CN106811476A

CN106811476A - A kind of complete carrier and its application for the expression of multielement protein compound

Info

Publication number: CN106811476A
Application number: CN201510847331.3A
Authority: CN
Inventors: 戴俊彪; 陈柱成; 吴庆余; 秦怡然; 林继伟
Original assignee: Wuxi Qinglan Biological Science & Technology Co Ltd; Tsinghua University
Current assignee: Wuxi Qinglan Biological Science & Technology Co Ltd; Tsinghua University
Priority date: 2015-11-27
Filing date: 2015-11-27
Publication date: 2017-06-09
Anticipated expiration: 2035-11-27
Also published as: CN106811476B

Abstract

The invention discloses a kind of complete carrier for the expression of multielement protein compound and its application.The complete carrier is divided into single-gene expression vector and coexpression received vector two parts, albumen composition each component can be cloned into different single-gene expression vectors parallel, then single-gene expression vector and coexpression vector are carried out into assembling reaction in same pipe, you can obtain albumen composition coexpression vector.Proved by testing：The design that the present invention passes through IIs type restriction enzymes, digestion can be made and be connected in same pipe to carry out, centre does not need digestion products purifying etc. to manipulate, meanwhile, design of the invention can be once tested the transcriptional units of multiple albumen while being assembled on coexpression vector, therefore the assembling of coexpression vector highly shortened clone-time, and different resistances and ccdB screenings, the efficiency of clone is improve, in addition, coexpression vector transcribes out monocistronic mRNA, can improve expressing quantity.

Description

A kind of complete carrier and its application for the expression of multielement protein compound

Technical field

The invention belongs to biological technical field, and in particular to it is a kind of for multielement protein compound expression complete carrier and its should With.

Background technology

Compared to single protein component, scientists sight have gradually been transferred to 26S Proteasome Structure and Function and have been more difficult to study but also more attach most importance to On the multielement protein compound wanted.Multielement protein compound is all important controlling element in many bioprocess, in addition, It is just active when some albumen are only as the component of compound.Therefore, if the 26S Proteasome Structure and Function of compound can be studied directly, So many biological questions just can be explained more intuitively.

Expression and purifying protein complex are the necessary links of structural research.Escherichia coli are still the most frequently used expression restructuring so far The host of albumen.First, using Escherichia coli, substantial amounts of albumen can be obtained with very short time and little cost；Second, Either in terms of gene cloning or protein purification, coli expression system is all highly developed, is convenient for various The selection and detection of part；3rd, used as prokaryotes, Escherichia coli lack some posttranslational modifications, and this is more beneficial for grinding sometimes Study carefully.Obtaining albumen composition currently with coli expression system has following several approach：First, by albumen composition each group Divide and be individually purified (purifying of some components may further relate to denaturation and renaturation process), compound is recombinated in vitro；Second, Be co-expressed compound in vivo.In first method, certain component may be insoluble when single expression in compound, together When assembled in vitro be likely to be formed the compound of mistake.If however, compound to be realized coexpression in vivo, can be conducive to every The correct folding of one albumen, and correct interaction between compound each component, more likely form solvable compound.To sum up Described, coexpression system has big advantage during albumen composition is studied in Escherichia coli body.

Coexpression can be realized by single or multiple carriers.In single-gene vectors coexpression method, each carrier carries one Gene.When using multiple carrier, each carrier is required for different selected markers, compatible replicon and similar Copy number.However, the mark of Escherichia coli is usually antibiotic, in culture, addition Multiple Classes of Antibiotics can influence the life of bacterium Speed long.And above-mentioned strict requirements are also for selection multichip carrier increased difficulty.Compared to single-gene vectors, multigene carrier To can be co-expressed in several gene clonings to single carrier.Under normal circumstances, this carrier needs more complicated polyclonal position Point, the clone of each step is realized using different groups of restriction enzymes.In terms of the transcription of gene, several genes may be located at together Under one promoter, the mRNA for obtaining is polycistron；If the single promoter control of each gene, then obtain MRNA is monocistron.Some research reports, polycistron expression vector can cause different expressing quantities inconsistent, be close to The expressing quantity of promoter is higher than downstream albumen, can so influence must measuring for compound different component.

In monocistron expression vector, each albumen is controlled by single promoter, can control expression, so as to obtain Obtain expression quantity albumen higher.This kind of carrier has：The pETDuet series of Novagen, pET-MCP series and pQLink Series etc..These expression vectors need various restriction endonuclease sites, for clone increased difficulty.Additionally, these are carried at present Body is essentially all in series to be connected into each albumen successively one by one, therefore with the increase of component number needed for compound, The structure time of coexpression vector needs constantly extension.So, building one kind can carry out splicing in parallel by each component in compound , the coexpression vector with multiple transcriptional units be current active demand.

The content of the invention

It is an object of the present invention to provide a kind of complete sets of products for the expression of multielement protein compound.

Complete sets of products provided by the present invention for the expression of multielement protein compound is made up of m core fragment and coexpression vector；

The m is the integer more than or equal to 1；The m core fragment is sequentially named as core fragment according to Arabic numerals A1, core fragment A2 ... and core fragment Am；

The core fragment A1 includes recognition sequence, single base N, the viscosity of IIs types restriction enzyme 1 successively from 5 ' hold End 1x, the DNA fragmentation for building exogenous gene expression box and cohesive end 1y, single base N and the IIs types are limited The recognition sequence of property restriction endonuclease 1；

The core fragment A2 includes recognition sequence, single base N, the viscosity of IIs types restriction enzyme 1 successively from 5 ' hold End 2x, the DNA fragmentation for building exogenous gene expression box and cohesive end 2y, single base N and the IIs types are limited The recognition sequence of property restriction endonuclease 1；

The like,

The recognition sequence including IIs types restriction enzyme 1, single base N are sticky successively from 5 ' hold for the core fragment Am The limitation of end mx, the DNA fragmentation for building exogenous gene expression box, cohesive end my, single base N and the IIs types The recognition sequence of property restriction endonuclease 1；

Each described core fragment by the digestion of IIs types restriction enzyme 1 produce for building exogenous gene expression box DNA fragmentation upstream cohesive terminus,cohesive termini is different and not for building the DNA fragmentation downstream cohesive terminus,cohesive termini of exogenous gene expression box with described Matching；

The coexpression vector is made up of core fragment A and skeleton carrier；

The core fragment A of the coexpression vector includes cohesive end Ax, single base N, IIs types limit successively from 5 ' hold The recognition sequence of property restriction endonuclease 1 processed, riddled basins, recognition sequence, the single base N of the IIs types restriction enzyme 1 With cohesive end Ay；

Skeleton carrier upstream cohesive terminus,cohesive termini that the coexpression vector is produced by the digestion of IIs types restriction enzyme 1 and described Skeleton carrier downstream cohesive terminus,cohesive termini is different and mismatches；

Cohesive end 1y and the core sheet that the core fragment A1 is produced by the digestion of IIs types restriction enzyme 1 Section A2 is matched by the cohesive end 2x that the digestion of IIs types restriction enzyme 1 is produced；

Cohesive end 2y and the core sheet that the core fragment A2 is produced by the digestion of IIs types restriction enzyme 1 Section A3 is matched by the cohesive end 3x that the digestion of IIs types restriction enzyme 1 is produced；

The like；

Cohesive end (m-1) y and institute that the core fragment A m-1 are produced by the digestion of IIs types restriction enzyme 1 Core fragment A m are stated to be matched by the cohesive end mx that the digestion of IIs types restriction enzyme 1 is produced；

Cohesive end Ax and the core fragment that the coexpression vector is produced by the digestion of IIs types restriction enzyme 1 A1 is matched by the cohesive end 1x that the digestion of IIs types restriction enzyme 1 is produced；

Cohesive end Ay and the core fragment that the coexpression vector is produced by the digestion of IIs types restriction enzyme 1 A m are matched by the cohesive end my that the digestion of IIs types restriction enzyme 1 is produced.

