CN106801064B - Construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria - Google Patents
Construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria Download PDFInfo
- Publication number
- CN106801064B CN106801064B CN201710077962.0A CN201710077962A CN106801064B CN 106801064 B CN106801064 B CN 106801064B CN 201710077962 A CN201710077962 A CN 201710077962A CN 106801064 B CN106801064 B CN 106801064B
- Authority
- CN
- China
- Prior art keywords
- schizochytrium
- schizochytrium limacinum
- gene
- faba
- fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
- C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/01—Hydro-lyases (4.2.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a construction method and application of dehydrogenase gene knocked-out schizochytrium limacinum engineering bacteria, which comprises the following steps: (1) taking the genome of schizochytrium as a DNA template, and respectively carrying out PCR amplification on an upstream fragment UFabaA and a downstream fragment DFabaA of the FabA gene by using an upstream primer pair and a downstream primer pair; (2) connecting the upstream fragment UFaba and the downstream fragment DFaba with a knockout vector to construct a recombinant knockout plasmid; (3) and (3) electrically transforming the recombinant knockout plasmid into schizochytrium limacinum, screening by using a resistance plate, and verifying by using a PCR resistance gene sequence to obtain a transformant, namely the schizochytrium limacinum engineering bacterium with the dehydrogenase gene knockout. The invention provides a construction method of a schizochytrium gene-knocked engineering bacterium, and a FabA gene-knocked schizochytrium recombinant bacterium is constructed, wherein the polyunsaturated fatty acid producing capacity of the engineering bacterium is reduced by 26% compared with the total oil proportion of an original strain, and the production of saturated fatty acid is increased by 16%.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to a construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria.
Background
Polyunsaturated fatty acids (PUFAs), which are linear fatty acids containing two or more unsaturated double bonds, have 18 to 22 carbons and play an important role in biological cells, for example, as important components of cell membranes, for storing oil, for signal transduction, and the like. Currently, PUFAs are classified into two groups, n-6 (or. omega. -6) and n-3 (or. omega. -3). Among these two types of fatty acids, n-3 group polyunsaturated fatty acids include Linolenic Acid (ALA), Eicosapentaenoic Acid (EPA), and Docosahexaenoic Acid (DHA), and n-6 group polyunsaturated fatty acids are mainly Arachidonic Acid (ARA) and linoleic Acid (GLA). Polyunsaturated fatty acids, especially from group n-3, are essential nutrients for human health and animal growth as biologically active substances.
Schizochytrium is an important strain for producing polyunsaturated fatty acids, has been used for industrial production of DHA at present, has a high cellular oil content, is fast to grow and propagate, is more resistant to mechanical agitation, is suitable for large-scale cultivation in fermenters, and has been approved by the us and european authorities for food right to add to relevant food for use (regulation (ec) No 258/97 of european parament, 2010). Schizochytrium limacinum has been demonstrated to have the ability of PUFA synthase pathway (PKS-like pathway) to synthesize polyunsaturated fatty acids in large quantities (Science, 2001, 293 (5528): 290-.
Hydroxy-fatty acyl-Acyl Carrier Protein (ACP) -dehydrogenase (FabA) is a widely distributed enzyme in plants, animals, and microorganisms, and is closely involved in the anabolism of unsaturated fatty acids. The FabA gene encodes a bifunctional 3-hydroxyfatty acyl ACP dehydratase, the isoform of which can be extended by the 3-ketofatty acyl ACP synthase I encoded by the FabB gene to synthesize unsaturated fatty acids. This pathway is considered to be the classical pathway for the synthesis of unsaturated fatty acids under anoxic conditions. The dehydrogenase gene is one of the key genes for synthesizing polyunsaturated fatty acid, a PKS gene cluster of schizochytrium comprises a plurality of dehydrogenase (FabA) sequences, and the FabA gene participates in the synthesis process of the polyunsaturated fatty acid, but the action mechanism of the FAB gene is still unclear at present.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a construction method of a dehydrogenase gene knockout schizochytrium limacinum engineering bacterium.
The invention also aims to provide application of the constructed schizochytrium limacinum engineering bacteria.
