CN106755435B - Application of product for detecting glycolysis related gene in preparation of nasopharyngeal carcinoma diagnostic kit - Google Patents
Application of product for detecting glycolysis related gene in preparation of nasopharyngeal carcinoma diagnostic kit Download PDFInfo
- Publication number
- CN106755435B CN106755435B CN201611240543.6A CN201611240543A CN106755435B CN 106755435 B CN106755435 B CN 106755435B CN 201611240543 A CN201611240543 A CN 201611240543A CN 106755435 B CN106755435 B CN 106755435B
- Authority
- CN
- China
- Prior art keywords
- pcr
- gck
- primer
- dna
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an application of a product for detecting glycolysis related genes in preparing a nasopharyngeal darcinoma diagnostic kit. The glycolytic related genes are GCK gene, HK2 gene and HIF 1-alpha gene respectively, the kit comprises PCR primers, DNA standard products and PCR reaction liquid, the PCR primers comprise primer groups aiming at corresponding sites of GCK, HK2 and HIF 1-alpha, the DNA standard products comprise mutant standard product DNA and wild type standard product DNA, and the PCR reaction liquid comprises PCR Buffer, MgCl2, dNTP and Taq enzyme. The invention carries out genotyping detection by combining a multiplex PCR technology, a single base extension technology and a matrix-assisted laser desorption ionization time-of-flight mass spectrometry technology, and has the advantages of accurate detection result, high specificity, short detection period and sensitive detection method.
Description
Technical Field
The invention relates to the technical field of in-vitro nucleic acid detection, in particular to application of a product for detecting glycolysis related genes in preparation of a nasopharyngeal carcinoma diagnostic kit.
Background
Nasopharyngeal carcinoma (NPC) is a highly invasive malignancy derived from the Nasopharyngeal epithelium. Statistically, in 2012, 86,700 people who are new cases of nasopharyngeal carcinoma and 50,800 people who are dead cases, so that it is considered as a relatively rare malignancy worldwide. However, in epidemic areas, including southern China and southeast Asia, the incidence of nasopharyngeal carcinoma can reach 15-50/100000. The nasopharynx has deep anatomical parts, a plurality of important blood vessels and nerves are nearby, and the special anatomical positions and the biological behaviors of local invasive growth make the surgical treatment difficult to realize; most of the pathological types of nasopharyngeal carcinoma are sensitive to radiation, and the currently accepted effective treatment means for nasopharyngeal carcinoma is radiotherapy. The early nasopharyngeal carcinoma patients have ideal effect by adopting simple radiotherapy, but because the early symptoms of the nasopharyngeal carcinoma are not obvious, most patients have been in middle and late stages at the time of treatment, tumor tissues have invaded to the periphery, and even have distant metastasis, the total survival rate of the nasopharyngeal carcinoma treated by simple radiotherapy is not ideal. In order to improve the overall survival rate of patients with middle and late nasopharyngeal carcinoma, chemotherapy has been applied to the comprehensive treatment of nasopharyngeal carcinoma, because the overall survival rate of patients with middle and late nasopharyngeal carcinoma is obviously reduced due to higher local recurrence rate and distant metastasis rate. Although the current NPC treatment makes a favorable progress, the treatment effect of many patients is obviously different from that of the patients at the earlier stage because the early symptoms of the nasopharyngeal carcinoma are not obvious and the growth mode of local invasion and distant metastasis is easy, so that the treatment of the patients at the middle and late stages is realized.
Therefore, an effective molecular marker for clinical diagnosis and treatment of NPC is found, and the molecular marker has important significance for early diagnosis and early treatment of patients and improvement of survival time.
Tumor cells recode metabolism to promote proliferative growth and long-term survival. The most important features of this recoded metabolic process are increased glucose uptake and fermentation of glucose to produce lactate, even in the presence of sufficient oxygen and normal mitochondrial function. This is known as the Warburg effect. This effect is likely to be an adaptation to indirect hypoxia during the early development of malignant tumors. Enhanced glycolysis would lose a large mitochondrial productivity, but changes in the internal environment also make tumor cells more resistant to acidosis, provide raw materials for biosynthesis of macromolecules, and protect cells from oxidative stress damage.
Single Nucleotide Polymorphism (SNP) is a variation with a certain frequency (> 1%) in human population, and specifically, a DNA sequence is changed due to a Single base variation (including insertion, substitution, deletion) in a genome, so that the human genome has more diversity. Many studies have shown that SNPs of many genes are closely related to occurrence, development, prognosis and treatment sensitivity of various diseases including tumors, which suggests that SNPs have the potential to be applied to clinical prevention, screening, diagnosis and guidance of related diseases, which is of great significance for personalized treatment and precise treatment.