In above-mentioned complete sets of products, the DNA fragmentation for building exogenous gene expression box includes that driving is outer successively from 5 ' hold Cohesive end, single base N, IIs type restriction enzyme that the promoter of source gene expression, IIs types restriction enzyme 2 are produced In 2 recognition sequence, riddled basins, the recognition sequence of the restriction enzyme 2, single base N, IIs type are restricted Cohesive end and the terminator of the termination exogenous gene expression that enzyme cutting 2 is produced；

Or, the DNA fragmentation for building exogenous gene expression box includes driving exogenous gene expression successively from 5 ' hold In promoter, ribosome bind site, the cohesive end of the generation of IIs types restriction enzyme 2, single base N, IIs type are restricted The recognition sequence of enzyme cutting 2, riddled basins, the recognition sequence of the restriction enzyme 2, the limitation of single base N, IIs type Property the cohesive end for producing of the restriction endonuclease 2 and terminator that terminates the exogenous gene expression；

Or, the DNA fragmentation for building exogenous gene expression box includes driving exogenous gene expression successively from 5 ' hold Promoter, lactose operon, ribosome bind site, IIs types restriction enzyme 2 produce cohesive end, single base N, The recognition sequence of IIs types restriction enzyme 2, riddled basins, the recognition sequence of the restriction enzyme 2, single base Cohesive end and the terminator of the termination exogenous gene expression that N, IIs type restriction enzyme 2 is produced；

Or, the DNA fragmentation for building exogenous gene expression box includes driving exogenous gene expression successively from 5 ' hold The viscosity end that promoter, lactose operon, ribosome bind site, protein purification label, IIs types restriction enzyme 2 are produced End, the recognition sequence of single base N, IIs type restriction enzyme 2, riddled basins, the knowledge of the restriction enzyme 2 Cohesive end and the terminator of the termination exogenous gene expression that other sequence, single base N, IIs type restriction enzyme 2 are produced.

In above-mentioned complete sets of products, the selection markers that each described core fragment is produced by the digestion of IIs types restriction enzyme 2 Upstream region of gene cohesive terminus,cohesive termini is different with riddled basins downstream cohesive terminus,cohesive termini and mismatches；

Palindrome can not be formed inside the cohesive end that each described IIs types digestion with restriction enzyme is produced；

In addition to the position of description, other parts are free of the recognition sequence of the IIs types restriction enzyme 2 to the core fragment；

In addition to the position of description, other parts are free of the recognition sequence of the IIs types restriction enzyme 1 to the coexpression vector；

The single base N is any one in A, G, C and T.

In above-mentioned complete sets of products, the IIs types restriction enzyme 1 is BsmBI；

The IIs types restriction enzyme 2 is BsaI；

The riddled basins are ccdB genes.

In above-mentioned complete sets of products,

The recognition sequence of the IIs types restriction enzyme 1 is as shown in sequence 1 in sequence table；

The recognition sequence of the IIs types restriction enzyme 2 is as shown in sequence 2 in sequence table.

In above-mentioned complete sets of products, the m is 1,2,3,4,5 or 6；

When m is 1, complete sets of products is made up of core fragment A1 and the coexpression vector；

When m is 2, complete sets of products is made up of core fragment A2, core fragment A3 and the coexpression vector；

When m is 3, complete sets of products is by core fragment A2, core fragment A4, core fragment A5 and the coexpression vector group Into；

When m is 4, complete sets of products is by core fragment A2, core fragment A4, core fragment A6, core fragment A7 and described Coexpression vector is constituted；

When m is 5, complete sets of products is by core fragment A2, core fragment A4, core fragment A6, core fragment A8, core Fragment A9 and the coexpression vector are constituted；

When m is 6, complete sets of products is by core fragment A2, core fragment A4, core fragment A6, core fragment A8, core Fragment A10, core fragment A11 and the coexpression vector are constituted；

Cohesive end 1x in the core fragment A1 is as shown in sequence 3 in sequence table；

Cohesive end 1y in the core fragment A1 is as shown in sequence 4 in sequence table；

Cohesive end 2x in the core fragment A2 is as shown in sequence 5 in sequence table；

Cohesive end 2y in the core fragment A2 is as shown in sequence 6 in sequence table；

Cohesive end 3x in the core fragment A3 is as shown in sequence 7 in sequence table；

Cohesive end 3y in the core fragment A3 is as shown in sequence 8 in sequence table；

Cohesive end 4x in the core fragment A4 is as shown in sequence 9 in sequence table；

Cohesive end 4y in the core fragment A4 is as shown in sequence 10 in sequence table；

Cohesive end 5x in the core fragment A5 is as shown in sequence 11 in sequence table；

Cohesive end 5y in the core fragment A5 is as shown in sequence 12 in sequence table；

Cohesive end 6x in the core fragment A6 is as shown in sequence 13 in sequence table；

Cohesive end 6y in the core fragment A6 is as shown in sequence 14 in sequence table；

Cohesive end 7x in the core fragment A7 is as shown in sequence 15 in sequence table；

Cohesive end 7y in the core fragment A7 is as shown in sequence 16 in sequence table；

Cohesive end 8x in the core fragment A8 is as shown in sequence 17 in sequence table；

Cohesive end 8y in the core fragment A8 is as shown in sequence 18 in sequence table；

Cohesive end 9x in the core fragment A9 is as shown in sequence 19 in sequence table；

Cohesive end 9y in the core fragment A9 is as shown in sequence 20 in sequence table；

Cohesive end 10x in the core fragment A10 is as shown in sequence 21 in sequence table；

Cohesive end 10y in the core fragment A10 is as shown in sequence 22 in sequence table；

Cohesive end 11x in the core fragment A11 is as shown in sequence 23 in sequence table；

Cohesive end 11y in the core fragment A11 is as shown in sequence 24 in sequence table；

Cohesive end Ax in the core fragment A is as shown in sequence 25 in sequence table；

Cohesive end Ay in the core fragment A is as shown in sequence 26 in sequence table.

The sequence at that template DNA chain from 5 ' to 3 ' end above the core fragment that above-mentioned cohesive end sequence refers both to as shown in Figure 1.

It is a further object to provide a kind of complete carrier for the expression of multielement protein compound.

Provided by the present invention for multielement protein compound expression complete carrier by m single-gene expression vector and above-mentioned coexpression Carrier is constituted；

The m is the integer more than or equal to 1；The m single-gene expression vector is sequentially named as 1 according to Arabic numerals Number single-gene expression vector, No. 2 single-gene expression vectors ... and m single-gene expression vectors；

No. 1 single-gene expression vector is that will be obtained in the core fragment A1 insertion skeleton carriers in claim 1 Carrier；

No. 2 single-gene expression vectors are that will be obtained in the core fragment A2 insertion skeleton carriers in claim 1 Carrier；

The like；

The m single-genes expression vector is that will be obtained in the core fragment Am insertion skeleton carriers in claim 1 Carrier.