The technical scheme of the invention is as follows:
a construction method of a dehydroisomerase (FabA) gene knockout schizochytrium limacinum engineering bacterium comprises the following steps:
(1) taking the genome of schizochytrium as a DNA template, and respectively carrying out PCR amplification on an upstream fragment UFabaA and a downstream fragment DFabaA of a FabA gene by using an upstream primer pair and a downstream primer pair, wherein the upstream primer pair comprises an upstream forward primer and an upstream reverse primer which are respectively shown as SEQ ID NO 01 and SEQ ID NO 02, and the downstream primer pair comprises a downstream forward primer and a downstream reverse primer which are respectively shown as SEQ ID NO 03 and SEQ ID NO 04;
(2) connecting the upstream fragment UFaba and the downstream fragment DFaba with a knockout vector to construct a recombinant knockout plasmid;
(3) and (3) electrically transforming the recombinant knockout plasmid into schizochytrium limacinum, screening by using a resistance plate, and verifying by using a PCR resistance gene sequence to obtain a transformant, namely the schizochytrium limacinum engineering bacterium with the dehydrogenase gene knockout.
The FabA gene is a gene for coding a hydroxyfatty acyl ACP (acyl-CoA dehydrogenase) dehydratase, can catalyze the dehydration isomerization of the 3-hydroxyfatty acyl ACP and is an important step for synthesizing polyunsaturated fatty acid, and an OrfC fragment in a PKS (protein kinase) gene of schizochytrium comprises two FabA gene sites and participates in the synthesis of the fatty acid. Based on the theoretical analysis, the second FabA gene in the OrfC fragment in the PKS gene cluster is knocked out in the schizochytrium, so that the function of the second FabA gene can be shielded, the influence on organisms can be further caused, the effect of the second FabA gene in the synthesis process of PUFAs by the schizochytrium can be further deduced, and important help is provided for exploring the synthesis mechanism of polyunsaturated fatty acid in the schizochytrium.
In a preferred embodiment of the invention, the knock-out vector is pBlu-Zeo.
In a preferred embodiment of the present invention, the procedure of PCR amplification comprises the following: (1)94 ℃ for 5 min; (2) 30s at 94 ℃; (3) 30s at 55 ℃; (4)72 ℃ for 1 min; (5) repeating the (2) to (4)35 cycles; (6) preservation at 72 ℃ for 10min (7) and 4 ℃.
The other technical scheme of the invention is as follows:
a method for producing polyunsaturated fatty acid by fermentation with the Schizochytrium limacinum engineering bacteria constructed by the construction method of any one of claims 1 to 3.
In a preferred embodiment of the present invention, the method comprises the following steps:
(1) inoculating the schizochytrium limacinum engineering bacteria into a liquid seed culture medium for culture to obtain a seed culture solution;
(2) inoculating the seed culture solution obtained in the step (1) into a fermentation culture medium for culture so as to produce polyunsaturated fatty acids through fermentation to obtain a fermentation solution;
(3) and (3) fully digesting the thalli in the fermentation liquor obtained in the step (3), adding n-hexane, uniformly mixing, standing for layering to obtain an organic phase, washing the organic phase to be colorless by using the n-hexane, and finally removing the n-hexane to obtain the polyunsaturated fatty acid.
Further preferably, the step (1) is: inoculating the engineering bacteria of the schizochytrium limacinum into a liquid seed culture medium, and culturing at 27-29 ℃ and 180-220 rpm for 24-48 h to obtain a seed culture solution.
Further preferably, the step (2) is: inoculating the seed culture solution obtained in the step (1) into a fermentation culture medium according to the volume ratio of 3-5%, and culturing at 27-29 ℃ and 180-220 rpm for 4-6 days to produce polyunsaturated fatty acid through fermentation to obtain fermentation liquor.
The invention has the beneficial effects that: the invention provides a construction method of a schizochytrium gene-knocked engineering bacterium, and a FabA gene-knocked schizochytrium recombinant bacterium is constructed, wherein the polyunsaturated fatty acid producing capacity of the engineering bacterium is reduced by 26% compared with the total oil proportion of an original strain, and the production of saturated fatty acid is increased by 16%.
Drawings
FIG. 1 is a diagram showing the results of PCR verification of the recombinant knockout plasmid pBlu-UFabaA-Zeo-DFabaA in example 1 of the present invention, wherein lane 1 is a negative control, and lane 2 is a recombinant plasmid pBlu-UFabaA-Zeo-DFabaA.
