CN106801043A

CN106801043A - One kind restructuring transaminase and its preparation method and application

Info

Publication number: CN106801043A
Application number: CN201611239147.1A
Authority: CN
Inventors: 石利平; 陈峻青; 蔡进; 漆志文; 张维冰; 叶银梅; 龚仕荣; 徐春涛
Original assignee: JIANGSU ALPHA PHARMACEUTICAL CO Ltd
Current assignee: Jiangsu alpha Pharmaceutical Co.,Ltd.
Priority date: 2016-12-28
Filing date: 2016-12-28
Publication date: 2017-06-06
Anticipated expiration: 2036-12-28
Also published as: CN106801043B

Abstract

The invention discloses one kind restructuring transaminase and its preparation method and application.A kind of restructuring transaminase mutant of high activity, as shown in SEQ ID NO.2, encoding gene is as shown in SEQ ID NO.1 for amino acid sequence.A kind of method for preparing described restructuring transaminase, including fermented and cultured contains the genetic engineering bacterium of above-mentioned encoding gene, and collects and Prepare restructuring transaminase.Restructuring transaminase of the present invention is applied to asymmetric syntheses chirality aminated compounds, particularly for synthesizing sitagliptin intermediate (R) 3 amino 4 (2,4,5 trifluorophenyl) methyl butyrate.Enzyme involved in the present invention has excellent stereoselectivity, regioselectivity and catalysis activity, and the reaction of its catalysis is gentle, and the yield of reaction conversion ratio and product is high, with preferable application prospect.

Description

One kind restructuring transaminase and its preparation method and application

Technical field

The invention belongs to technical field of bioengineering, and in particular to one kind restructuring transaminase and its preparation method and application.

Background technology

It, by a kind of disorderly chronic progressive disease of whole body for triggering of human body own metabolism, is by insulin secretion that diabetes are Caused by not enough or insulin action obstacle.Diabetes are generally concurrent with coronary heart disease, cranial vascular disease, ephrosis, lower limbs necrosis etc. Disease, is a kind of complicated frequently-occurring disease.Whole world maturity-onset diabetes number of patients was up to 4.22 hundred million at present, it is contemplated that to 2025, and the whole world will There is people more than 700,000,000 to suffer from diabetes.

Diabetes are broadly divided into two kinds of I type and II type, and wherein type II diabetes is Non-Insulin Dependent Diabetes Mellitus, be by Insulin resistance or islet beta cell function are damaged and cause, and its patient accounts for more than the 90% of diabetic.II type for the treatment of is sugared at present The medicine for urinating disease has various, and such as sulfonylurea, biguanides, thiazolidinediones, alpha-glucosidase restrainer, benzoic acid derive Species etc., although blood sugar reducing function is ideal, but influence patient to adhere to medication because there is side effect, do not reach preferable blood sugar Control purpose.

Dipeptidyl peptidase-IV (DPP-IV) can be cracked including glucagon-like-peptide-1 (GLP-1) and Gastric inhibitory polypeptide (GIP) In interior various peptide hormones, and both has close ties with type II diabetes.DPP-IV inhibitor can be by suppressing DPP-IV reduces the degraded of GLP-1, increases the PC of GLP-1, so as to improve postprandial blood sugar.Additionally, DPP-IV inhibitor May also suppress other peptides of the participation regulation blood sugar such as GIP, PACAP and gastrin releasing peptide Degraded.

In October, 2006, FDA (Food and Drug Adminstration) (FDA) approval sitagliptin phosphate monohydrate (Sitagliptin, trade name Januvia) is used to treat type II diabetes.Sitagliptin is first to be used to treat II type sugar Urinate disease dipeptidyl peptidase (DPP-IV) inhibitor class medicine, can glucagon suppression secretion and beta Cell of islet propagation and Glucose-tolerant level is improved, its blood sugar reducing function is relatively mild, and patient's oedema and increased weight are not caused, causes the wind of hypoglycemia Danger is smaller, and without putting on weight, the side effect such as Nausea and vomiting.Sitagliptin is used alone or is shared with other antidiabetic drugs, Can reach the purpose of hypoglycemic.

Sitagliptin Chineses are 7- [(3R) -3- amino -1- oxos -4- (2,4,5- trifluorophenyls) butyl] -5, 6,7,8- tetrahydrochysenes -3- (trifluoromethyl) -1,2,4- triazole [4,3- α] pyrazoles phosphoric acid (1:1) monohydrate, molecular formula is C₁₆H₁₅F₆N₅O, relative molecular mass is 407.31, and No. CAS is 654671-77-9.