In above-mentioned complete carrier, the skeleton carrier in the single-gene expression vector does not contain the identification of IIs types restriction enzyme 2 Sequence.

In above-mentioned complete carrier, the m is 1,2,3,4,5 or 6；

When m is 1, complete carrier is made up of No. 1 single-gene expression vector and above-mentioned coexpression vector；

When m is 2, complete carrier is by No. 2 single-gene expression vectors, No. 3 single-gene expression vectors and above-mentioned coexpression vector group Into；

When m is 3, complete carrier is by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 5 single-gene expression vectors Constituted with above-mentioned coexpression vector；

When m is 4, complete carrier by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 6 single-gene expression vectors, No. 7 single-gene expression vectors and above-mentioned coexpression vector are constituted；

When m is 5, complete carrier by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 6 single-gene expression vectors, No. 8 single-gene expression vectors, No. 9 single-gene expression vectors and above-mentioned coexpression vector composition；

When m is 6, complete carrier by No. 2 single-gene expression vectors, No. 4 single-gene expression vectors, No. 6 single-gene expression vectors, No. 8 single-gene expression vectors, No. 10 single-gene expression vectors, No. 11 single-gene expression vectors and above-mentioned coexpression vector composition；

No. 1 single-gene expression vector is that sequence 27 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 2 single-gene expression vectors are that sequence 28 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 3 single-gene expression vectors are that sequence 29 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 4 single-gene expression vectors are that sequence 30 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 5 single-gene expression vectors are that sequence 31 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 6 single-gene expression vectors are that sequence 32 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 7 single-gene expression vectors are that sequence 33 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 8 single-gene expression vectors are that sequence 34 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 9 single-gene expression vectors are that sequence 35 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 10 single-gene expression vectors are that sequence 36 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 11 single-gene expression vectors are that sequence 37 is inserted between SphI the and XhoI recognition sequences of expression vector A, And keep the other sequences of expression vector A constant, the carrier for obtaining；

The coexpression vector is that sequence 38 is inserted between SphI the and XhoI recognition sequences of expression vector B, and keeps table Other sequences up to carrier B are constant, the carrier for obtaining；

The expression vector A is pET-28b；The expression vector B is what BsmBI and BsaI recognition sequences were fallen by mutation PET-15b carriers.

It is a still further object of the present invention to provide a kind of method of the recombinant vector for building coexpression multielement protein compound.

The method of the recombinant vector of the structure coexpression multielement protein compound that the present invention is provided is built using the said goods , it is following (A) or (B)：

(A) comprise the following steps：

1) encoding gene of several foreign proteins is loaded into above-mentioned single-gene expression vector respectively, respectively obtains several tables Up to the single-gene expression vector of foreign protein；

2) by the single-gene expression vector and above-mentioned coexpression vector IIs type restriction enzymes of several expression foreign proteins Enzyme 1 carries out digestion and connection, obtains connection product, the recombinant vector of the multielement protein compound that is as co-expressed；

(B) comprise the following steps：

1) encoding gene of several foreign proteins is loaded into above-mentioned core fragment respectively, respectively obtains several expression external sources The single-gene core fragment of albumen；

2) by the single-gene core fragment and above-mentioned coexpression vector IIs type restriction enzymes of several expression foreign proteins Enzyme 1 carries out digestion and connection, obtains connection product, the recombinant vector of the multielement protein compound that is as co-expressed.

In the above method, the method for the loading is：By the single-gene expression vector, the encoding gene IIs of foreign protein Type restriction enzyme 2 and ligase carry out digestion and connection simultaneously, the encoding gene of the foreign protein is replaced single base Because of the screening-gene in expression vector, that is, realize loading.

In the above method,

The IIs types restriction enzyme 1 is BsmBI；

The IIs types restriction enzyme 2 is BsaI.

Feasible to operate in the above method, the upstream and downstream two ends of the core fragment also need to add protection base.

In the above method, described several express the single-gene expression vector of foreign proteins by the single-gene table of expression foreign protein 1 Up to carrier, the single-gene expression vector of expression foreign protein 2, the single-gene expression vector of expression foreign protein 3, expression external source The single-gene expression vector of albumen 4 and the single-gene expression vector composition of expression foreign protein 5.

The single-gene expression vector of the expression foreign protein 1 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps25 eggs The Partial Fragment of white encoding gene replaces the riddled basins in above-mentioned No. 2 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 2 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps30 eggs White encoding gene replaces the riddled basins in above-mentioned No. 4 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 3 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps50 eggs White encoding gene replaces the riddled basins in above-mentioned No. 6 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 4 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps60 eggs The Partial Fragment of white encoding gene replaces the riddled basins in above-mentioned No. 8 single-gene expression vectors；

The single-gene expression vector of the expression foreign protein 5 is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Set1 albumen The Partial Fragment of encoding gene replace riddled basins in above-mentioned No. 9 single-gene expression vectors.

In the above method,

The Partial Fragment sequence of the encoding gene of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps25 albumen is sequence 39；

The coding gene sequence of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps30 albumen is sequence 41；

The coding gene sequence of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps50 albumen is sequence 43；

The Partial Fragment sequence of the encoding gene of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps60 albumen is sequence 45 In 25-1467；

The Partial Fragment sequence of the encoding gene of the Saccharomyces Cerevisiae in S accharomyces cerevisiae Set1 albumen is in sequence 47 19-576.

Final object of the present invention is to provide a kind of method of the multielement protein compound that is co-expressed.

The method of the coexpression multielement protein compound that the present invention is provided comprises the following steps：Build according to the method described above and obtain common table Up to the recombinant vector of multielement protein compound；The recombinant vector of the coexpression multielement protein compound is transformed into Escherichia coli bacterium In strain, the correct clone of identification extracts plasmid；The plasmid is transferred in expression system, coexpression is realized.

In the above method or above-mentioned complete carrier or above-mentioned complete sets of products, the matching is complementary pairing, i.e. cohesive end (m-1) y Complementary strand with cohesive end mx can be with complementary pairing.

The invention provides a kind of complete carrier for the expression of multielement protein compound and its application.The complete carrier is divided into single base Because of expression vector and coexpression received vector two parts, single-gene cloning vector is kalamycin resistance, promoter upstream and termination There are BsmBI restriction enzyme sites in sub- downstream, and ccdB selectable marker genes are inserted between promoter and terminator, and there is BsaI ccdB both sides Restriction enzyme site；And the received vector that is co-expressed selects ccdB alternatively to mark for amicillin resistance, also, ccdB both sides have BsmBI restriction enzyme sites.Proved by testing：Albumen composition each component can be cloned into different single-gene expression vectors parallel, Then single-gene expression vector and coexpression vector are carried out into assembling reaction in a pipe, you can obtain albumen composition coexpression Carrier.The present invention can make digestion and be connected in same pipe to carry out by the design of IIs type restriction enzymes, middle not need Digestion products purifying etc. is manipulated, meanwhile, design of the invention can be once tested the transcriptional units of multiple albumen while being assembled into On coexpression vector, therefore the assembling of coexpression vector highly shortened clone-time, and different resistances and ccdB screenings, The efficiency of clone is improve, in addition, coexpression vector transcribes out monocistronic mRNA, expressing quantity can be improved.