Detailed Description
The technical solution of the present invention will be further illustrated and described below with reference to the accompanying drawings by means of specific embodiments.
Example 1: construction of knock-out recombinant vector plasmid pBlu-UFabaA-Zeo-DFabaA
Designing PCR primer to amplify FabA gene upstream segment UFabaA.
The forward and reverse primers are respectively:
forward primer 1: GGGGTACCCCTTGCCAGCGATCTTGGACAT (SEQ ID NO 01)
Reverse primer 2: CGCACAAGGGTAAGCTCGTATGGTAGCTACC (SEQ ID NO 02)
PCR primers were designed for amplification of the downstream fragment DFaba of the FabA gene.
The forward and reverse primers are respectively:
forward primer 3: CGGGATCCCGTGGAGGCCGAGCCAGAGCAT (SEQ ID NO 03)
Reverse primer 4: GACCAAGAAGCAGGACATCACGCTCGAGC (SEQ ID NO 04)
The following PCR procedure was performed using Schizochytrium limacinum ATCC1381 (from ATCC strain collection, USA) genomic DNA as a template: (1)94 ℃ for 5 min; (2) 30s at 94 ℃; (3) 30s at 55 ℃; (4)72 ℃ for 1 min; (5) repeating the (2) to (4)35 cycles; (6)72 ℃ for 10 min; (7) storing at 4 ℃.
The PCR reaction system is as follows:
the knock-out vector pBlu-Zeo (see publications:
the metabolic garden of cell expression by recombinant Saccharomyces cerevisiae Y294in aerobic batch culture Applied microbiology and Biotechnology 2012, 96 (1): 197-
Applied Microbiology and cell technology, 2014, 98 (12): 5567-5578) was digested with restriction enzymes Kpn I and Cla I, recovered, mixed with UFaba, which is an upstream fragment of the FabA gene, and a DNA T4 ligase, and ligated at 4 ℃ overnight. The reaction system is as follows:
the ligation product obtained above was transformed into e.coli DH5 α competent cells, positive clones were selected, plasmid pBlu-UFabA-Zeo was extracted, double digested with restriction enzymes BamH I and Sac I, recovered, mixed with FabA gene downstream fragment DFabA and DNA T4 ligase, and ligated overnight at 4 ℃. The reaction system is as follows:
and transforming the obtained ligation product into E.coli DH5 alpha competent cells, selecting positive clones, extracting plasmids, and obtaining the knock-out recombinant vector plasmid pBlu-UFabaA-Zeo-DFabaA.
Example 2: construction of Schizochytrium limacinum genetically engineered bacterium Sch delta FabA
Extracting and concentrating pBlu-UFabaA-Zeo-DFabaA plasmid, converting Schizochytrium limacinum by electric shock, recovering for 2-3h at 28 ℃, coating bleomycin resistant plate, culturing for 3-5 d at 28 ℃, and screening transformants. After plasmid extraction, transformants were verified by PCR (as shown in FIG. 1), thereby obtaining a FabA gene-knocked-out Schizochytrium limacinum recombinant strain Sch. DELTA. FabA.
The specific steps of the electrotransformation are as follows:
preparing schizochytrium noctilus competence:
(1) inoculating a ring of Schizochytrium limacinum in 20mL of seed culture medium, and culturing at 28 ℃ overnight at 200rpm for 48 h;
(2) taking 1mL of culture solution, inoculating into 20mL of seed culture medium, and culturing at 28 ℃ and 200rpm until the middle and later logarithmic phase lasts for 24 h;
(3) 5mL of the culture medium was centrifuged at 4 ℃ and 4200rpm to harvest the cells, and the supernatant was discarded;
(4) adding 25mL of pretreatment agent (20Mm pH 5.8 phosphate buffer solution with 25mM DTT) to resuspend the cells, and shaking at 28 deg.C and 200rpm for 30 min;
(5) the treated culture broth was centrifuged at 4200rpm at 4 ℃ to harvest cells, and the supernatant was discarded; adding 15-20mL of precooled sterilized water (on ice at 0 ℃) and washing twice;
(6) then 15-20mL of 1M sorbitol is added for washing twice
(7) Finally adding a certain amount of 1M sorbitol for resuspension, and controlling the concentration of the cells to be 106cell/mL. The schizochytrium competent cells need to be prepared at present, and the prepared competent cells need to complete electrotransformation within 1 h.