The synthetic method of current sitagliptin has various, and wherein what yield was higher is the synthetic method of United States Merck company (WO2004085378, WO2005020920)：Asymmetric hydrogenation is carried out to unprotected enamine with chiral rhodium catalyst, its reaction Total recovery is higher, is 74.5%, and production cost is relatively low.But the product optical purity obtained by the route is relatively low (ee 97%), need Crystallization concentration can just obtain optically pure sitagliptin, and reaction needs high-pressure hydrogenation (250psi), to consersion unit requirement compared with It is high.

Chemical synthesis sitagliptin and its intermediate have that reaction scheme is long, need to use toxic raw materials, product yield and Optical purity is low, severe reaction conditions the shortcomings of；And Enzyme catalyzed synthesis sitagliptin intermediate has, and reaction condition is gentle, reaction Selectivity is strong, side reaction is few, product yield and optical purity are high, the advantages of can be easily separated purifying, with preferably using preceding Scape.The present invention develops the restructuring transaminase that a kind of catalysis activity is high, enantioselectivity is good, substrate tolerance is good, can be used to urge Be combined to chiral amine compound, particularly catalyze and synthesize sitagliptin intermediate (R) -3- amino -4- (2,4,5- trifluorophenyl) - Methyl butyrate.

The content of the invention

The technical problems to be solved by the invention are, for current sitagliptin and its intermediate synthetic route it is long, need Using toxic raw materials, product yield and chiral purity is low, severe reaction conditions the shortcomings of, there is provided a kind of catalysis activity is high, mapping The good restructuring transaminase of the good, substrate tolerance of selectivity, the encoding gene of the transaminase, the recombination expression containing the gene is carried Body, recombinant expression transformants and preparation method thereof, and the restructuring transaminase mutant is in catalysis prepares chiral amine compound Application.Particularly, by the restructuring transaminase be used for sitagliptin intermediate (R) -3- amino -4- (2,4,5- trifluorophenyl) - The preparation of methyl butyrate.

The purpose of the present invention can be achieved through the following technical solutions：

The restructuring transaminase mutant of a kind of high activity, with the Aspergillus terreus of the gene code shown in SEQ ID NO.3 (Aspergillus terreus) NIH2624 wild types transaminase is the enzyme that sets out, by the enzyme active center and guiding activity It is higher that the amino acid residue in some sites in the hydrophobic channel of the heart sports the catalysis activity that other amino acid residues obtain Restructuring transaminase mutant；Described activated centre is defined as near substrate binding site aboutDiameter of Spherical Volume； Any one in the described preferred SEQ ID NO.2 2 of restructuring transaminase variant amino acid sequence.

Nucleic acid source in the present invention shown in SEQ ID NO.3 is in Aspergillus terreus (Aspergillus terreus) NIH2624.Nucleic acid shown in SEQ ID NO.3 of the present invention can be from Aspergillus terreus (Aspergillus terreus) Separated in the genome of NIH2624 and obtained, it is also possible to from recombinant expression carrier or weight containing nucleic acid shown in SEQ ID NO.3 Separated in group transformant and obtained, it is also possible to artificial synthesized acquisition.

A kind of gene for encoding restructuring transaminase mutant of the present invention, its nucleotide sequence is selected from SEQ ID NO.1。

A kind of recombinant expression carrier comprising restructuring transaminase mutant code gene of the present invention.It can be by this Be connected to for the nucleotide sequence of restructuring aminotransferase gene of the invention built-up on various carriers by field conventional method.Described Carrier can be the conventional various carriers in this area, such as commercially available plasmid, bacteriophage or viral vectors, preferred plasmid pET21a。

A kind of recombination expression comprising restructuring transaminase mutant code gene of the invention or its recombinant expression carrier turns Change body, the present invention preferably ETEC (Escherichia coli) BL21 (DE3).By the conversion of foregoing recombinant expression plasmid Into ETEC (Escherichia coli) BL21 (DE3), you can obtain currently preferred genetic engineering bacterium.

A kind of method for preparing described restructuring transaminase, including the fermented and cultured genetic engineering bacterium, and collect and system Standby restructuring transaminase.

Methods described is included under certain production tank fermentation condition, recombinated described in preparation of industrialization the step of transaminase Suddenly；Described production tank fermentation condition is preferred：DO more than 35%, air mass flow 1:1.5vvm.