Brief description of the drawings

Fig. 1 is single-gene expression vector structural representation.Wherein, BioBrick prefix：Biological brick prefix sequence； BsmBI:BsmBI recognition sequences；fx:BsmBI cleavage sequences；T7 promoter：T7 promoters；lac operator：Breast Sugared operator；RBS:Ribosome bind site；tag：Protein purification label；BsaI:BsaI recognition sequences；ccdB:Toxin PROTEIN C cdB genes；T7 terminator:T7 terminators；fy:BsmBI cleavage sequences；BioBrick suffix：Biological brick Suffix array.

Fig. 2 is albumen composition coexpression received vector structural representation.Wherein, BioBrick prefix：Biological brick prefix sequence Row；BsmBI:BsmBI recognition sequences；ccdB:Toxin protein CcdB genes；BioBrick suffix：Biological brick suffix sequence Row.

Fig. 3 is single-gene expression vector establishment flow chart.

Fig. 4 is that compound coexpression received vector builds flow chart.

Fig. 5 is the schematic diagram that albumen composition component is cloned into single-gene expression vector.

Fig. 6 is clone's schematic diagram of albumen composition coexpression vector.

Fig. 7 is the SDS-PAGE images through molecular-exclusion chromatography after purification, wherein digitized representation collecting pipe numbering.

Specific embodiment

Experimental technique used in following embodiments is conventional method unless otherwise specified.

Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.

The construction method of the complete carrier for the expression of multielement protein compound in following embodiments specifically includes following steps：

1st, m core fragment is designed；

M core fragment be sequentially named as according to Arabic numerals core fragment A1, core fragment A2 ... and core fragment Am；

Core fragment A1 includes recognition sequence, single base N, the cohesive end of IIs types restriction enzyme 1 successively from 5 ' hold 1x, the DNA fragmentation for building exogenous gene expression box, cohesive end 1y, single base N and recognition sequence；

Core fragment A2 includes recognition sequence, single base N, the cohesive end of IIs types restriction enzyme 1 successively from 5 ' hold 2x, the DNA fragmentation for building exogenous gene expression box, cohesive end 2y, single base N and recognition sequence；

The like,

Core fragment Am includes recognition sequence, single base N, the cohesive end of IIs types restriction enzyme 1 successively from 5 ' hold Mx, the DNA fragmentation for building exogenous gene expression box, cohesive end my, single base N and recognition sequence；

The DNA pieces for building exogenous gene expression box that each core fragment is produced by the digestion of IIs types restriction enzyme 1 Duan Shangyou cohesive terminus,cohesive terminis are different and not complementary with for building the DNA fragmentation downstream cohesive terminus,cohesive termini of exogenous gene expression box；

Coexpression vector is made up of core fragment A and skeleton carrier；

The core fragment of coexpression vector includes cohesive end Ax, the single base of IIs types restriction enzyme 1 successively from 5 ' hold N, recognition sequence, riddled basins, the recognition sequence of IIs types restriction enzyme 1, single base N and cohesive end Ay；

Skeleton carrier upstream cohesive terminus,cohesive termini and skeleton carrier downstream that coexpression vector is produced by the digestion of IIs types restriction enzyme 1 Cohesive terminus,cohesive termini is different and not complementary；

Cohesive end 1y that core fragment A1 is produced by the digestion of IIs types restriction enzyme 1 and core fragment A2 are by IIs The cohesive end 2x matchings that the digestion of type restriction enzyme 1 is produced；

Cohesive end 2y that core fragment A2 is produced by the digestion of IIs types restriction enzyme 1 and core fragment A3 are by IIs The cohesive end 3x matchings that the digestion of type restriction enzyme 1 is produced；

The like；

Cohesive end (m-1) the y downstreams cohesive terminus,cohesive termini that core fragment A m-1 are produced by the digestion of IIs types restriction enzyme 1 Matched by the cohesive end mx that the digestion of IIs types restriction enzyme 1 is produced with core fragment A m；

Cohesive end Ax that coexpression vector is produced by the digestion of IIs types restriction enzyme 1 and core fragment A1 are by IIs The cohesive end 1x matchings that the digestion of type restriction enzyme 1 is produced；

Cohesive end Ay that coexpression vector is produced by the digestion of IIs types restriction enzyme 1 and core fragment A m are by IIs The cohesive end my matchings that the digestion of type restriction enzyme 1 is produced.

For build the DNA fragmentation of exogenous gene expression box from 5 ' ends rise include successively driving exogenous gene expression promoter, Cohesive end, the limitation of single base N, IIs type that lactose operon, ribosome bind site, IIs types restriction enzyme 2 are produced Property the recognition sequence of restriction endonuclease 2, riddled basins, the recognition sequence of restriction enzyme 2, the limitation of single base N, IIs type Property restriction endonuclease 2 produce cohesive end and terminate exogenous gene expression terminator；

The riddled basins upstream cohesive terminus,cohesive termini and screening that each core fragment is produced by the digestion of IIs types restriction enzyme 2 are marked Note downstream of gene cohesive terminus,cohesive termini is different and not complementary；

Palindrome can not be formed inside the cohesive end that each IIs types digestion with restriction enzyme is produced；

Single base N is any one in A, G, C and T.

2nd, the structure of single-gene expression vector

During above-mentioned m core fragment inserted into skeleton carrier respectively, each single-gene expression vector is respectively obtained.

Embodiment 1, the structure of the complete carrier expressed for multielement protein compound and its application

First, the structure of single-gene expression vector

The present embodiment constructs 11 single-gene expression vectors altogether, specific as follows：

No. 1 single-gene expression vector is that sequence 27 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 2 single-gene expression vectors are that sequence 28 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 3 single-gene expression vectors are that sequence 29 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 4 single-gene expression vectors are that sequence 30 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 5 single-gene expression vectors are that sequence 31 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 6 single-gene expression vectors are that sequence 32 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 7 single-gene expression vectors are that sequence 33 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 8 single-gene expression vectors are that sequence 34 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 9 single-gene expression vectors are that sequence 35 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 10 single-gene expression vectors are that sequence 36 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, And keep the other sequences of expression vector A constant, the carrier for obtaining；

No. 11 single-gene expression vectors are that sequence 37 is inserted between SphI the and XhoI recognition sequences of pET-28b carriers, and Keep the other sequences of expression vector A constant, the carrier for obtaining；

The construction method of above-mentioned each single-gene expression vector is as shown in figure 3, comprise the following steps that：

1st, No. 1 structure of single-gene expression intermediate carrier

(1) synthesis of characteristic sequence

5‘-CAGGAAACAGCTATGACGCATGCGAATTCGCGGCCGCTTCTAGAGCGTCTCATG GATAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGtAATAATT TTGTTTAACTTTAAGAAGGAGATATACGATGCGAGACCATGCGGTCTCCTAGCTAGCATA ACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTCACTGAGACGTACTAGTA GCGGCCGCTGCAGCTCGAGACTGGCCGTCGTTTTAC-3 ' (sequence 1)；