Electric conversion of schizochytrium:
(1) transferring the mixture of competent cells and 1-5 ug of plasmid into an ice-cold electric shock cell with a gap of 0.1 cm;
(2) converting with 2100V and 5ms pulse;
(3) rapidly adding 1mL of recovery culture medium (seed culture medium) into the electric shock pool, recovering the bacterial suspension into a 5mL centrifuge tube, and culturing at 28 ℃ and 200rpm for 3 h;
(4) the bacterial suspension was spread on resistant plates and incubated at 28 ℃ until colonies appeared on the plates.
Example 3 production of polyunsaturated fatty acids by fermentation Using Schizochytrium limacinum and genetically engineered bacteria thereof
The starting strain of schizochytrium ATCC1381 and the engineering bacteria described in the example 2 are inoculated in a liquid seed culture medium, cultured for 24 hours at 28 ℃ and 200rpm, a seed culture solution is prepared, the inoculation amount of the seed culture solution is 4% (V/V) and is inoculated in an unsaturated fatty acid fermentation culture medium, and the seed culture solution is cultured at 28 ℃ and 200rpm and fermented to produce the polyunsaturated fatty acid. After 5d, the total fat and polyunsaturated fatty acid composition of the fermentation broth was measured (as shown in table 1). The polyunsaturated fatty acid production capacity of the schizochytrium limacinum engineering bacteria Sch delta FabA constructed by the invention is reduced by 26% compared with the total oil proportion of the starting bacterial strain, and the production of saturated fatty acid is increased by 16% (as shown in Table 1).
Table 1: the total oil and fat yield and the unsaturated fatty acid component ratio of the schizochytrium ATCC1381 and the recombinant strain Sch delta FabA thereof are shown in the comparison table (in the total oil and fat%), DHA: docosahexaenoic acid, DPA: docosapentaenoic acid
The extraction and purification method of schizochytrium limacinum total oil comprises the following steps:
(1) accurately sucking 3mL of fermentation liquid into a 10mL test tube with a plug, uniformly mixing, and then adding 4mL of concentrated hydrochloric acid with the mass fraction of 38%. Heating in water bath at 60-70 ℃ for 40-50 min until the thallus is completely digested.
(2) And adding 3-5 mL of n-hexane, adding a plug, fully shaking uniformly, standing for layering, and placing an upper organic phase into a ground conical flask with constant weight. And repeatedly washing with n-hexane for 3-5 times until the upper-layer organic phase is colorless.
(3) The TotaL oil (TFA) yield was calculated by removing the organic solvent to constant weight by nitrogen blowing.
The polyunsaturated fatty acid identification method comprises the following steps:
(1) an amount (about 0.1g) of oil was accurately weighed out and placed in a 50mL ground flask, and 5mL of 0.5mol/L KOH-CH was added3The OH solution was refluxed in a water bath at 65 ℃ until the oil droplets disappeared (about 10min), and 5mL of 30% boron trifluoride diethyl etherate was added from the top of the condenser tube and reacted for 30 min.
(2) Cooling, adding 5mL of n-hexane, oscillating, adding appropriate amount of internal standard substance (such as methyl heptadecanoate), adding sufficient saturated saline solution, standing for layering, taking the upper n-hexane phase, adding anhydrous sodium sulfate for dehydration, filtering, and performing gas chromatography on the obtained sample.
And (3) meteorological chromatographic conditions: an SP2560 column (AvondaLe, PennsyLvania) (30m 0.25mm 0.25m) was used. Adopting temperature programming: the initial temperature is 100 ℃, then the temperature is raised to 180 ℃ according to 20 ℃/min, and then the temperature is raised to 220 ℃ according to 15 ℃/min, and the temperature is kept for 20 min; column pressure 13.582psi, inlet temperature 250 ℃ and FID detector temperature 260 ℃.
The above description is only a preferred embodiment of the present invention, and therefore should not be taken as limiting the scope of the invention, which is defined by the appended claims.