Restructuring transaminase of the present invention is applied to asymmetric syntheses chirality aminated compounds, particularly for synthesizing west Ta Lieting intermediates (R) -3- amino -4- (2,4,5- trifluorophenyls)-methyl butyrate.

The transaminase-catalyzed reaction of present invention restructuring is as follows：

It is preferred that：In the reaction solution of pH 6.5~7.5, in the presence of PLP, in restructuring of the present invention Under the effect of transaminase mutant, optics chiral amine compound is prepared by the catalysis reduction of substrate enantioselective enzyme of compound A

Wherein, R is alkyl or substituted heteroaryl, preferably C_nH_2n+1And benzyl, wherein n be selected from 1~8 integer.

A kind of synthetic method of sitagliptin, reaction scheme is as follows：

Beneficial effect：

The present invention by chemistry, molecular biology, bioinformatics and high-throughput screening method, exploitation to it is a kind of with compared with High specific (enantiomeric excess value>99.5%) and preferably catalysis activity restructuring transaminase mutant, for catalyzing and synthesizing hand Property amines.The co-factor of restructuring transaminase of the invention is PLP PLP.

Enzyme involved in the present invention has excellent stereoselectivity, regioselectivity and a catalysis activity, and its catalysis Reaction is gentle, and the yield of reaction conversion ratio and product is high, with preferable application prospect.

Specific embodiment

The foundation of the genetic engineering bacterium of embodiment 1

The gene order of Aspergillus terreus (the Aspergillus terreus NIH2624) transaminase included according to Genbank (NCBI accession number：XM_001209325.1), artificial synthesized genetic fragment, is expanded by PCR and extends fragment (the fragment both sides Plus Nde I and the incision enzyme gene fragments of BamH I), its nucleotide sequence is as shown in SEQ ID NO.3.And utilize Nde I and BamH I Restriction enzyme site inserts gene in pET21a plasmids, and foundation turns during the carrier after connection is transferred into e. coli bl21 (DE3) Ammonia enzyme gene engineering bacteria.Wherein PCR amplification aminotransferase gene primer be：Forward primer F1： GGGGCCATATGGCCTCCATGGACAAAGTCTTT (SEQ ID NO.4), reverse primer R1： GGGCCGGATCCCGTTATAATCAATCTCGAAGC(SEQ ID NO.5)。

The acquisition of the transaminase mutant gene of embodiment 2

This research and utilization fallibility PCR method, protein engineering transformation has been carried out to transaminase.Fallibility PCR is to use DNA When polymerase carries out genes of interest amplification, by adjusting reaction condition, magnesium ion concentration is such as improved, manganese ion is added, is changed body Four kinds of dNTPs concentration or change the frequency of mutation in amplification procedure with low fidelity archaeal dna polymerase etc. in system, so that With certain frequency to mutation is randomly incorporated into genes of interest, the random mutant of protein molecule is obtained.This research is using guarantor Really spend during relatively low polymerase is easy to amplified production under certain measures and mix the principle of random mutation, while using Mn²⁺ Substitute natural confactor Mg²⁺Increase fallibility probability.

50 μ l PCR reaction systems are：10 × amplification buffer 5 μ l, 4 kinds of each 4 μ l of dNTP mixtures (2.5mmol/L), draw Each 50pmol of thing, 1.5 μ g, Taq archaeal dna polymerase of template DNA 0.5 μ L, Mg²⁺2mmol/L, plus distilled water is to 50 μ l.

PCR amplification programs are：94 DEG C of predegenerations 5min, 94 DEG C of denaturation 45s, 55 DEG C of denaturation 30s, 72 DEG C of denaturation 120s, enter 30 circulations of row；In continuing to extend 10min at 72 DEG C, 4 DEG C are cooled to.The genetic fragment of amplification uses 1% agarose afterwards after testing Gel electrophoresis is reclaimed, and purifies amplified production, removes unnecessary primer.

Experiment flow

Method PCR according to embodiment 1 is expanded aminotransferase gene and is inserted gene using Nde I and the restriction enzyme sites of BamH I Enter into pET21a plasmids, as gene mutation template；

Fallibility PCR expands the gene of transaminase, and genetic fragment links to pET21a carriers after amplification, by the carrier after connection It is transferred in e. coli bl21 (DE3) and sets up aminotransferase gene mutant library；It is host using e. coli bl21 (DE3), PET21a plasmids are carrier, expression extension transaminase, high flux screening high activity mutant strain；To high activity transaminase base after mutation Because being identified.The nucleotide sequence of the high activity transaminase mutant gene for filtering out is as shown in SEQ ID NO.1.