Using gene design website (http:// 54.235.254.95/gd/) Building Block Design (constant length Overlap function), the nucleic acid molecule shown in list entries 3 obtains following oligos:

5’-CAGGAAACAGCTATGACGCATGCGAATTCGCGGCCGCTTCTAGAGCGTCTC-3’；

5’- GCTCACAATTCCCCTATAGTGAGTCGTATTATCCATGAGACGCTCTAGAAGCGGC-3’；

5’-CTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGTAATAATTTTGTT TAACTTTAAG-3’；

5’- GTCTCGCATCGTATATCTCCTTCTTAAAGTTAAACAAAATTATTACTAGAGGGGAA-3’；

5’- AGAAGGAGATATACGATGCGAGACCATGCGGTCTCCTAGCTAGCATAACCCCT-3’；

5’- CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGCTAGGAG-3’；

5’-AACGGGTCTTGAGGGGTTTTTTGTCACTGAGACGTACTAGTAGCGGCCGCTG-3’；

5’-GTAAAACGACGGCCAGTCTCGAGCTGCAGCGGCCGCTACTAGTAC-3’。

(2) PCR amplifications

PCR is carried out in two steps：

First step PCR is to enter performing PCR amplification by template of the characteristic sequence of above-mentioned steps (1) synthesis, obtains first step PCR Amplified production.

First step PCR reaction systems (final concentration)：dNTP(GenStar A114-01)0.2mM、1xQ5reaction buffer (NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S) 0.02units/ μ l, primer (eventually Concentration is 30nM).First step PCR reaction conditions are as follows：98 DEG C, 2min, 55 DEG C, 30s；72℃,20s；1 circulation； 98℃,10s,69℃,30s,72℃,20s；5 circulations；98℃,10s,65℃,30s,72℃,20s；5 circulations；98℃,10 s,61℃,30s,72℃,20s；20 circulations；72℃2min；10 DEG C of preservations.

Second step PCR is template to dilute 5 times of first step pcr amplification product, with M13Forward and M13Reverse Universal primer is expanded into performing PCR amplification, obtains second step pcr amplification product.

Second step PCR reaction systems (final concentration)：dNTP(GenStar A114-01)0.2mM、1xQ5reaction buffer (NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S) 0.02units/ μ l, primer (final concentration is 0.5mM), template be 5 times of above-mentioned dilution on the basis of dilute 10 times again.

Second step PCR reaction conditions are as follows：98℃2min,55℃30s,72℃,20s；1 circulation；98℃20s；55℃,30s； 72℃,20s；25 circulations；72℃3min；10 DEG C of preservations.

Second step pcr amplification product is analyzed with agarose gel electrophoresis, purpose band is reclaimed.

(3) with SphI (SphI-HF NEB R3182L) and XhoI (NEB R0146L) to second step pcr amplification product Double digestion is carried out with pET-28b carriers (Novagen companies), is connected, obtain recombinant vector, be named as No. 1 single base Because of expression intermediate carrier, and bacillus coli DH 5 alpha is converted, sequencing is sent after being identified through digestion.

Sequencing result shows：Between No. 1 single-gene expression intermediate carrier is SphI the and XhoI restriction enzyme sites by pET-28b carriers DNA fragmentation replace with DNA molecular shown in sequence 49 and keep the constant carrier for obtaining of pET-28b carrier other sequences.

2nd, 2-11 single-genes express the structure of intermediate carrier

It is template with No. 1 single-gene expression intermediate carrier, enters performing PCR with the corresponding primer of 2-11 carriers in table 1 respectively and expand Increase, respectively obtain pcr amplification product (cohesive end direction is the direction according to support template chain 5 ' -3 ').

The primer of table 1, the structure of 2-11 single-genes expression intermediate carrier

PCR reaction systems (final concentration)：dNTP(GenStar A114-01)0.2mM、1xQ5reaction buffer(NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S) 0.02units/ μ l, primer (eventually it is dense Degree be 0.5mM), plasmid template 30ng.PCR reaction conditions are as follows：98℃,2min；1 circulation；98 DEG C, 30s, 54 DEG C, 30s, 72 DEG C, 20s；30 circulations；72℃3min；10 DEG C of preservations.

Pcr amplification product is analyzed with agarose gel electrophoresis respectively, reclaims purpose band, respectively obtain PCR recovery products. Reclaimed with EcoRI (EcoRI-HF NEB R3101L) and SpeI (SpeI-HF NEB R3133L) double digestion PCR respectively and produced Thing and No. 1 single-gene expression intermediate carrier, connection respectively obtain recombinant vector, 2-11 single-gene tables are named as respectively Up to intermediate carrier, and bacillus coli DH 5 alpha is converted, sequencing is sent after being identified through digestion.

Sequencing result shows：No. 2 single-gene expression intermediate carriers are the EcoRI and SpeI that No. 1 single-gene is expressed intermediate carrier DNA fragmentation between recognition sequence replaces with the DNA molecular shown in sequence 50 in sequence table, and keeps No. 1 single-gene expression The constant carrier of the other sequences of intermediate carrier；

No. 3 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 51 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 4 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 52 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 5 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 53 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 6 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 54 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 7 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 55 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 8 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 56 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 9 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 57 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 10 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 58 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence；

No. 11 single-gene expression intermediate carriers are by between No. 1 EcoRI and SpeI recognition sequence of single-gene expression intermediate carrier DNA fragmentation replaces with the DNA molecular shown in sequence 59 in sequence table, and keeps No. 1 single-gene expression intermediate carrier other The constant carrier of sequence.

3rd, the structure of 1-11 single-genes expression vector

The sequence (inside is free of BsaI recognition sequences) containing ccdB genes in artificial synthesized sequence table shown in sequence 60, and will Between its BsaI (BsaI-HF NEB R3535L) recognition sequence for being inserted respectively into 1-11 single-genes expression intermediate carrier, respectively Recombinant vector is obtained, 1-11 single-genes expression vector (sequence signature is shown in Fig. 1) is named as respectively, and converted respectively Escherichia coli OneccdB Survival^TM2 T1R, sequencing is sent after being identified through digestion.

Sequence verification shows：No. 1 single-gene expression vector is to know SphI and XhoI that sequence 27 is inserted into pET-28b carriers Between other sequence, and keep the other sequences of expression vector A constant, the carrier for obtaining；

2nd, the structure of coexpression received vector

Coexpression vector is that sequence 38 is inserted into pET-15b carriers (BsaI and BsmBI recognition sequences are mutated on carrier) SphI and XhoI recognition sequences between, and keep the other sequences of expression vector B constant, the carrier for obtaining.Coexpression connects The structural representation of body is recorded as shown in Fig. 2 the construction method of coexpression received vector is as shown in figure 4, comprise the following steps that：

1st, BsaI the and BsmBI sites on pET-15b are removed

With pET-15b carriers (Novagen companies) as template, following three pairs of primers are respectively adopted and enter performing PCR amplification, respectively Obtain pcr amplification product.

