffer liquid (Thermo Scientific B69).

Response procedures: 55 DEG C, 60min；1U T4 ligase (Thermo Scientific EL0011) 25 is added after cooling DEG C, 50min；55 DEG C, 15min；80 DEG C, 15min；10 DEG C of preservations.

Compound coexpression vector is directly converted into bacillus coli DH 5 alpha, send sequencing after bacterium colony PCR identification.

3, the expression and purification of compound

Compound coexpression vector is transformed into e. coli bl21 Rosetta (DE3) (purchased from hundred grace vitamins CC009) In, obtain the recombinant bacterium containing compound coexpression vector；Picking contain the monoclonal of compound coexpression vector to 5ml added with In the dual anti-culture medium of ampicillin and chloramphenicol, 37 DEG C are incubated overnight；1L is transferred to added with ampicillin and chloramphenicol Dual anti-culture medium in, when OD600 reaches 0.6-0.8, cool down 2 hours, IPTG be added, 18 DEG C of Fiber differentiations are stayed overnight；Centrifugation Purifying through affinity chromatography, ion-exchange chromatography and molecular-exclusion chromatography after receipts bacterium, obtains albumen composition after purification.

The SDS-PAGE testing result of albumen composition after purification is as shown in Figure 7: it can be seen from the figure that after purification The SDS-PAGE testing result of albumen composition is 5 bands, and size is consistent with each component molecular weight, shows that method of the invention can To realize the coexpression of albumen composition each component, and clone-time is greatly shortened, improves the efficiency of clone.

Claims

1. it is a kind of for carrying out the complete sets of products of multielement protein compound expression in Escherichia coli, by m core fragment and total table It is formed up to carrier；

The m is the integer for being less than or equal to 6 more than or equal to 1；The m core fragment is sequentially named as core according to Arabic numerals Lamination section A1, core fragment A2 ... and core fragment Am；

Successively the identification sequence including IIs type restriction enzyme 1, single base N, viscosity are last from 5 ' ends by the core fragment A1 Hold 1x, the DNA fragmentation for constructing exogenous gene expression box and cohesive end 1y, single base N and the IIs type restriction enzyme The identification sequence of enzyme 1；

Successively the identification sequence including IIs type restriction enzyme 1, single base N, viscosity are last from 5 ' ends by the core fragment A2 Hold 2x, the DNA fragmentation for constructing exogenous gene expression box and cohesive end 2y, single base N and the IIs type restriction enzyme The identification sequence of enzyme 1；

And so on,

Successively the identification sequence including IIs type restriction enzyme 1, single base N viscosity are last from 5 ' ends by the core fragment Am Hold mx, the DNA fragmentation for constructing exogenous gene expression box, cohesive end my, single base N and the IIs type restriction enzyme The identification sequence of enzyme 1；

Each core fragment is used to construct exogenous gene expression by what 1 digestion of IIs type restriction enzyme generated The DNA fragmentation upstream cohesive terminus,cohesive termini of box is different with the DNA fragmentation downstream cohesive terminus,cohesive termini for constructing exogenous gene expression box And it mismatches；

The coexpression vector is made of core fragment A and skeleton carrier；

The core fragment A of the coexpression vector successively includes cohesive end Ax, single base N, IIs type limitation from 5 ' ends Property the identification sequence of restriction endonuclease 1, riddled basins, the identification sequence of the IIs type restriction enzyme 1, single base N and viscous Property end Ay；

The coexpression vector by 1 digestion of IIs type restriction enzyme generate skeleton carrier upstream cohesive terminus,cohesive termini and Skeleton carrier downstream cohesive terminus,cohesive termini is different and mismatches；

Cohesive end 1y and the core sheet of the core fragment A1 by 1 digestion of IIs type restriction enzyme generation The cohesive end 2x matching that section A2 is generated by 1 digestion of IIs type restriction enzyme；

Cohesive end 2y and the core sheet of the core fragment A2 by 1 digestion of IIs type restriction enzyme generation The cohesive end 3x matching that section A3 is generated by 1 digestion of IIs type restriction enzyme；

And so on；

Cohesive end (m-1) y and described that the core fragment A m-1 is generated by 1 digestion of IIs type restriction enzyme The cohesive end mx matching that core fragment A m is generated by 1 digestion of IIs type restriction enzyme；

Cohesive end Ax and the core sheet of the coexpression vector by 1 digestion of IIs type restriction enzyme generation The cohesive end 1x matching that section A1 is generated by 1 digestion of IIs type restriction enzyme；

Cohesive end Ay and the core sheet of the coexpression vector by 1 digestion of IIs type restriction enzyme generation The cohesive end my matching that section A m is generated by 1 digestion of IIs type restriction enzyme；

The DNA fragmentation for constructing exogenous gene expression box successively includes the starting of driving exogenous gene expression from 5 ' ends Son, the cohesive end that IIs type restriction enzyme 2 generates, the identification sequence of single base N, IIs type restriction enzyme 2, screening The cohesive end that marker gene, the identification sequence of the restriction enzyme 2, single base N, IIs type restriction enzyme 2 generate With the terminator for terminating the exogenous gene expression；