At present, a plurality of researches show that glycolytic pathway gene SNP is closely related to the development of a plurality of tumors, but glycolytic pathway gene change and nasopharyngeal carcinoma risk are not researched so far. Based on the method, key genes of a glycolytic pathway of the nasopharyngeal carcinoma are used as entry points to detect 30 labeled SNPs of 4 key genes of glycolytic pathway Hexokinase 2(Hexokinase2, HK2), Hypoxia Inducible Factor-1 alpha (Hypoxia inducer Factor-1 alpha, HIF-1 alpha), Glucokinase (Glucokinase, GCK) and Lactate Dehydrogenase (LDH), which has important significance for establishing a new nasopharyngeal carcinoma screening risk technology, can screen the diseased risk of the nasopharyngeal carcinoma early, sensitively and stably so as to perform timely and effective monitoring evaluation and intervention, reduce medical cost and save social resources.
At present, the diagnosis of nasopharyngeal carcinoma in hospitals mainly depends on the traditional conventional pathological method, the early diagnosis rate is low, and the prevention effect on the nasopharyngeal carcinoma is poor; in addition, no sequencing primer and corresponding detection kit aiming at the glycolysis related genes GCK, HK2 and HIF 1-alpha are available, so the method has important significance for establishing a new in-vitro diagnosis method for screening nasopharyngeal carcinoma risks.
Disclosure of Invention
In order to solve the technical problem that the conventional nasopharyngeal darcinoma diagnosis method has low early diagnosis rate to cause the development and deterioration of the disease of a patient, the invention provides the application of a product for detecting glycolysis related genes in preparing a nasopharyngeal darcinoma diagnosis kit.
The invention provides an application of a product for detecting glycolysis related genes in preparing a nasopharyngeal carcinoma diagnostic kit, wherein the glycolysis related genes are GCK gene, HK2 gene and HIF 1-alpha gene respectively, and the sequences of the glycolysis related genes are SEQ ID NO: 1:
3'-AGTATATGTCCCAAATTGTGCATAACATAATGTGTTTTCTCCGCCAGCCCTGGGAAGGGCGTAACTTCCCAGGTATTTCTAGGTGAAGTAACTTTGTAGATCAGGAGTAAG-5' (see NCBI DBSNP database dbSNP database NC-000007.14),
SEQ ID NO：2：
5'-CACTGTGTGTTTAAATTTGGAGTCTGGTGTCTAGCATTAGCTGGGGTTGGAGCTTCCACTCCTCTCAGCATTGGTAAGCCTCCTCACCCACCCCATCCCATGTCCAAGATC-3' (see NCBI DBSNP database dbSNP database NC-000002.12) and
SEQ ID NO：3：
5'-CACATATTGCATGTACTTTGTCCAATCACCCTCTGATGCAGTTACTATTATGCTCATTTTACAGATGATAGAAGGCTTATAATGACAACCCTAGGATAACAAAGGCAGTAAAGAACAGAGCTGGTCTTAAA-3' (see NCBI DBSNP database dbSNP database NC-000014.9);
the nasopharyngeal carcinoma diagnostic kit takes the glycolysis related genes GCK, HK2 and HIF 1-alpha as diagnostic markers;
the kit comprises a PCR primer, a DNA standard substance and a PCR reaction solution;
the PCR primers comprise a primer group aiming at GCK rs2244164 site, HK2rs656489 site and HIF 1-alpha rs10136168 site, and the primer group comprises:
(1) for the GCK rs2244164 site,
the amplification primers are as follows:
GCK rs2244164 forward amplification primer:
5’-ACGTTGGATGCATAATGTGTTTTCTCCGCC-3’(SEQ ID NO：4)；
GCK rs2244164 reverse amplification primer:
5’-ACGTTGGATGGGGACTTACTCCTGATCTAC-3’(SEQ ID NO：5)；
(2) for HK2rs656489 site,
the amplification primers are as follows:
HK2rs656489 forward amplification primer:
5’-ACGTTGGATGCTGGTGTCTAGCATTAGCTG-3’(SEQ ID NO：6)；
HK2rs656489 reverse amplification primer:
5’-ACGTTGGATGTGATCTTGGACATGGGATGG-3’(SEQ ID NO：7)；
(3) for the HIF1- α rs10136168 site,
the amplification primers are as follows:
forward amplification primer HIF1- α rs 10136168:
5’-ACGTTGGATGTCACCCTCTGATGCAGTTAC-3’(SEQ ID NO：8)；
HIF1- α rs10136168 reverse amplification primer:
5’-ACGTTGGATGCAGCTCTGTTCTTTACTGCC-3’(SEQ ID NO：9)。
in a preferred embodiment of the application of the product for detecting glycolytic related gene in the preparation of a nasopharyngeal carcinoma diagnostic kit, the DNA standard comprises a mutant DNA standard, i.e. a positive control, and a wild DNA standard, i.e. a negative control; wherein the mutant standard DNA is GCK rs2244164 mutant homozygotic and mutant heterozygotic DNA (the gene sequence is shown in NCBI DBSNP database dbSNP database NC-000007.14), HK2rs656489 mutant homozygotic and mutant heterozygotic DNA (the gene sequence is shown in NCBI DBSNP database dbSNP database NC-000002.12), HIF 1-alpha rs10136168 mutant homozygotic and mutant heterozygotic DNA (the gene sequence is shown in NCBI DBSNP database dbSNP database NC-000014.9); wherein the wild type standard DNA is GCK rs2244164 wild type DNA (the gene sequence is shown in NCBI DBSNP database dbSNP database NC _000007.14), HK2rs656489 wild type DNA (the gene sequence is shown in NCBI DBSNP database dbSNP database NC _000002.12) and HIF 1-alpha rs10136168 wild type DNA (the gene sequence is shown in NCBI DBSNP database dbSNP database NC _ 000014.9).
In a preferred embodiment of the application of the product for detecting glycolytic related gene in the preparation of a nasopharyngeal carcinoma diagnostic kit, the PCR reaction solution comprises PCR Buffer, MgCl2, dNTP and Taq enzyme.
In a preferred embodiment of the application of the product for detecting glycolytic related gene in the preparation of a nasopharyngeal carcinoma diagnostic kit, the ratio of the reagent components of the PCR primer to the reagent components of the PCR reaction solution is as follows:
1×PCR Buffer；
MgCl225mM；
dNTP 25mM；
5U/mul of Taq enzyme;
PCR primer 500 nM; and
an appropriate amount of ultrapure water.
Compared with the prior art, the application of the product for detecting glycolysis related genes in the preparation of the nasopharyngeal carcinoma diagnostic kit has the following beneficial effects that:
compared with the conventional nasopharyngeal carcinoma diagnosis method, the primer set and the kit have the characteristics of rapidness, sensitivity, good specificity and the like, and can evaluate the risk of the nasopharyngeal carcinoma of the human in time at an early stage so as to take necessary measures such as prevention, early diagnosis and early treatment;
secondly, genotyping detection is carried out by combining a multiplex PCR technology, a single base extension technology and a matrix-assisted laser desorption ionization time-of-flight mass spectrometry technology, and the method has the advantages of accurate detection result, high specificity, short detection period and sensitive detection method;
and thirdly, the positive control substance and the negative control substance are arranged in the kit, so that the kit can better ensure the accuracy of the detection result when detecting the genotyping of the glycolysis related genes GCK, HK2 and HIF 1-alpha.
Drawings
FIG. 1 is a sequence diagram of the wild type of the GCK rs2244164 locus in a clinical sample;
FIG. 2 is a sequence diagram of clinical samples GCK rs2244164 site mutation heterozygote;
FIG. 3 is a sequence chart of the homozygous mutation at the GCK rs2244164 locus in a clinical sample;
FIG. 4 is a histogram of clinical sample HK2rs656489 locus wild type;
FIG. 5 is a sequence chart of clinical specimen HK2rs656489 site mutation heterozygote;
FIG. 6 is a sequence chart of the homozygous type of the mutation at HK2rs656489 site in clinical samples;
FIG. 7 is a sequence diagram of a wild type HIF1- α rs10136168 site in a clinical sample;
FIG. 8 is a sequence diagram of clinical samples HIF1- α rs10136168 site mutation heterozygous;
FIG. 9 is a sequence chart of the homozygous type of the HIF 1-alpha rs10136168 site mutation in the clinical sample.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be further described in detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
First, experimental object
The clinical study strictly followed the Halsky declaration and was approved by the Ethics Committee of the affiliated tumor Hospital of Hunan Yay medical college, Zhongnan university.
Inclusion criteria for study group cases:
1) 723 patients who were admitted to the affiliated tumor hospital of Xiangya medical college of Zhongnan university from 10 months to 2016 months in 2014 and were confirmed to be nasopharyngeal carcinoma by histopathology were selected.
2) Those who had not undergone other treatments such as radiotherapy and chemotherapy prior to enrollment.
3) There has been no history of nasopharyngeal carcinoma and other malignant tumors.
4) There was no history of blood transfusions 6 months prior to blood specimen collection.
5) All questionnaires relevant to the study were consented to be accepted and venous blood donated.
6) Agree to fill in the book informed consent.
7) All subjects were not related to each other.
Inclusion criteria for control group:
1) 857 normal residents who have been examined in the Hospital of Sanjian Hospital in Changsha at the same period are selected for epidemic diseases
The screening result does not have any history of malignant tumors.
2) Resident in Hunan province.
3) All questionnaires relevant to the study were consented to be accepted and venous blood donated.
4) All subjects were approved to fill in the informed consent form.
Second, Experimental scheme
Case control studies were performed to design case groups and healthy control groups. The SNP of 3 key genes in glycolysis pathway is detected by utilizing a Mass ARRAY system through a pathway for detecting peripheral blood cells: GCK rs2244164 locus (gene sequence see NCBI dbSNP database NC _000007.14), HK2rs656489 locus (gene sequence see NCBI dbSNP database NC _000002.12), HIF 1-alpha rs10136168 locus (gene sequence see NCBI dbSNP database NC _ 000014.9). Hardy-Weinberg equilibrium conformity and comparison of genotype distribution among groups were measured using Haploview, SPSS 18.0.