Aminotransferase gene primer is：Forward primer F1：GGGGCCATATGGCCTCCATGGACAAAGTCTTT(SEQ ID NO.4), reverse primer R1：GGGCCGGATCCCGTTATAATCAATCTCGAAGC(SEQ ID NO.5).

By the genetic engineering bacterium of the methods described construction expression transaminase mutant of embodiment 1.

After mutant sequence is obtained, it is also possible to the Hes of Nde I are utilized after chemical synthesis mode synthesizes the gene order Be inserted into gene in pET21a plasmids by the restriction enzyme sites of BamH I, then converts Escherichia coli structure genetic engineering bacterium.

It is prepared by the shaking flask of the transaminase of embodiment 3

The recombination bacillus coli that embodiment 1, embodiment 2 build gained is seeded to 50mL containing ampicillin (100 respectively μ g/mL) LB culture mediums (peptone 10g/L, yeast extract 5g/L, NaCl 10g/L, pH7.2) in, in 37 DEG C, 200rpm's shakes Shaken cultivation more than 16 hours in bed.Switching 2mL bacterial culture fluids are cultivated in LB of the 50mL containing chloramphenicol (or ampicillin) In base, shaken cultivation under similarity condition is placed in, light absorption value of the Timing measurement bacterium solution under 600nm is monitoring thalli growth density. When the OD 600 of bacterium solution is worth in 0.6-0.8, derivant IPTG to final concentration of 0.2mmol/L, 30 DEG C of induced expressions 12 are added More than hour.By the way that (5000rpm, 15min, 4 DEG C) collects thalline is centrifuged after expression, and with phosphate buffer (pH7.2,50mM) Cleaning twice, is scattered in the buffer solution of same precooling, and ultrasonication is carried out in ice-water bath.Centrifugation (8000rpm, 30min, 4 DEG C) supernatant is collected, concentration, freeze-drying obtain the crude powder for recombinating transaminase or restructuring transaminase mutant.

Embodiment 4 recombinates the measure of aminotransferase activity

With 3- carbonyls -4- (2,4,5- trifluorophenyl) methyl butyrate for substrate, restructuring prepared by HPLC detection embodiments 3 turns Ammonia enzymatic activity, the genetic engineering bacterium with highest transaminase enzyme activity can be expressed so as to filter out.It is efficient using Shimadzu LC-20AT Liquid chromatograph, is equipped with C18 posts (150mm*4.6mm, 5um), 0.1% trifluoroacetic acid aqueous solution of mobile phase-methyl alcohol (40:60), Detection wavelength 254nm, 30 DEG C of column temperature, flow velocity 1.0mLmin^-1。

Testing conditions are：Reaction system cumulative volume 2mL, wherein comprising 0.5-50 μm of ol/L substrate, 200 μ L 1mol/L are different Propylamin hydrochloride, 100 μm of ol PLPs, 5%-25% (v/v) DMSO, 500 μ L enzyme liquids, 45 DEG C of reaction 30min are surveyed Determine the consumption and product (R) -3- amino -4- (2,4,5- trifluoros of substrate 3- carbonyls -4- (2,4,5- trifluorophenyls) methyl butyrate Phenyl)-methyl butyrate growing amount.

The definition of enzyme activity unit (U) is：Under the above-described reaction conditions, 1 μm of ol (R) -3- amino of catalysis generation per minute - 1 μm of ol substrate 3- carbonyls -4- (2,4,5- tri- of enzyme amount or consumption per minute needed for 4- (2,4,5- trifluorophenyls)-methyl butyrate Fluorophenyl) enzyme amount needed for methyl butyrate.

The enzyme activity for measuring restructuring transaminase mutant is 926.2U/L, than original enzyme activity (NCBI accession number：XM_ 001209325.1) 1.1 times are improve.