Or, the DNA fragmentation for constructing exogenous gene expression box successively includes driving exogenous gene expression from 5 ' ends In cohesive end, single base N, the IIs type that promoter, ribosome bind site, IIs type restriction enzyme 2 generate are restricted Identification sequence, riddled basins, the identification sequence of the restriction enzyme 2, single base N, the IIs type of enzyme cutting 2 are restricted The terminator of cohesive end and the termination exogenous gene expression that restriction endonuclease 2 generates；

Or, the DNA fragmentation for constructing exogenous gene expression box successively includes driving exogenous gene expression from 5 ' ends Promoter, lactose operon, ribosome bind site, the cohesive end of the generation of IIs type restriction enzyme 2, single base N, IIs The identification sequence of type restriction enzyme 2, riddled basins, the identification sequence of the restriction enzyme 2, single base N, The terminator of cohesive end and the termination exogenous gene expression that IIs type restriction enzyme 2 generates；

Or, the DNA fragmentation for constructing exogenous gene expression box successively includes driving exogenous gene expression from 5 ' ends The viscosity end that promoter, lactose operon, ribosome bind site, protein purification label, IIs type restriction enzyme 2 generate It holds, the identification of the identification sequence, riddled basins, the restriction enzyme 2 of single base N, IIs type restriction enzyme 2 The terminator of cohesive end and the termination exogenous gene expression that sequence, single base N, IIs type restriction enzyme 2 generate；

Each core fragment passes through the riddled basins upstream stickiness that 2 digestion of IIs type restriction enzyme generates End is different with riddled basins downstream cohesive terminus,cohesive termini and mismatches；

The single base N is any one in A, G, C and T.

2. complete sets of products according to claim 1, it is characterised in that:

The IIs type restriction enzyme 1 is BsmBI；

The IIs type restriction enzyme 2 is BsaI；

The riddled basins areccd1 B gene.

3. according to claim 1 or complete sets of products described in 2, it is characterised in that:

The identification sequence of the restriction enzyme 1 is as shown in sequence 1 in sequence table；

The identification sequence of the restriction enzyme 2 is as shown in sequence 2 in sequence table.

4. complete sets of products according to claim 1 or 2, it is characterised in that:

The m is 1,2,3,4,5 or 6；

When m is 3, complete sets of products is made of core fragment A2, core fragment A4, core fragment A5 and the coexpression vector；

When m is 4, complete sets of products is by core fragment A2, core fragment A4, core fragment A6, core fragment A7 and the coexpression Carrier composition；

M be 5 when, complete sets of products by core fragment A2, core fragment A4, core fragment A6, core fragment A8, core fragment A9 and The coexpression vector composition；

M be 6 when, complete sets of products by core fragment A2, core fragment A4, core fragment A6, core fragment A8, core fragment A10, Core fragment A11 and coexpression vector composition；

5. a kind of complete carrier for the expression of multielement protein compound, by m single-gene expression vector and claim 1-4 Any coexpression vector composition；

The m is the integer for being less than or equal to 6 more than or equal to 1；The m single-gene expression vector is sequentially ordered according to Arabic numerals Entitled No. 1 single-gene expression vector, No. 2 single-gene expression vectors ... and m single-gene expression vector；

No. 1 single-gene expression vector is that the core fragment A1 in claim 1 is inserted into obtained in skeleton carrier Carrier；

No. 2 single-gene expression vectors are that the core fragment A2 in claim 1 is inserted into obtained in skeleton carrier Carrier；

And so on；

The m single-gene expression vector is that the core fragment Am in claim 1 is inserted into obtained in skeleton carrier Carrier；

The complete carrier is the complete carrier in Bacillus coli expression.

6. a kind of method of the recombinant vector of building coexpression multielement protein compound, utilizes any production of claim 1-5 Product are constructed, for as follows (A) or (B):

(A) include the following steps:

1) encoding gene of several foreign proteins is loaded into respectively in the single-gene expression vector in claim 5, Respectively obtain the single-gene expression vector of several expression foreign proteins；

2) by any coexpression in the single-gene expression vector and claim 1-4 of several expression foreign proteins Carrier carries out digestion and connection with IIs type restriction enzyme 1, obtains connection product, as coexpression multielement protein compound Recombinant vector；

(B) include the following steps:

1) encoding gene of several foreign proteins is loaded into respectively in any core fragment of claim 1-4, point The single-gene core fragment of several expression foreign proteins is not obtained；

2) by any coexpression in the single-gene core fragment and claim 1-4 of several expression foreign proteins Carrier carries out digestion and connection with IIs type restriction enzyme 1, obtains connection product, as coexpression multielement protein compound Recombinant vector；

The recombinant vector is the recombinant vector in expression in escherichia coli.

7. according to the method described in claim 6, it is characterized by: the method for the load are as follows: express the single-gene and carry Body, the encoding gene IIs type restriction enzyme 2 of foreign protein and ligase carry out digestion and connection simultaneously, make described outer The encoding gene of source protein replaces the screening-gene in the single-gene expression vector, that is, realizes load.

8. a kind of method for carrying out coexpression multielement protein compound in Escherichia coli, includes the following steps: according to claim 6 The method constructs to obtain the recombinant vector of coexpression multielement protein compound；By the coexpression multielement protein compound Recombinant vector is transformed into coli strain, is identified correct clone, is extracted plasmid；The plasmid is transferred in expression system, Realize coexpression.