YQO001:5’-GCTAGGTCTCGCACAGCTTGTCTGTAAGCGGATGCCG-3’；

YQO002:5’-CGATGGTCTCCTGTGACCTTCTCCGGGAGCTGCATGTG-3’；

YQO003:5’-GCTAGGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCC-3’；

YQO004:5’-GCTAGGTCTCACCAGTGATACGGGCAACAGCTGATTGCCC-3’；

YLO006:5’-CTGCAATGATACCGCggtctcgactacCACGCTCACCGG-3’；

YLO005:5’-CCGGTGAGCGTGggtctcgtagtcGCGGTATCATTGCAG-3’。

PCR reaction systems (final concentration)：dNTP(GenStar A114-01)0.2mM、1xQ5reaction buffer(NEB B9027S)、Q5(High-Fidelity DNA Polymerase NEB M0491S) 0.02units/ μ l, primer (final concentration Be 0.5mM), plasmid template 30ng.PCR reaction conditions are as follows：98℃,2min；1 circulation；98 DEG C, 30s, 54 DEG C, 30s, 72 DEG C, 1min；30 circulations；72℃7min；10 DEG C of preservations.

Pcr amplification product is analyzed with agarose gel electrophoresis respectively, reclaims purpose band, obtain 3 PCR recovery products； With 3 PCR recovery products of BsaI digestions, conventional connection is carried out after glue reclaim purpose band, obtains recombinant vector, and by its Conversion bacillus coli DH 5 alpha, sequencing is sent after being identified through digestion.

2nd, ccdB genes are inserted

With the ccdB genes in sequence 60 as template, performing PCR is entered using following primer and is expanded, obtain pcr amplification product.

YQO040:CATGCATGCGAATTCGCGGCCGCTTCTAGAGTGGAAGAGACGCTCTAGAG GATCCGGCTTAC；

YQO041: GGCTCGAGCTGCAGCGGCCGCTACTAGTAGTGATGAGACGGTCGACCTGCAGACTGGCT G。

PCR reaction systems (final concentration)：DNTP(GENSTAR A114-01)0.2MM、1XQ5REACTION BUFFER (NEB B9027S)、Q5(HIGH-FIDELITY DNA POLYMERASE NEB M0491S) 0.02UNITS/ Μ L, primer (final concentration is 0.5MM), plasmid template 30NG.PCR reaction conditions are as follows：98℃,2min； 1 circulation；98 DEG C, 30s, 54 DEG C, 30s, 72 DEG C, 1min；30 circulations；72℃7min；10 DEG C of preservations.

The recombinant vector for being obtained with SphI and XhoI double digestion PCR recovery products and above-mentioned steps 1 respectively, connection, is total to Expression received vector, and bacillus coli DH 5 alpha is converted, send sequencing after being identified through digestion.

Sequence verification shows：Between coexpression received vector is SphI the and XhoI restriction enzyme sites of the recombinant vector for obtaining step 1 DNA fragmentation replace with the sequence (inside is without BsaI recognition sequences) containing ccdB genes in sequence table shown in sequence 60, And keep the constant carrier for obtaining of other sequences of recombinant vector that step 1 obtains.

3rd, using single-gene expression vector and coexpression received vector expressing protein compound

1st, the structure of the single-gene expression vector of expression foreign protein

The single-gene expression vector of expression foreign protein is that will express the encoding gene of foreign protein or part thereof fragment replacement step one Single-gene expression vector in the carrier that obtains of riddled basins.Albumen composition in the present embodiment is by A, B, C, D Constituted with five components of E, the single-gene expression vector of expression foreign protein of the invention has 5, specific as follows：

The single-gene expression vector of expression foreign protein A is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps25 albumen The Partial Fragment of encoding gene replaces the riddled basins in above-mentioned No. 2 single-gene expression vectors；

The single-gene expression vector of expression foreign protein B is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps30 albumen Encoding gene replaces the riddled basins in above-mentioned No. 4 single-gene expression vectors；

The single-gene expression vector of expression foreign protein C is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps50 albumen Encoding gene replaces the riddled basins in above-mentioned No. 6 single-gene expression vectors；

The single-gene expression vector of expression foreign protein D is by Saccharomyces Cerevisiae in S accharomyces cerevisiae Cps60 albumen The Partial Fragment of encoding gene replaces the riddled basins in above-mentioned No. 8 single-gene expression vectors；

The single-gene expression vector of expression foreign protein E is by the volume of Saccharomyces Cerevisiae in S accharomyces cerevisiae Set1 albumen The Partial Fragment of code gene replaces the riddled basins in above-mentioned No. 9 single-gene expression vectors.

The building process of the single-gene expression vector of above-mentioned each expression foreign protein is specific as follows：

(1) structure of the single-gene expression vector of expression foreign protein A

With genomic DNA (the BioVector NTCC Inc, article No. of saccharomyces cerevisiae BY4741：ATCC 201388D-5) be Template, enters performing PCR and expands using YQO052 and YQO053 primers, obtains pcr amplification product, and as component A (makes Brewer yeast Saccharomyces cerevisiae Cps25 protein coding genes Partial Fragment), sequence in its nucleotide sequence such as sequence table Shown in row 23.Primer sequence is as follows：

YQO052：5’-AGCGTGGGTCTCAGATGAATGTGAACCTTGCCGCGACGG-3’；YQO053：5’- GTGCTGGGTCTCGGCTATTTACTAGCATTACTCTCTTTTTCTCC-3’。

PCR reaction systems (final concentration)：dNTP(GenStar A114-01)0.2mM、1xbuffer for KOD-Plus- (TOYOBO)、MgSO₄(TOYOBO) 2mM, KOD-Plus- (TOYOBO) 0.02units/ μ l, primer are (dense eventually Degree be 0.5mM), genomic templates 150ng.PCR reaction conditions are as follows：94℃,4min；1 circulation；94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 40s；30 circulations；68℃7min；10 DEG C of preservations.

Pcr amplification product is analyzed with agarose gel electrophoresis, purpose band is reclaimed, product is recycled.

No. 2 single-gene expression vectors (20ng) prepared by recovery product (100ng) and above-mentioned steps one are added to reaction system Middle reaction, obtains product A (expressing the single-gene expression vector of foreign protein A).Reaction system：5units BsaI (BsaI-HF NEB R3535L), 1U T4DNA ligases (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solutions (Thermo Scientific B69)；Response procedures：37 DEG C, 60min；50 DEG C, 15min； 80 DEG C, 15min；10 DEG C of preservations.

Product A is directly converted into bacillus coli DH 5 alpha, sequencing is sent after being identified through digestion.

Show through sequencing：The single-gene expression vector of expression foreign protein A is by No. 2 BsaI digestions positions of single-gene expression vector DNA fragmentation between point replaces with the volume of the component A (Cps25 protein coding genes Partial Fragment) shown in sequence 39 in sequence Code gene and the carrier that obtains after keeping No. 2 single-gene expression vector other sequences constant.The amino acid sequence of the component A of expression As shown in sequence 40 in sequence table.

(2) structure of the single-gene expression vector of expression foreign protein B

There is BsmBI and BsaI restriction enzyme site in component B, two pairs of primers of design are expanded to remove BsmBI enzymes Enzyme site.

Genomic DNA with saccharomyces cerevisiae BY4741 is respectively adopted primer YQO058 and YQO060, primer as template YQO061 and YQO059 enter performing PCR amplification, respectively obtain pcr amplification product.