Sequencing was performed using MassArray (Sequenom, USA) from Bio Miao Biological Technology (Beijing, China). The primer design used was iPLEX GOLD (Sequenom, USA). Sequenom
The SNP detection process combines a multiple PCR technology, a MassARRAY iPLEX single base extension technology and a Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF) technology for typing detection. The specific principle is that specific PCR primers and extension primers are designed according to site information, a DNA template containing an SNP site region is amplified through a PCR technology, redundant dNTPs of an amplification product are removed through SAP enzyme, then single base extension is carried out on a site to be detected simultaneously, and the site-specific extension primers extend one base at a mutation site and terminate. The extension primer will be connected with different ddNTPs according to the difference of mutation types, so as to form the molecular weight difference. After the extension products are purified by resin, the extension products are spotted on a target sheet, a mass spectrometer is used for detecting the molecular weight difference of different extension products, and the specific genotype of each mutation site can be obtained through data analysis. And deducing whether the nasopharyngeal carcinoma is at high risk or not according to the three genotypes detected.
Third, Experimental methods
3.1 clinical specimen collection:
collecting 2-5ml venous blood of nasopharyngeal carcinoma patients and normal physical examination personnel according to the entry and discharge standard, performing anticoagulation with EDTA, extracting DNA by using Omega kit, and storing in a refrigerator at-20 ℃.
All the subjects were genotyped at the sites GCK rs2244164, HK2rs656489 and HIF1- α rs10136168 using the MassARRAY sequential (Bio Miao Biological Technology (Beijing, China)) time-of-flight mass spectrometry biochip system to analyze the correlation with the risk of developing nasopharyngeal carcinoma.
3.2DNA extraction:
DNA extraction kit (Omega USA) DNA was extracted from whole blood, following the exact kit instructions. The method comprises the following specific steps:
1) the blood sample in the EDTA anticoagulation tube is inverted for several times and fully mixed;
2) adding whole blood into a 15ml centrifuge tube, adding 2.5 times of cell lysate Buffer NL, and turning upside down for 5 times to fully lyse cells; all buffer solutions were added as per Table 2.
3) Centrifuge at 2000 Xg for 5 minutes. The supernatant was slowly discarded and the tube was inverted on clean absorbent paper for 2 minutes to ensure that the pellet was always in the tube.
4) A mixture of buffer XL and protease OB was prepared as shown in Table 1. The mixture was added in 0.5 volume and immediately vortexed for 10 seconds until the pellet distribution was completely uniform.
5) The water bath was maintained at 65 ℃ for 10-30 minutes, during which time the precipitate was observed to dissolve completely and become a clear greenish black solution.
6) And when the clear dark green solution is cooled to room temperature, adding isopropanol, reversing, and fully and uniformly mixing until white filiform or clustered genome DNA appears.
7) Centrifuge at 2000 Xg for 5 minutes. The supernatant was slowly discarded. The centrifuge tube was inverted over clean absorbent paper until the water run out.
8) 70% ethanol solution was added thereto, and the mixture was inverted from the top to the bottom for 10 seconds, followed by washing to remove genomic DNA.
9) Centrifuge at 2000 Xg for 3 min. The supernatant was slowly discarded. Centrifuge again for 1minute and wash the upper. The centrifuge tube was inverted on clean absorbent paper for 10-15 minutes until the ethanol in the tube was completely volatilized.
10) 200 and 500 mul of DNA dissolving solution EB Buffer are added into the centrifuge tube, and DNA and the Buffer solution are stirred evenly by a gun.
11) The centrifuge tubes were incubated in a 65 ℃ water bath for 10 minutes to 1 hour to ensure complete dissolution of the DNA during this process.
12) And (3) determining the OD value of the sample by using a trace nucleic acid concentration analyzer, recording the DNA concentration, and storing in an environment at the temperature of-20 ℃.
TABLE 1 various buffer capacities required for different volumes of blood
3.3 Gene polymorphic site selection:
by using biotechnology information and the mononucleotide polymorphic database of the national center of the international HapMap program database, the Han nationality people are obtainedGCK, HK2, IDH1 and HIF-1 α genes and information of 500kb upstream and downstream2< 0.8, minimum allele frequency greater than 5% (in Han population), labeled SNP.
3.4 Gene polymorphism detection and analysis:
3.4.1 primer design and Synthesis
Based on the SNP site sequence information, PCR reactions and single base extension primers were designed using the primer design software Assay design3.1 of sequenom, see Table 2.
TABLE 2 primer set for cancer glycolysis-related genotyping
3.4.2 DNA extraction
And extracting DNA in blood samples, tissues, cells and saliva by using a finished product kit. The OD value detection and the 1.25% agarose gel electrophoresis detection are carried out by using a NanoDrop2000 instrument (Beijing Corerdcondo Co., Ltd.), the DNA quality is qualified, and the DNA is transferred to -96 pore plates and stored at the temperature of 20 ℃ for later use.