It is prepared by the fermentation of the restructuring transaminase of embodiment 5

Fermentation medium components are：Ammonium sulfate 0.76g/L, ironic citrate 0.06mg/L, NaCl 10.5g/L, phosphoric acid hydrogen two Potassium 12.2g/L, potassium dihydrogen phosphate 6.1g/L, yeast extract 11.5g/L, peptone 7.1g/L, glycerine 17.3g/L, ammonium molybdate Tetrahydrate 0.01g/L.Zymotic fluid maintains pH 7.0,37 DEG C of tank temperature, speed of agitator 300-1300rpm, hair by adding ammoniacal liquor DO more than 35%, air mass flow 1 are controlled during ferment:1.5vvm.Access the seed liquors of E.Coli BL21 (DE3) ST 1205 OD600 is 0.68, access amount for fermentating liquid volume 10%, zymotic fluid OD600 up to when 0.8 add IPTG to final concentration 1mmol/ L continues to ferment 15 hours to induce the expression of transaminase, hereafter, 25 DEG C of tank temperature.By adding 460g/ containing glycerine in fermentation process L, yeast extract 150g/L, ammonium chloride 11.5g/L, ammonium molybdate tetrahydrate 0.04mg/L, ironic citrate 0.06mg/L it is molten Liquid maintains the growth of culture.Culture is cooled to 4 DEG C of preservations after fermentation ends.

By zymotic fluid through the conventional treatments such as (8000rpm, 10min), clasmatosis, freeze-drying are centrifuged, prepare and turn Ammonia enzyme polypeptide freeze-dried powder is simultaneously preserved in -80 DEG C.

Embodiment 6 recombinates transaminase-catalyzed synthesis (R) -3- amino -4- (2,4,5- trifluorophenyls)-methyl butyrate (XT-4)

To addition 32.6kg substrate 3- carbonyls -4- (2,4,5- trifluorophenyl)-methyl butyrate, 132kg in 2000L reactors Isopropylamine hydrochloride, 0.55kg PLPs (PLP), 550L DMSO, then to being added in kettle according to the method for embodiment 5 The restructuring transaminase freeze-dried powder 29.5kg of preparation, under nitrogen protection, is warming up to 45 DEG C, and add 4mol/L isopropylamine solutions The pH for adjusting reaction solution is 8.5.In course of reaction by add 4mol/L isopropylamine solutions control reaction solution pH be 8.5- 9.0, stirring reaction 22 hours or so, terminating reaction when being down to less than 3% to substrate content.

Through operations such as centrifugation, extraction, decolourings after reaction terminating, product (R) -3- amino -4- (2,4,5- trifluoro-benzenes are obtained Base)-methyl butyrate：¹H NMR(CDCl₃)d7.08(m,1H),6.94(m,1H),3.85(s,2H),3.77(s,3H),3.55(s, 2H)；¹³C NMR(CDCl₃)d 197.9,167.1,156.9,154.5,150.4,147.9,145.5,119.4,117.0, 105.5,52.4,48.3,41.9.Analyzed through HPLC, determine substrate conversion efficiency 97.6%, product ee 99.5%.

The concrete analysis condition of product ee values is：Chiralpak AD-H chromatographic columns (150mm × 4.6mm, 5um), flowing Phase n-hexane-isopropanol (80:20, v/v)；Detection wavelength 254nm, flow velocity 1mL/min, 30 DEG C of column temperature.

Embodiment 7 (R) -3- amino -4- (2,4,5- trifluorophenyls)-methyl butyrate (XT-4)

The addition 90ml dimethyl sulfoxide (DMSO)s in reactor, 3- carbonyls -4- (2,4,5- trifluorophenyl)-methyl butyrate of 15g, Stirring and dissolving, adds the isopropyl amine salt aqueous acid 90ml of pH=9.00, adds crude enzyme liquid 120g and 0.08g phosphoric acid pyrrole to tremble Aldehyde, 35 DEG C of stirring reaction 24h, period is maintained between pH8.00-8.60 with isopropylamine solution, acid adding terminating reaction, then 35 DEG C Insulated and stirred 1h, is filtered to remove albumen, and water adjusts pH to 10-11 with sodium hydrate aqueous solution, is extracted three times with dichloromethane, closes And dichloromethane adds anhydrous sodium sulfate drying 2h, product 14g, purity more than 99% are obtained after reclaiming dichloromethane.

Embodiment 8 (R) -3- t-butoxycarbonyl aminos -4- (2,4,5- trifluorophenyls)-methyl butyrate (XT-5)

14.8g (R) -3- amino -4- (2,4,5- trifluorophenyl)-methyl butyrate (0.06mol) is weighed, 50ml bis- is dissolved in In chloromethanes, 1ml triethylamines are added, less than 5 DEG C add 14.4g di-tert-butyl dicarbonates (0.066mol), are warming up to room temperature Reaction 15 hours, adds 30ml water quenchings to go out, and collects organic phase, and water is mutually extracted 2 times with dichloromethane again, merges organic phase, is added Anhydrous sodium sulfate drying, rotates recycling design, obtains 18.7g white solids, yield 90%.