YQO058：5’-AgcgtgGGTCTCaGATGTTCCAGTTTGTTACTCCTGTG-3’；

YQO059:5’-GtgctgGGTCTCgGCTAAACCCATCTCCATAAACAGC-3’；

YQO060:5’-AgcgtgGGTCTCGTTTCTGCATCAAAGATCCGTATGAG-3’；

YQO061:5’-GtgctgGGTCTCaGAAACGGGCCATTGTTTGAAG-3’。

PCR reaction systems (final concentration)：dNTP(GenStar A114-01)0.2mM、1xbuffer for KOD-Plus- (TOYOBO)、MgSO₄(TOYOBO) 2mM, KOD-Plus- (TOYOBO) 0.02units/ μ l, primer are (dense eventually Degree be 0.5mM), genomic templates 150ng.

The PCR reaction conditions of pair of primers are as follows：94℃,5min；1 circulation；94 DEG C, 30s, 45 DEG C, 30s, 68 DEG C, 1min；10 circulations；94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 1min；20 circulations；68℃7min；10 DEG C of preservations.

The PCR reaction conditions of second pair of primer are as follows：94℃,4min；1 circulation；94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 2min；30 circulations；68℃7min；10 DEG C of preservations.

Two pcr amplification products are analyzed with agarose gel electrophoresis, purpose band is reclaimed, two recovery products are obtained.

By two recovery products (larger fragment 100ng, another and its equimolar number) and No. 4 single-gene expression vectors (20ng) Reaction in reaction system is added to, product B (expressing the single-gene expression vector of foreign protein B) is obtained.Reaction system： 2units BsaI (BsaI-HF NEB R3535L), 0.5U T4DNA ligases (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solutions (Thermo Scientific B69)；Response procedures：37 DEG C, 5min；1 circulation；37 DEG C, 5min, 25 DEG C of 5min；3 circulations；50 DEG C, 5min；80 DEG C, 5min；1unit is added after cooling Ligase；25℃40min；10 DEG C of preservations.

Product B is directly converted into bacillus coli DH 5 alpha, sequencing is sent after being identified through digestion.

Show through sequencing：The single-gene expression vector of expression foreign protein B is by No. 4 BsaI digestions positions of single-gene expression vector DNA fragmentation between point replaces with the encoding gene (BsmBI of the component B (Cps30 albumen) shown in sequence 41 in sequence Point is mutated) keep No. 4 single-gene expression vector other sequences constant after the carrier that obtains.The amino acid sequence of the component B of expression Row are as shown in sequence 42 in sequence table.

(3) structure of the single-gene expression vector of expression foreign protein C

Genomic DNA with saccharomyces cerevisiae BY4741 enters performing PCR and expands as template, using YQO056 and YQO057 primers Increase, obtain pcr amplification product, as component C (encoding gene of Cps50 albumen), sequence in its nucleotide sequence such as sequence table Shown in row 27.

YQO056：5’-agcgtgGGTCTCaGATGAACATCCTTTTACAGGATCC-3’；

YQO057:5’-GtgctgGGTCTCgGCTATGATGACTGCATCTTAATTATC-3’。

PCR reaction conditions are as follows：94℃,4min；1 circulation；94 DEG C, 30s, 55 DEG C, 30s, 68 DEG C, 2min；30 Circulation；68℃7min；10 DEG C of preservations.

Recovery product (100ng) and No. 6 single-gene expression vectors (20ng) are added in reaction system and are reacted, reacted Product C (expresses the single-gene expression vector of foreign protein C).Reaction system：2units BsaI(BsaI-HF NEB R3535L), 0.5U T4DNA ligases (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solutions (Thermo Scientific B69)；Response procedures：37 DEG C, 5min；1 circulation；37 DEG C, 5min, 25℃5min；3 circulations；50 DEG C, 5min；80 DEG C, 5min；1unit ligases are added after cooling；25℃40min；10 DEG C of guarantors Deposit.

Product C is directly converted into bacillus coli DH 5 alpha, sequencing is sent after being identified through digestion.

Show through sequencing：The single-gene expression vector of expression foreign protein C is by No. 6 BsaI digestions positions of single-gene expression vector The encoding gene that DNA fragmentation between point replaces with the component C (Cps50 albumen) shown in sequence 43 in sequence keeps No. 6 lists The carrier obtained after expression vector other sequences are constant.Sequence 44 in the amino acid sequence of the component C of expression such as sequence table It is shown.

(4) structure of the single-gene expression vector of expression foreign protein D

Genomic DNA with saccharomyces cerevisiae BY4741 enters performing PCR and expands as template, using YQO054 and YQO055 primers Increase, obtain pcr amplification product, as component D (Cps60 protein coding genes Partial Fragments and N-terminal melts with FLAG Close label), its nucleotide sequence is as shown in sequence 29 in sequence table.

YQO054： 5’-AGCGTGGGTCTCAGATGGATTATAAAGACGATGATGACAAGGAAGGGAAGAGACCTA ATT-3’；

YQO055：5’-GTGCTGGGTCTCGGCTATTGCTGTAGGGCAATTTGCTCCAAC-3’.

PCR reaction conditions are as follows：94℃,5min；1 circulation；94 DEG C, 30s, 45 DEG C, 30s, 68 DEG C, 2min30s；5 Individual circulation；94 DEG C, 30s, 50 DEG C, 30s, 68 DEG C, 2min30s；5 circulations；94 DEG C, 30s, 52 DEG C, 30s, 68 DEG C, 2min30s； 20 circulations；68℃7min；10 DEG C of preservations.

Recovery product (100ng) and No. 8 single-gene expression vectors (20ng) are added in reaction system and are reacted, reacted Product D (expresses the single-gene expression vector of foreign protein D).Reaction system：2units BsaI(BsaI-HF NEB R3535L), 0.5U T4DNA ligases (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligase buffer solutions (Thermo Scientific B69)；Response procedures：37 DEG C, 5min；1 circulation；37 DEG C, 5min, 25℃5min；3 circulations；50 DEG C, 5min；80 DEG C, 5min；1unit ligases are added after cooling；25℃40min；10 DEG C of guarantors Deposit.

Product D is directly converted into bacillus coli DH 5 alpha, sequencing is sent after being identified through digestion.

Show through sequencing：The single-gene expression vector of expression foreign protein D is by No. 8 BsaI digestions positions of single-gene expression vector DNA fragmentation between point replaces with component D (Cps60 protein coding genes Partial Fragment and the N shown in sequence 45 in sequence End carries FLAG fusion tags) encoding gene keep No. 8 single-gene expression vector other sequences constant after the carrier that obtains. The amino acid sequence of the component D of expression is as shown in sequence 46 in sequence table.

(5) structure of the single-gene expression vector of expression foreign protein E

Genomic DNA with saccharomyces cerevisiae BY4741 enters performing PCR and expands as template, using YQO050 and YQO051 primers Increase, obtain pcr amplification product, as component E (Set1 protein coding genes Partial Fragments and N-terminal merges mark with His Sign), its nucleotide sequence is as shown in sequence 31 in sequence table.

YQO050： 5’-AGCGTGGGTCTCAGATGCATCATCATCACCACCACCAAGAAGTTTCATCCTCTAGAG-3 ’；

YQO051：5’-GTGCTGGGTCTCGGCTAGTTCAAGAAACCTTTACAATTAGG-3’.