3.4.3 Sequenom MassArray System genotyping procedure
A) PCR amplification reaction
1) Principle of
Polymerase Chain Reaction (PCR) is used to amplify a region of DNA located between known sequences at both ends. The reaction mix was incubated at three different temperatures for template denaturation, primer annealing and primer extension sequentially for each PCR cycle. The process can be automated using a programmable temperature thermal cycler.
2. Step (ii) of
1) A1.5 ml EP tube was used to prepare a PCR premix (PCR master mix), and the mixture was centrifuged at low speed with shaking. Reaction components, see table 3:
TABLE 3 PCR master mix reaction-related reagent formulation components
Remarking: MgCl2The final concentration was 3.5mM, 1.875mM in PCR Buffer, and MgCl21.625mM was added per se.
2) An 8-channel or 12-channel liquid dispenser is selected, 4 ul of PCR master mix is added into each sample adding well of a 384-well plate, 1 ul of template DNA (20ng/ul) is finally added and mixed evenly, a 384-well sealing plate membrane is carefully covered, and each well is firmly pressed, so that phenomena such as evaporation and the like during a PCR procedure are prevented. Centrifuge 1minute at 1000 rpm.
3) The following PCR amplification reaction system was set up, see Table 4. The PCR reaction plate was placed on the PCR instrument and the program was started.
TABLE 4 PCR amplification reaction System
B) Product alkaline phosphatase treatment
1) After the PCR reaction was completed, the PCR product was treated with SAP (Shrimp alkaline phosphatase) to remove free dNTPs from the system.
2) Alkaline phosphatase treatment reaction solution, SAP Mix reaction components, were prepared in a new 1.5ml ep tube, see table 5:
TABLE 5 SAP Mix reaction Components
| SAP mix reagent | Concentration of | Volume (1rxn) |
| Water, HPLC grade | NA | 1.53μl |
| SAP Buffer | 10X | 0.17μl |
| SAP enzymes | 1U/ul | 0.30μl |
| Total of | - | 2.00μl |
3) SAP mix was added to 384 well PCR reaction plates in a total reaction volume of 7ul for each alkaline phosphatase treated reaction well, 5ul for the PCR product and 2ul for SAP mix.
4) after completion, a 384-well sealing plate was carefully placed on the plate and each well was tightly pressed to prevent evaporation during the PCR process, and the reaction procedure was performed after centrifugation.
5) Setting up SAP reaction program: 20min at 37 ℃; 5min at 85 ℃; infinity at 4 ℃. And a 384 well reaction plate was placed on the PCR instrument and the procedure was started.
C) Single base extension reaction
1) After the alkaline phosphatase treatment was completed, the single-base extension reaction was carried out in a total volume of 9. mu.l.
2) Single base extension reactions, EXTEND Mix reaction components, were prepared in new 1.5ml EP tubes, see Table 6:
TABLE 6 EXTEND Mix reaction components
| EXTEND Mix reagent | Concentration (in 9. mu.l) | Volume (1rxn) |
| Water, HPLC grade | NA | 0.619μl |
| iPLEX Buffer Plus | 0.222X | 0.200μl |
| iPLEX termination mixture | 1X | 0.200μl |
| Primer set (7. mu.M: 14. mu.M) | 0.625uM：1.25uM | 0.940μl |
| iPLEX enzyme | 1X | 0.041μl |
| Total of | - | 2.0μl |
Remarking: (7. mu.M: 14. mu.M) is expressed as double concentration of the high quality primer set. That is, the concentration of the low-quality primer set was 0.625. mu.M and the concentration of the high-quality primer set was 1.25. mu.M in the final reaction solution of 9. mu.l concentration.
3) EXTEND Mix was added to 384 well reaction plates. For each reaction well, a single base extension reaction system, see table 7:
TABLE 7 Single-base extension reaction System
| Reagent | Volume (ul) |
| EXTEND |
2 |
| SAP + PCR reaction solution | 7 |
| Total of | 9 |
4) after completion, a 384-well sealing plate was carefully placed on the plate and each well was tightly pressed to prevent evaporation during the PCR process, and the reaction procedure was followed after centrifugation.
5) Set up extension reaction procedure, see table 8:
TABLE 8 elongation reaction procedure
D) Resin purification
1) The resin was uniformly filled in an 384/6MG Dimple plate and left to dry for 10 minutes.
2) Add 16. mu.L of water to each well of 384 sample plates.
3) The 384 sample plate was gently inverted and snapped onto the sample plate and then tapped to drop the resin into each well of the sample plate.
4) The 384 sample plates were placed in a tumbling centrifuge and spun for 30 minutes at room temperature.
E) Chip sample application
The MassARRAY Nanodispenser RS1000 spotting instrument was started and the resin purified extension product was applied to 384-well SpectroCHIP bioarray.