Embodiment 9 (R) -3- t-butoxycarbonyl aminos -4- (2,4,5- trifluorophenyls)-butyric acid (XT-6)

By 17.4g (R) -3- t-butoxycarbonyl aminos -4- (2,4,5- trifluorophenyl)-methyl butyrate (0.05mol), dissolving In the mixed solvent of 120ml methyl alcohol and 60ml water, 6g NaOH (0.15mol), the stirring reaction at 40-45 DEG C are added 1.5 hours, revolving removed partial solvent, and it is 2-3 to add 1N hydrochloric acid to adjust pH under ice bath, is extracted with ethyl acetate 3 times, is associated with Machine phase, organic to be added to anhydrous sodium sulfate drying 2h with brine It 1 time, filtering, revolving recycling design obtains white solid 15.7g, yield 94%.

The 7- of embodiment 10 [(3R) -3- t-butoxycarbonyl amino -1- oxos -4- (2,4,5- trifluorophenyls) butyl] -5,6, 7,8- tetrahydrochysene -3- Trifluoromethyl-1s, 2,4- triazols [4,3-a] pyrazine (XT-7)

Under nitrogen protection, by 8.6g (R) -3- t-butoxycarbonyl aminos -4- (2,4,5- trifluorophenyl)-butyric acid Simultaneously piperazine hydrochloride (0.045mol) is dissolved in 50ml dichloromethane for (0.045mol), 10.28g trifluoromethyls triazole, ice Bath is lower to add 7.27g 1- hydroxy benzo triazoles (0.054mol) and 10.3g 1- ethyls -3- (3- dimethylamino-propyls) phosphinylidyne Inferior amine salt hydrochlorate (0.054mol), is added dropwise 13.5g triethylamines, and lower reaction 24 hours, reaction solution 50ml water washings 3 is stirred at room temperature Secondary, organic to be added to anhydrous sodium sulfate drying 2 hours, recycling design obtains 20.9g, yield 91%.

The Sitagliptin phosphate of embodiment 11

Weigh 10.14g XT-7 (0.02mol) and be dissolved in 100ml concentrated hydrochloric acids：Ethanol (1:5) in mixed solvent, room temperature Stirring reaction 4 hours, revolving removes ethanol, is neutralized with sodium acid carbonate, is extracted with ethyl acetate 3 times, merges organic phase, adds nothing Aqueous sodium persulfate is dried 2 hours, filtering, after recycling design, under nitrogen protection, adds 80ml isopropanols and 10ml water, and 85 DEG C are stirred, The phosphoric acid of 3g 85% is added, 85 DEG C of stirring reactions 2 hours are cooled to room temperature and are stirred for 10 hours, and filtering drying obtains white Xi Talie Spit of fland phosphate 9.09g, yield 90%.

It is prepared by the Sitagliptin phosphate pilot scale of embodiment 12

Weigh 5.1kg XT-7 (1mol) and be dissolved in 50L concentrated hydrochloric acids：Ethanol (1:5) in mixed solvent, it is stirred at room temperature anti- Answer 4 hours, revolving removes ethanol, neutralized with sodium acid carbonate, be extracted with ethyl acetate 3 times, merge organic phase, add anhydrous slufuric acid Sodium is dried 2 hours, filtering, after recycling design, under nitrogen protection, adds 45L isopropanols：Water (8:1) mixed solvent, 85 DEG C are stirred Mix, add the phosphoric acid of 1.5kg 85%, 85 DEG C of continuation stirring reaction 2 hours is cooled to room temperature and is stirred for 10 hours, and filtering drying is obtained White Sitagliptin phosphate 4.71kg, yield 93%.

<110>Jiangsu Alpha Pharmaceutical Co., Ltd.

<120>One kind restructuring transaminase and its preparation method and application

<160> 5

<210> 1

<211> 978

<212> DNA

<213>Artificial sequence

<220>

<223>Recombinate the encoding gene of transaminase mutant

<400> 1

atggcctcca tggacaaagt ctttgccggc tacgccgccc gccaagcgat cctcgaatca 60

accgagacca ccaacccctt tgcgaagggt atcgcctggg tagaaggcga gctggtgccc 120

ctggcagagg cacgcattcc actgctcgac cagggcttca tgaaaagcga tctcacctac 180

gacgtgccct ccgtctggga cggccgcttc ttccggctag acgaccacat cacgcggctc 240

gaagccagct gcaccaagct ccggctgcga ctgccactcc cgcgcgacaa agtcaagcag 300

attctcgtcg agatggtgcg caagagcggc atccgcgacg cctttgtcga gctgatcgtg 360

acgcgcgggc tgaagggcgt gcgggggaca cgccccgagg acatcgtcaa caatctgtac 420

atgtttgtgc agccgtacgt gtgggtgatg gagccggata tgcagcgtgt cggcggcagc 480

gcggtcgtcg cccgcaccgt gcgccgggtg cccccgggtg ccatcgaccc aaccgtcaag 540

aacctgcaat ggggcgatct cgtgcgcggc atgttcgagg ctgcggatcg cggtgcaact 600

tatccgttct tgacggacgg agatgcccat ctcaccgaag gctctgggtt caatattgtg 660

ctcgtcaagg acggcgtgct gtacacacca gaccgtggtg tgctgcaggg cgtgacacga 720

aagagtgtta tcaatgcggc ggaagccttc gggattgaag tccgcgttga gtttgtgccg 780

gttgagctgg cgtaccgttg tgatgagatc tttatgtgta ccaccgctgg cggcatcatg 840

cctatcacta cgctggatgg gatgcccgtg aatggaggac agatcggtcc tattacgaag 900

aagatttggg atggatattg ggctatgcat tatgatgcgg cttacagctt cgagattgat 960

tataacgaga ggaactga 978

<210> 2

<211> 325

<212> PRT

<213>Artificial sequence

<220>

<223>Restructuring transaminase mutant

<400> 2

Met Ala Ser Met Asp Lys Val Phe Ala Gly Tyr Ala Ala Arg Gln Ala

5 10 15

Ile Leu Glu Ser Thr Glu Thr Thr Asn Pro Phe Ala Lys Gly Ile Ala

20 25 30

Trp Val Glu Gly Glu Leu Val Pro Leu Ala Glu Ala Arg Ile Pro Leu

35 40 45

Leu Asp Gln Gly Phe Met Lys Ser Asp Leu Thr Tyr Asp Val Pro Ser

50 55 60

Val Trp Asp Gly Arg Phe Phe Arg Leu Asp Asp His Ile Thr Arg Leu

65 70 75 80

Glu Ala Ser Cys Thr Lys Leu Arg Leu Arg Leu Pro Leu Pro Arg Asp

85 90 95

Lys Val Lys Gln Ile Leu Val Glu Met Val Arg Lys Ser Gly Ile Arg

100 105 110

Asp Ala Phe Val Glu Leu Ile Val Thr Arg Gly Leu Lys Gly Val Arg

115 120 125

Gly Thr Arg Pro Glu Asp Ile Val Asn Asn Leu Tyr Met Phe Val Gln

130 135 140

Pro Tyr Val Trp Val Met Glu Pro Asp Met Gln Arg Val Gly Gly Ser

145 150 155 160

Ala Val Val Ala Arg Thr Val Arg Arg Val Pro Pro Gly Ala Ile Asp

165 170 175

Pro Thr Val Lys Asn Leu Gln Trp Gly Asp Leu Val Arg Gly Met Phe

180 185 190

Glu Ala Ala Asp Arg Gly Ala Thr Tyr Pro Phe Leu Thr Asp Gly Asp

195 200 205

Ala His Leu Thr Glu Gly Ser Gly Phe Asn Ile Val Leu Val Lys Asp

210 215 220

Gly Val Leu Tyr Thr Pro Asp Arg Gly Val Leu Gln Gly Val Thr Arg

225 230 235 240

Lys Ser Val Ile Asn Ala Ala Glu Ala Phe Gly Ile Glu Val Arg Val

245 250 255

Glu Phe Val Pro Val Glu Leu Ala Tyr Arg Cys Asp Glu Ile Phe Met

260 265 270

Cys Thr Thr Ala Gly Gly Ile Met Pro Ile Thr Thr Leu Asp Gly Met

275 280 285

Pro Val Asn Gly Gly Gln Ile Gly Pro Ile Thr Lys Lys Ile Trp Asp

290 295 300

Gly Tyr Trp Ala Met His Tyr Asp Ala Ala Tyr Ser Phe Glu Ile Asp

305 310 315 320

Tyr Asn Glu Arg Asn

325

<210> 3

<211> 978

<212> DNA

<213>Aspergillus terreus（Aspergillus terreus）NIH2624

<220>

<223>The encoding gene of transaminase

<400> 3

atggcctcca tggacaaagt ctttgccggc tacgccgccc gccaagcgat cctcgaatca 60

accgagacca ccaacccctt tgcgaagggt atcgcctggg tagaaggcga gctggtgccc 120

ctggcagagg cacgcattcc actgctcgac cagggcttca tgcacagcga tctcacctac 180

gacgtgccct ccgtctggga cggccgcttc ttccggctag acgaccacat cacgcggctc 240

gaagccagct gcaccaagct ccggctgcga ctgccactcc cgcgcgacca ggtcaagcag 300

attctcgtcg agatggtggc caagagcggc atccgcgacg cctttgtcga gctgatcgtg 360

acgcgcgggc tgaagggcgt gcgggggaca cgccccgagg acatcgtcaa caatctgtac 420

atgtttgtgc agccgtacgt gtgggtgatg gagccggata tgcagcgtgt cggcggcagc 480

gcggtcgtcg cccgcaccgt gcgccgggtg cccccgggtg ccatcgaccc aaccgtcaag 540

aacctgcaat ggggcgatct cgtgcgcggc atgttcgagg ctgcggatcg cggtgcaact 600

tatccgttct tgacggacgg agatgcccat ctcaccgaag gctctgggtt caatattgtg 660

ctcgtcaagg acggcgtgct gtacacacca gaccgtggtg tgctgcaggg cgtgacacga 720

aagagtgtta tcaatgcggc ggaagccttc gggattgaag tccgcgttga gtttgtgccg 780

gttgagctgg cgtaccgttg tgatgagatc tttatgtgta ccaccgctgg cggcatcatg 840

cctatcacta cgctggatgg gatgcccgtg aatggaggac agatcggtcc tattacgaag 900

aagatttggg atggatattg ggctatgcat tatgatgcgg cttacagctt cgagattgat 960

tataacgaga ggaactga 978

<210> 4

<211> 978

<212> DNA

<213>Artificial sequence

<220>

<223>Primers F 1

<400> 4

ggggccatat ggcctccatg gacaaagtct tt 32

<210> 5

<211> 978

<212> DNA

<213>Artificial sequence

<220>

<223>Primer R1

<400> 5

gggccggatc ccgttataat caatctcgaa gc 32

Claims

1. the restructuring transaminase mutant that a kind of PLP is relied on, it is characterised in that with the base shown in SEQ ID NO.3 Because the Aspergillus terreus NIH2624 wild types transaminase for encoding is to set out enzyme, by the enzyme active center and dredging for activated centre is oriented to The amino acid residue in some sites in aquaporin sports the restructuring higher of catalysis activity that other amino acid residues obtain Transaminase mutant；Described activated centre is defined as near substrate binding site aboutDiameter of Spherical Volume；Described Restructuring transaminase variant amino acid sequence is preferably as shown in SEQ ID NO.2.

2. it is a kind of encode claim 1 described in restructuring transaminase mutant gene, it is characterised in that nucleotide sequence such as SEQ Shown in ID NO.1.

3. a kind of expression vector of the gene containing described in claim 2, preferred expression carrier system is pET21a.

4. a kind of genetic engineering bacterium for producing the restructuring transaminase mutant described in claim 1, it is characterised in that described Contain the gene described in claim 2 in genetic engineering bacterium.

5. genetic engineering bacterium according to claim 4, it is characterised in that the host cell of the genetic engineering bacterium is large intestine Escherichia (Escherichia coli) BL21 (DE3).

6. the preparation method of the restructuring transaminase mutant described in a kind of claim 1, it is characterised in that comprise the following steps：Training The genetic engineering bacterium any one of claim 4~5 is supported, the restructuring transaminase of recombination expression is obtained.

7. method according to claim 6, it is characterised in that methods described is included under production tank fermentation condition, carries out work The step of industryization prepares the restructuring transaminase mutant；Described production tank fermentation condition is preferred：DO more than 35%, air Flow 1:1.5vvm.

8. application of the restructuring transaminase described in claim 1 as catalyst in chiral amine compound is prepared, described hand The property preferred sitagliptin of amines or its intermediate；Described intermediate further preferably (R) -3- amino -4- (2,4,5- tri- Fluorophenyl)-methyl butyrate.

9. application according to claim 8, it is characterised in that in the reaction solution of pH 6.5~7.5, trembles in 5- phosphoric acid pyrroles In the presence of aldehyde, under the restructuring transaminase mutant effect described in claim 1, it is catalyzed by substrate enantioselective enzyme of compound A Reduction prepares optics chiral amine compound：

10. a kind of synthetic method of sitagliptin, it is characterised in that reaction scheme is as follows：