PCR reaction conditions are as follows：94℃,4min；1 circulation；94 DEG C, 30s, 45 DEG C, 30s, 68 DEG C, 2min；5 are followed Ring；94 DEG C, 30s, 50 DEG C, 30s, 68 DEG C, 2min；5 circulations；94 DEG C, 30s, 52 DEG C, 30s, 68 DEG C, 2min；20 Individual circulation；68℃7min；10 DEG C of preservations.

Recovery product (100ng) and No. 9 single-gene expression vectors (20ng) are added in reaction system and are reacted, reacted Product E (expresses the single-gene expression vector of foreign protein E).Reaction system：2units BsaI(BsaI-HF NEB R3535L)、 0.5U T4DNA ligases (Thermo Scientific EL0011), 0.1mg/ml BSA (NEB B9001S), 1x T4 connect Connect enzyme buffer liquid (Thermo Scientific B69)；Response procedures：37 DEG C, 60min；50 DEG C, 15min；80 DEG C, 15min；10℃ Preserve.

Product E is directly converted into bacillus coli DH 5 alpha, sequencing is sent after being identified through digestion.

Show through sequencing：The single-gene expression vector of expression foreign protein E is by No. 9 BsaI digestions positions of single-gene expression vector DNA fragmentation between point replaces with component E (Set1 protein coding genes Partial Fragment and the N-terminal shown in sequence 47 in sequence With His fusion tags) encoding gene keep No. 9 single-gene expression vector other sequences constant after the carrier that obtains.Expression Component E amino acid sequence as shown in sequence 48 in sequence table.

2nd, the structure (Fig. 5) of compound coexpression vector

The single-gene expression vector of the expression foreign protein A that step 1 is obtained, the single-gene expression vector of expression foreign protein B, The single-gene expression vector of expression foreign protein C, the single-gene expression vector for expressing foreign protein D and expression foreign protein E's Single-gene expression vector and coexpression received vector (coexpression received vector 150ng, remaining single-gene vectors and its equimolar amounts) Reaction in reaction system is added to, compound coexpression vector (Fig. 6) is obtained.

Reaction system：5units BsmBI (NEB R0580S), 0.1mg/ml BSA (NEB B9001S), 1x T4 ligases Buffer solution (Thermo Scientific B69).

Response procedures：55 DEG C, 60min；25 DEG C of 1U T4 ligases (Thermo Scientific EL0011) are added after cooling, 50min；55 DEG C, 15min；80 DEG C, 15min；10 DEG C of preservations.

Compound coexpression vector is directly converted into bacillus coli DH 5 alpha, sequencing is sent after being identified through bacterium colony PCR.

3rd, the expression and purification of compound

Compound coexpression vector is transformed into e. coli bl21 Rosetta (DE3) (purchased from hundred grace dimension biology CC009), Obtain the recombinant bacterium containing compound coexpression vector；Picking contains the monoclonal of compound coexpression vector to 5ml added with ammonia benzyl In the dual anti-culture medium of penicillin and chloramphenicol, 37 DEG C of incubated overnights；1L is transferred to added with the dual anti-of ampicillin and chloramphenicol In culture medium, when OD600 reaches 0.6-0.8, lower the temperature 2 hours, add IPTG, 18 DEG C of Fiber differentiations are overnight；Centrifugation is received Through the purifying of affinity chromatography, ion-exchange chromatography and molecular-exclusion chromatography after bacterium, albumen composition after purification is obtained.

The SDS-PAGE testing results of albumen composition after purification are as shown in Figure 7：It can be seen that egg after purification The SDS-PAGE testing results of white compound are 5 bands, and size is consistent with each component molecular weight, shows that the method for the present invention can To realize the coexpression of albumen composition each component, and clone-time is greatly shortened, improve the efficiency of clone.

Claims

1. a kind of complete sets of products for the expression of multielement protein compound, is made up of m core fragment and coexpression vector；

The like,

The coexpression vector is made up of core fragment A and skeleton carrier；

The like；

Cohesive end (m-1) y and institute that the core fragment A m-1 are produced by the digestion of IIs types restriction enzyme 1 Core fragment Am is stated to be matched by the cohesive end mx that the digestion of IIs types restriction enzyme 1 is produced；

2. complete sets of products according to claim 1, it is characterised in that：The DNA for building exogenous gene expression box Fragment from 5 ' end rise successively include drive exogenous gene expression promoter, IIs types restriction enzyme 2 generation cohesive end, The recognition sequence of single base N, IIs type restriction enzyme 2, riddled basins, the identification sequence of the restriction enzyme 2 Cohesive end and the terminator of the termination exogenous gene expression that row, single base N, IIs type restriction enzyme 2 are produced；

3. complete sets of products according to claim 1 and 2, it is characterised in that：

The riddled basins upstream cohesive terminus,cohesive termini that each described core fragment is produced by the digestion of IIs types restriction enzyme 2 And mismatch different with riddled basins downstream cohesive terminus,cohesive termini；

The single base N is any one in A, G, C and T.

4. according to any described complete sets of products in claim 1-3, it is characterised in that：

The IIs types restriction enzyme 1 is BsmBI；

The IIs types restriction enzyme 2 is BsaI；

The riddled basins are ccdB genes.

5. according to any described complete sets of products in claim 1-4, it is characterised in that：

The recognition sequence of the restriction enzyme 1 is as shown in sequence 1 in sequence table；

The recognition sequence of the restriction enzyme 2 is as shown in sequence 2 in sequence table.

6. according to any described complete sets of products in claim 1-5, it is characterised in that：

The m is 1,2,3,4,5 or 6；

7. it is a kind of for multielement protein compound expression complete carrier, by m single-gene expression vector and claim 1-6 In any described coexpression vector composition；

The like；

8. it is a kind of build coexpression multielement protein compound recombinant vector method, using any products of claim 1-8 Built, be following (A) or (B)：

(A) comprise the following steps：

1) encoding gene of several foreign proteins is loaded into respectively in the single-gene expression vector in claim 7, point The single-gene expression vector of several expression foreign proteins is not obtained；

2) any described coexpression in the single-gene expression vector and claim 1-6 of several expression foreign proteins is carried Body carries out digestion and connection with IIs types restriction enzyme 1, obtains connection product, the weight of the multielement protein compound that is as co-expressed Group carrier；

(B) comprise the following steps：

1) encoding gene of several foreign proteins is loaded into any described core fragments of claim 1-6 respectively, respectively Obtain the single-gene core fragment of several expression foreign proteins；

2) any described coexpression in the single-gene core fragment and claim 1-6 of several expression foreign proteins is carried Body carries out digestion and connection with IIs types restriction enzyme 1, obtains connection product, the weight of the multielement protein compound that is as co-expressed Group carrier.

9. method according to claim 8, it is characterised in that：The method of the loading is：The single-gene is expressed and is carried Body, the encoding gene of foreign protein carry out digestion and connection simultaneously with IIs types restriction enzyme 2 and ligase, make the external source The encoding gene of albumen replaces the screening-gene in the single-gene expression vector, that is, realize loading.

10. a kind of method of the multielement protein compound that is co-expressed, comprises the following steps：Structure in accordance with the method for claim 8 Build the recombinant vector for obtaining coexpression multielement protein compound；The recombinant vector of the coexpression multielement protein compound is transformed into In coli strain, the correct clone of identification extracts plasmid；The plasmid is transferred in expression system, coexpression is realized.