F) Mass spectrometric detection and data output
Analyzing the spotted SpectroCHIP chip by using a MALDI-TOF mass spectrometer (Bruker company, Germany), acquiring original data and a genotyping chart by using TYPER4.0 software according to a detection result, checking the integrity and the correctness of a data file, storing the result into a corresponding storage medium, and then performing bioinformatics analysis.
Fourth, result analysis
By using
SPSS statics 18 software, HAPLOVIEW4.2 software. The Hardy-Weinberg equilibrium model was used to measure the genotype and allele frequencies of the samples. Pearson's chi-square test or Fisher's exact test (when any expected frequency is less than 5) was used to compare genotype to allele distribution frequency between the case and control groups. The risk ratio (Odds ratios, OR) and 95% Confidence intervals (confidences intervals, CI) were calculated to assess the relative risk of each genotype to the allele.
For each genotype, comparisons were made to the reference genotype and subgroup analyses were performed according to gender classification. Interclass clinical profile data were tested using the chi-square test. A p-value of less than 0.05 is considered statistically significant.
The results are as follows:
1. interesting distribution of SNP sites in case and control groups is shown in Table 9.
TABLE 9 distribution of SNP sites in case group and control group
HIF-1a rs10136168 is a single nucleotide polymorphism located at the upstream of a gene, and the invention discovers that at the site, compared with the population of wild GG and mutant homozygous GA, the population carrying mutant heterozygous GA is a high-incidence population suffering from nasopharyngeal carcinoma, and 95% confidence interval is 1.042-1.618.
2. Distribution of SNP sites in the male subgroup, see table 10.
TABLE 10 distribution of SNP sites in Male subgroups
In the male subgroup, no statistically significant findings were found in the population between the genotype distributions at the HIF1- α rs17113978 site.
3. Distribution of SNP sites in the female subgroup, see table 11.
TABLE 11 distribution of SNP sites in female subgroups
In female subgroups, GCK rs2244164 mutant homozygote CC is found to have obvious high risk of nasopharyngeal carcinoma, wherein the risk of nasopharyngeal carcinoma is 1.97 times that of non-mutant population, and 95% confidence interval is 1.067-3.653. This single nucleotide polymorphism is located in an intron of the glucokinase coding gene, and has enhancer properties, which may accelerate the glycolytic pathway. Mutant allele A in HK2rs656489 is a protective factor for diseases, the risk of the diseases is 0.655 times that of the non-mutant population, and the 95% confidence interval is 0.449-0.985. Its non-coding region, located at the 5' end of the gene, may be involved in regulating transcription, mRNA stabilization and transfer and thus the above single nucleotide polymorphisms may have a significant impact on the Warburg effect.
In addition, the sequencing results are graphically depicted in FIGS. 1-9. Wherein, FIGS. 1-3 are sequencing charts of the wild type, mutation heterozygote and mutation homozygote of the GCK rs2244164 locus in clinical samples respectively; FIGS. 4-6 are sequencing charts of wild type, mutant heterozygous type and mutant homozygous type at HK2rs656489 locus, respectively, in clinical samples; FIGS. 7-9 are sequencing charts of wild type, mutation heterozygous type and mutation homozygous type at HIF1- α rs10136168 site in clinical samples, respectively. The sequencing result is real and reliable, and meets the standard requirements of clinical detection on genotyping. The application of the product for detecting glycolysis related gene in the preparation of the nasopharyngeal carcinoma diagnostic kit has the following beneficial effects that:
compared with the conventional nasopharyngeal carcinoma diagnosis method, the primer set and the kit have the characteristics of rapidness, sensitivity, good specificity and the like, and can evaluate the risk of the nasopharyngeal carcinoma of the human in time at an early stage so as to take necessary measures such as prevention, early diagnosis and early treatment;
secondly, genotyping detection is carried out by combining a multiplex PCR technology, a single base extension technology and a matrix-assisted laser desorption ionization time-of-flight mass spectrometry technology, and the method has the advantages of accurate detection result, high specificity, short detection period and sensitive detection method;
and thirdly, the positive control substance and the negative control substance are arranged in the kit, so that the kit can better ensure the accuracy of the detection result when detecting the genotyping of the glycolysis related genes GCK, HK2 and HIF 1-alpha.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent flow transformations made by the present specification, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.