<110> university of mansion
<120> construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria
<160>4
<210>1
<211>30
<212>DNA
<213> Artificial sequence
<400>1
ggggtacccc ttgccagcga tcttggacat 30
<210>2
<211>31
<212>DNA
<213> Artificial sequence
<400>2
cgcacaaggg taagctcgta tggtagctac c 31
<210>3
<211>30
<212>DNA
<213> Artificial sequence
<400>3
cgggatcccg tggaggccga gccagagcat 30
<210>4
<211>29
<212>DNA
<213> Artificial sequence
<400>4
gaccaagaag caggacatca cgctcgagc 29
Claims (7)
1. A construction method of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria is characterized in that: the method comprises the following steps:
(1) the genome of the schizochytrium ATCC1381 is taken as a DNA template, and an upstream primer pair and a downstream primer pair are respectively used for PCR amplificationFabAUpstream fragment U of GeneFabAAnd downstream fragment DFabAThe upstream primer pair comprises an upstream forward primer and an upstream reverse primer which are respectively shown as SEQ ID NO 01 and SEQ ID NO 02, and the downstream primer pair comprises a downstream forward primer and a downstream reverse primer which are respectively shown as SEQ ID NO 03 and SEQ ID NO 04;
(2) the upstream fragment UFabAAnd downstream fragment DFabALinked to a knock-out vectorInoculating, constructing a recombinant knockout plasmid;
(3) and (3) electrically transforming the recombinant knockout plasmid into schizochytrium limacinum, screening by using a resistance plate, and verifying by using a PCR resistance gene sequence to obtain a transformant, namely the schizochytrium limacinum engineering bacterium with the dehydrogenase gene knockout.
2. The method of construction of claim 1, wherein: the knockout vector is pBlu-Zeo.
3. The construction method of claim 1, wherein the PCR amplification process comprises (1)94 ℃, 5min, (2)94 ℃, 30s, (3)55 ℃, 30s, (4)72 ℃, 1min, (5) repeating (2) ~, (4)35 cycles, (6)72 ℃, 10min, and (7) storing at 4 ℃.
4. A method for producing polyunsaturated fatty acids, characterized in that: the fermentation production is carried out by using the Schizochytrium limacinum engineering bacteria constructed by the construction method of any one of claims 1 to 3.
5. The production method according to claim 4, wherein: the method comprises the following steps:
(1) inoculating the schizochytrium limacinum engineering bacteria into a liquid seed culture medium for culture to obtain a seed culture solution;
(2) inoculating the seed culture solution obtained in the step (1) into a fermentation culture medium for culture so as to produce polyunsaturated fatty acids through fermentation to obtain a fermentation solution;
(3) and (3) fully digesting the thalli in the fermentation liquor obtained in the step (3), adding n-hexane, uniformly mixing, standing for layering to obtain an organic phase, washing the organic phase to be colorless by using the n-hexane, and finally removing the n-hexane to obtain the polyunsaturated fatty acid 2.
6. The production method according to claim 5, wherein the step (1) is to inoculate the Schizochytrium limacinum engineering bacteria in a liquid seed culture medium, and culture the Schizochytrium limacinum engineering bacteria at 27 ~ 29 ℃, 180 ~ 220rpm and 24 ~ 48h to obtain a seed culture solution.