SEQUENCE LISTING
<110> aqua regia
Application of glycolysis related gene in preparation of nasopharyngeal carcinoma diagnostic kit
<130>2016
<160>9
<170>PatentIn version 3.3
<210>1
<211>111
<212>DNA
<213> Artificial sequence
<400>1
agtatatgtc ccaaattgtg cataacataa tgtgttttct ccgccagccc tgggaagggc 60
gtaacttccc aggtatttct aggtgaagta actttgtaga tcaggagtaa g 111
<210>2
<211>111
<212>DNA
<213> Artificial sequence
<400>2
cactgtgtgt ttaaatttgg agtctggtgt ctagcattag ctggggttgg agcttccact 60
cctctcagca ttggtaagcc tcctcaccca ccccatccca tgtccaagat c 111
<210>3
<211>131
<212>DNA
<213> Artificial sequence
<400>3
cacatattgc atgtactttg tccaatcacc ctctgatgca gttactatta tgctcatttt 60
acagatgata gaaggcttat aatgacaacc ctaggataac aaaggcagta aagaacagag 120
ctggtcttaa a 131
<210>4
<211>30
<212>DNA
<213> Artificial sequence
<400>4
acgttggatg cataatgtgt tttctccgcc 30
<210>5
<211>30
<212>DNA
<213> Artificial sequence
<400>5
acgttggatg gggacttact cctgatctac 30
<210>6
<211>30
<212>DNA
<213> Artificial sequence
<400>6
acgttggatg ctggtgtcta gcattagctg 30
<210>7
<211>30
<212>DNA
<213> Artificial sequence
<400>7
acgttggatg tgatcttgga catgggatgg 30
<210>8
<211>30
<212>DNA
<213> Artificial sequence
<400>8
acgttggatg tcaccctctg atgcagttac 30
<210>9
<211>30
<212>DNA
<213> Artificial sequence
<400>9
acgttggatg cagctctgtt ctttactgcc 30
Claims (4)
1. The application of a product for detecting glycolysis related genes in preparing a nasopharyngeal carcinoma diagnostic kit is characterized in that the glycolysis related genes are GCK gene, HK2 gene and HIF 1-alpha gene respectively, and the sequences of the glycolysis related genes are SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3, the nasopharyngeal carcinoma diagnosis kit takes the glycolysis related genes GCK, HK2 and HIF 1-alpha as diagnosis markers;
the kit comprises a PCR primer, a DNA standard substance and a PCR reaction solution;
the PCR primers comprise a primer group aiming at GCK rs2244164 site, HK2rs656489 site and HIF 1-alpha rs10136168 site, and the primer group comprises:
(1) for the GCK rs2244164 site,
the amplification primers are as follows:
GCK rs2244164 forward amplification primer:
5’-ACGTTGGATGCATAATGTGTTTTCTCCGCC-3’；
GCK rs2244164 reverse amplification primer:
5’-ACGTTGGATGGGGACTTACTCCTGATCTAC-3’；
(2) for HK2rs656489 site,
the amplification primers are as follows:
HK2rs656489 forward amplification primer:
5’-ACGTTGGATGCTGGTGTCTAGCATTAGCTG-3’；
HK2rs656489 reverse amplification primer:
5’-ACGTTGGATGTGATCTTGGACATGGGATGG-3’；
(3) for the HIF1- α rs10136168 site,
the amplification primers are as follows:
forward amplification primer HIF1- α rs 10136168:
5’-ACGTTGGATGTCACCCTCTGATGCAGTTAC-3’；
HIF1- α rs10136168 reverse amplification primer:
5’-ACGTTGGATGCAGCTCTGTTCTTTACTGCC-3’。
2. the use of claim 1, wherein the DNA standard comprises a mutant DNA standard, a positive control, and a wild-type DNA standard, a negative control.
3. The use according to claim 1, wherein the PCR reaction solution comprises PCR Buffer, MgCl2dNTP and Taq enzyme.
4. The application of claim 3, wherein the ratio of the PCR primers to the PCR reaction solution is 1 × PCR Buffer and MgCl225 mM; dNTP 25 mM; 5U/mul of Taq enzyme; PCR primer 500 nM; and an appropriate amount of ultrapure water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611240543.6A CN106755435B (en) | 2016-12-29 | 2016-12-29 | Application of product for detecting glycolysis related gene in preparation of nasopharyngeal carcinoma diagnostic kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611240543.6A CN106755435B (en) | 2016-12-29 | 2016-12-29 | Application of product for detecting glycolysis related gene in preparation of nasopharyngeal carcinoma diagnostic kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755435A CN106755435A (en) | 2017-05-31 |
| CN106755435B true CN106755435B (en) | 2020-10-02 |
Family
ID=58923409
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611240543.6A Active CN106755435B (en) | 2016-12-29 | 2016-12-29 | Application of product for detecting glycolysis related gene in preparation of nasopharyngeal carcinoma diagnostic kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755435B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010068183A1 (en) * | 2008-12-11 | 2010-06-17 | Agency For Science, Technology And Research | Glucose-peg conjugates for reducing glucose transport into a cell |
| CN104894229A (en) * | 2014-03-04 | 2015-09-09 | 中南大学 | Hexokinase 2 biomarker for predicting nasopharyngeal carcinoma radiotherapy prognosis |
| CN105177112A (en) * | 2014-06-17 | 2015-12-23 | 中南大学 | Molecular marker miR-504 for regulating radiation resistance of nasopharyngeal carcinoma |
-
2016
- 2016-12-29 CN CN201611240543.6A patent/CN106755435B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010068183A1 (en) * | 2008-12-11 | 2010-06-17 | Agency For Science, Technology And Research | Glucose-peg conjugates for reducing glucose transport into a cell |
| CN104894229A (en) * | 2014-03-04 | 2015-09-09 | 中南大学 | Hexokinase 2 biomarker for predicting nasopharyngeal carcinoma radiotherapy prognosis |
| CN105177112A (en) * | 2014-06-17 | 2015-12-23 | 中南大学 | Molecular marker miR-504 for regulating radiation resistance of nasopharyngeal carcinoma |
Non-Patent Citations (5)
| Title |
|---|
| "Expression and prognosis of FOXO3a and HIF-1a in nasopharyngeal carcinoma";Zhu Shou et al.;《J Cancer Res Clin Oncol》;20111231;第138卷;第585-593页，参见第585页摘要部分 * |
| "Glucose Metabolism Gene Polymorphisms and Clinical Outcome in Pancreatic Cancer";Xiaoqun Dong et al.;《Cancer》;20100915;第117卷;第480-491页 * |
| "己糖激酶及其同工酶与鼻咽癌细胞增殖中的作用研究";陈玉祯;《吉林医学》;20140331;第35卷(第9期);第1824-1825页，参见第1824页摘要部分 * |
| "缺氧诱导因子-1α在鼻咽癌中的表达及与临床病理的关系";徐敏;《实用临床医药杂志》;20131231;第17卷(第19期);第35-37页，参见第35页摘要部分 * |
| "鼻咽癌分子标记物研究进展";向燕群等;《实用肿瘤杂志》;20041231;第19卷(第4期);第273-275页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755435A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210222245A1 (en) | Autism associated genetic markers | |
| US20180187265A1 (en) | Methods and compositions for correlating genetic markers with prostate cancer risk | |
| CN107488711B (en) | Method for detecting genotype of point mutation and kit thereof | |
| CN107058538B (en) | Primer composition, kit composed of primer composition and application of kit | |
| CN111235272B (en) | Composition for once detecting multiple gene mutation of lung cancer and application thereof | |
| CN106755360B (en) | Nucleic acid, kit and method for detecting human CYP2D6 gene polymorphism | |
| CN107058486B (en) | Primer group and kit for detecting glycolytic related genotyping of nasopharyngeal carcinoma | |
| CN106498028B (en) | Diagnostic method and kit for T790M mutation of EGFR | |
| JP2015180207A (en) | Combination of polymorphism for determining allele-specific expression of igf2 | |
| CN108715893B (en) | SNP markers related to radioactive brain injury caused by radiotherapy and application thereof | |
| CN113046437A (en) | Method for detecting MET E14 jump mutation | |
| WO2016019633A1 (en) | Gene polymorphism variation site diagnostic reagent kit for early evaluation of breast cancer risk | |
| Hui et al. | Novel association analysis between 9 short tandem repeat loci polymorphisms and coronary heart disease based on a cross-validation design | |
| CN106755435B (en) | Application of product for detecting glycolysis related gene in preparation of nasopharyngeal carcinoma diagnostic kit | |
| CN112592972B (en) | Early screening method and kit for diffuse toxic goiter susceptibility genes | |
| KR102158713B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of GBA gene | |
| CN108676871B (en) | Diagnostic marker for type II diabetes | |
| Peng et al. | A molecular‐beacon‐based asymmetric PCR assay for detecting polymorphisms related to folate metabolism | |
| Huijsmans et al. | Single nucleotide polymorphism profiling assay to confirm the identity of human tissues | |
| CN112553326B (en) | Primer, probe and fluorescent PCR kit for detecting neonatal jaundice UGT1A1 genotype and GST gene deletion type | |
| KR102158725B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of MINK1 gene | |
| KR102158716B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of ARHGAP32 gene | |
| KR20170051748A (en) | Single nucleotide polymorphism markers for determining of probability of skin hydration and use thereof | |
| Voutilainen | The reproducibility of the SNP genotyping with TaqMan assays and the SmartChip qPCR system | |
| US8268562B2 (en) | Biomarkers for predicting response of esophageal cancer patient to chemoradiotherapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201215 Address after: No. 582, xianjiahu Road, Changsha City, Hunan Province Patentee after: Wang Hui Patentee after: HUNAN PROVINCIAL TUMOR Hospital Address before: No. 582, xianjiahu Road, Changsha City, Hunan Province Patentee before: Wang Hui |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230505 Address after: 410006 Geoscience Building, Central South University Headquarters, Yuelu District, Changsha City, Hunan Province Patentee after: CENTRAL SOUTH University Patentee after: HUNAN PROVINCIAL TUMOR Hospital Address before: No. 582, xianjiahu Road, Changsha City, Hunan Province Patentee before: Wang Hui Patentee before: HUNAN PROVINCIAL TUMOR Hospital |