7. The method according to claim 5, wherein the step (2) comprises inoculating the seed culture broth obtained in the step (1) at a volume ratio of 3 ~ 5% in a fermentation medium, and culturing at 27 ~ 29 ℃ and 180 ~ 220rpm for 4 ~ 6d to produce the polyunsaturated fatty acids by fermentation to obtain a fermentation broth.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710077962.0A CN106801064B (en) | 2017-02-14 | 2017-02-14 | Construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710077962.0A CN106801064B (en) | 2017-02-14 | 2017-02-14 | Construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106801064A CN106801064A (en) | 2017-06-06 |
| CN106801064B true CN106801064B (en) | 2020-01-17 |
Family
ID=58987476
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710077962.0A Active CN106801064B (en) | 2017-02-14 | 2017-02-14 | Construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106801064B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111893049A (en) * | 2020-06-30 | 2020-11-06 | 厦门大学 | Schizochytrium limacinum genetic engineering strain for over-expressing squalene synthetase gene and construction method and application thereof |
| CN113265340B (en) * | 2021-05-19 | 2023-02-28 | 厦门大学 | Squalene-producing schizochytrium limacinum genetic engineering strain and construction method and application thereof |
| CN114790425B (en) * | 2022-02-28 | 2024-03-08 | 南京师范大学 | Schizochytrium limacinum genetically engineered strain, construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103842502A (en) * | 2011-08-03 | 2014-06-04 | Ls9公司 | Production of fatty acids and derivatives thereof having improved aliphatic chain length and saturation characteristics |
| CN106011164A (en) * | 2016-05-20 | 2016-10-12 | 天津大学 | Genetic element, expression vector and application of genetic element and expression vector |
-
2017
- 2017-02-14 CN CN201710077962.0A patent/CN106801064B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103842502A (en) * | 2011-08-03 | 2014-06-04 | Ls9公司 | Production of fatty acids and derivatives thereof having improved aliphatic chain length and saturation characteristics |
| CN106011164A (en) * | 2016-05-20 | 2016-10-12 | 天津大学 | Genetic element, expression vector and application of genetic element and expression vector |
Non-Patent Citations (1)
| Title |
|---|
| 裂殖壶菌遗传转化体系的研究及其在 DHA 合成途径研究中的应用;李清;《中国优秀硕士学位论文全文数据库 基础科学辑》;20130315;第A006-233页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106801064A (en) | 2017-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Amaro et al. | Advances and perspectives in using microalgae to produce biodiesel | |
| CN106801064B (en) | Construction method and application of dehydrogenase gene knockout schizochytrium limacinum engineering bacteria | |
| CN104974944B (en) | A kind of schizochytrium limacinum genetic engineering bacterium for producing DHA and its construction method and application | |
| CN106676127B (en) | Construction method and application of ketone group synthetase gene knocked-out schizochytrium limacinum engineering bacteria | |
| Veerabadhran et al. | Using different cultivation strategies and methods for the production of microalgal biomass as a raw material for the generation of bioproducts | |
| CN106947706B (en) | Schizochytrium limacinum strain, construction method and application thereof | |
| Mohan et al. | Algal oils as biodiesel | |
| Salim | Biomass and lipid content of heterotrophic Spirogyra sp by using cassava starch hydrolysate | |
| CN110373436A (en) | A kind of construction method and fermentation technique producing bishomo-γ-linolenic acid volume branch Mucor cell factory | |
| CN117210508B (en) | Method for preparing high-yield schizochytrium limacinum | |
| Huo et al. | Outdoor growth characterization of an unknown microalga screened from contaminated Chlorella culture | |
| US9574215B2 (en) | Production of fatty acids by heterologous expression of gene clusters from myxobacteria | |
| CN114561434B (en) | Method for producing EPA and DHA by schizochytrium limacinum fermentation | |
| CN107384979B (en) | Application of high osmotic pressure glycerol protein kinase gene RKHog1 | |
| KR101499912B1 (en) | A Novel Tetraselmis sp. MBEyh04Gc strain (KCTC 12432BP) and a method for producing biodiesel using the same | |
| CN113462588A (en) | Construction method of yarrowia lipolytica genetic engineering bacteria for producing citric acid or itaconic acid by using acetic acid | |
| CN111304104A (en) | Recombinant yarrowia lipolytica for heterologous synthesis of betulinic acid and construction method thereof | |
| CN114507696B (en) | Preparation method of sorghum extract | |
| CN104099358B (en) | Recombined blue algae, its preparation method and the application thereof of a kind of fatty acid output increased | |
| CN108977362A (en) | The strain of Chlorococcum (CHLORELLA LEWINII) algae and its purposes | |
| CN115851569B (en) | Sport zymomonas for co-production of lactic acid and ethanol by using non-grain biomass and application thereof | |
| CN114606150B (en) | Gene engineering strain for producing gamma-linolenic acid, construction method and application thereof | |
| CN114790425B (en) | Schizochytrium limacinum genetically engineered strain, construction method and application thereof | |
| CN117683650A (en) | Yarrowia lipolytica engineering strain for high-level production of alpha-linolenic acid, construction method and application | |
| CN114456957B (en) | Schizochytrium limacinum genetically engineered strain, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |