CN106754910B - The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application - Google Patents
The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application Download PDFInfo
- Publication number
- CN106754910B CN106754910B CN201710158024.3A CN201710158024A CN106754910B CN 106754910 B CN106754910 B CN 106754910B CN 201710158024 A CN201710158024 A CN 201710158024A CN 106754910 B CN106754910 B CN 106754910B
- Authority
- CN
- China
- Prior art keywords
- rice
- wbc2
- primer
- molecular labeling
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of molecular labelings mutually chain with Rice Resistance white backed planthopper gene, and using rice as species, which is selected from primer pair WBC2-12, WBC2-20.WBC2-12 is positioned on the 2nd chromosome of rice；WBC2-20 is positioned on the 2nd chromosome of rice.The present invention can be used for the identification of rice whitebacked planthopper-resistance kind and/or the assisted selection of the pest-resistant offspring of rice.
Description
Technical field
The invention belongs to agricultural biotechnology engineerings, in particular to the molecule mutually chain with rice whitebacked planthopper-resistance gene
Label and its preparation method.
Background technique
Rice white backed planthopper (Sogatella furcifera, Horv á th) is the main of China and Southeast Asia rice producing region
One of pest, since the eighties, with China's High-Yielding Hybrid Rice technology popularization and may related with hybrid vigour crop it is raw
Reason factor, white backed planthopper have become Insect Pests in Rice.It is recorded according to Chinese agriculture yearbook, retransmits time, aggrieved face in planthopper
Product is more than the 50% of China's rice gross area.1991, a wide range of planthopper that China occurs, which is caused harm, caused nearly 1,600,000,000 kilograms of rice
The loss of paddy, injured area is up to 2,9,330,000 hm2；Planthoppers in 2005 great outbursts again is superimposed effect with rice leaf roller in addition
It answers, planthopper is caused harm up to 2.6 hundred million mu times or more.Therefore, the prevention and treatment of Whitebacked Planthopper has become the important interior of Guarantee Grain Production
Hold.
The main rice varieties of large area plantation are low without resistant gene or resistance level, are the inherences of white backed planthopper outburst
Reason, in addition a large amount of applications of chemical fertilizer, the sense worm rice to flourish provides abundance for the quick breeding of white backed planthopper
Food source.For a long time, the prevention and treatment of white backed planthopper is mainly by application chemical insecticide.However, the abuse of agricultural chemical insecticide,
The rice planthopper natural enemy in rice field is killed, induces the rampant again of white backed planthopper instead.In addition, Sogatella migrating property on a large scale
Pest, annual paddy growth season, white backed planthopper move into China's rice region by generation with spring and summer warm moist air, from south toward north district by district.
The polypide of white backed planthopper early period of origination, nymph is small, and concealment is strong, is not easy to be found by peasant, and prevention and treatment enables it a large amount of not in time
Breeding, insect pest are just able to prevalence；The rice of the insect pest outburst mature pustulation period, rice strain growing way is vigorous, and insecticide is applied to rice strain base
The operation in portion is extremely difficult, in addition adult has good mobility and stronger drug resistance, as a result causes damages repeatedly and the underproduction.
Rice Resistance disease pest breeding practice proves, using anti-white backed planthopper gene or cultivates polymerization separate sources resistant gene
New varieties are methods the most cost-effective in rice white backed planthopper integrated control.Even if the rice varieties of plantation are only with medium
Horizontal resistant gene, is also enough the collective control of white backed planthopper is below horizontal what is caused damages, not will lead to white backward flight
Lice great outburst or practical harm and production loss.
On the other hand, with the development of molecular biology, make to be difficult to identify, Resistant character easily affected by environment uses
Marker assisted selection has become possibility, which not only can carry out accurate, stable selection in early generation, but also separation can be overcome single
The aobvious recessive and pure heterozygosis problem of strain improves breeding efficiency, but the basis of the technology is must to possess to accelerate breeding process
Excellent target gene and the therewith molecular labeling of close linkage.
To realize above-mentioned task, new resistant gene is excavated, the new label for developing close linkage becomes the white backward flight of Rice Resistance
The key of lice molecular breeding.Carrying out molecule Position Research to rice whitebacked planthopper-resistance earliest is McCouch, is applied first
TN1 (No. 1 local in platform)/IR36 near isogenic lines navigates to Wbph1 between two RFLP label RG146 and RG445, but by
It is that multicopy marks, and is difficult to be used as selected marker in RFLP label；Hereafter, Wbph2 and Wbph6 (t) is also successively positioned,
But their genetic distance is respectively 25.6cM and 21.2cM, and practical application still has very big difficulty.
2008100613306 invention " mutually chain molecular labeling and its development approach with Rice Resistance white backed planthopper gene "
Disclose molecular labeling RM6917, the AP4741 mutually chain with Rice Resistance white backed planthopper gene；RM6917 is positioned at the dye of rice the 6th
On colour solid, the genetic distance between SSR molecular marker and anti insect gene is 2.6cM.AP4741 is also positioned at the 6th chromosome of rice
On, the genetic distance between STS molecular labeling and anti insect gene is 3.3cM.
2012100453977 invention " mutually chain molecular labeling and its application with Rice Resistance white backed planthopper gene " is open
A kind of molecular labeling primer RM401, Wbsca1 mutually chain with Rice Resistance white backed planthopper gene；RM401 is positioned at rice the 4th
On chromosome, the genetic distance between SSR molecular marker and anti insect gene is 5.3cM；Wbsca1 is also positioned at the dyeing of rice the 4th
On body, the genetic distance between STS molecular labeling and anti insect gene is 1.2cM.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of molecular labelings mutually chain with Rice Resistance white backed planthopper gene
And application thereof, it is anti-to be used for rice white backed planthopper for the resulting molecular labeling of the present invention and whitebacked planthopper-resistance gene close linkage
Property assisted selection.
In order to solve the above technical problem, the present invention provides a kind of molecule marks mutually chain with Rice Resistance white backed planthopper gene
Note, using rice as species, which is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
WBC2-12 is positive: GCGAGGTCACGAGGACTATC
It is reversed: TCTCGGAAGTCGAGGAACTG；
WBC2-20 is positive: AACAATTTTTATCTGCGTCATACA
It is reversed: TTCGTGATTTCCTTCCTAACC.
Improvement as molecular labeling of the invention: WBC2-12 is positioned on the 2nd chromosome of rice；WBC2-20 is also positioned
In on the 2nd chromosome of rice (Fig. 1).
The present invention also provides the development approaches of above-mentioned molecular labeling, comprising the following steps:
1) it, is carried out using rice variety ZF802 as resistant gene donor parents with the near isogene based material ZCJ of sense worm miscellaneous
It hands over, to obtain the single plant as filial generation twig and shoot pest；
2), with CTAB (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonium Bromide)
Method extracts parental rice seedling and filial generation seedling genomic DNA；
3), using SSR (simple repeated sequence, simple sequence repeat) and/or STS (sequence tagged site
Sequence-tagged site) molecule labelling method carry out rice whitebacked planthopper-resistance molecular labeling screening；
4) two STS molecular labelings WBC2-12 and WBC2-20, are filtered out.
The molecular labeling WBC2-12 and WBC2-20 mutually chain with Rice Resistance white backed planthopper gene, specifically uses following methods
It obtains:
1), rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, it is close with sense worm
Isogenic line material ZCJ is hybridized, and anti-, sense worm single plant is the bases such as the anti-of acquisition, sense worm are close by hybridization, backcrossing and selfing
Because being for combo and the assignment of genes gene mapping.
2) parental rice seedling and filial generation seedling genomic DNA, are extracted with CTAB method.
3) screening of rice whitebacked planthopper-resistance molecular labeling, is carried out using SSR and STS molecule labelling method；
4) two STS molecular labeling WBC2-12 and WBC2-20, are filtered out, through linkage analysis, find the two label with
Rice Resistance white backed planthopper gene is mutually chain.
Screen using SSR and STS molecular labeling the side of the molecular labeling mutually chain with Rice Resistance white backed planthopper gene
Method is specifically:
(1), STS primer DNA polymorphism between parents CJ06 and TN1 and their filial generation is analyzed:
With STS labelling technique screen, first to genome be completed sequencing OryzasativaLcv.Nipponbare (http: //
Rgp.dna.affrc.go.jp) and the sequence of 93-11 (http://www.rise.genomics.org.cn) carries out sequence ratio
It is right, polymorphism of the suitable primer for ZF802 and ZCJ is designed according to the result of OryzasativaLcv.Nipponbare and 93-11 sequence alignment and is screened, is drawn
Object entrusts the synthesis of Shanghai Shen Neng betting office, and PCR amplification, PCR reaction system are as follows: 20ng/ul are carried out in PTC-225 PCR instrument
Oryza sativa genomic dna 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM dNTP 2.0ul, 10uM draw
Object 2.0ul, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH2O 11.8ul, total system 20ul.Response procedures: 95 DEG C are denaturalized 5 points
Clock；94 DEG C are denaturalized 1 minute, and 52 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72 DEG C 10 minutes；Product detection: In
4.0% agarose gel electrophoresis containing 0.5%ug/ul EB, observation and film recording result under ultraviolet lamp.
(2), the linkage analysis of molecular labeling
The identification of the whitebacked planthopper-resistance of ZF802 and near isogene based material ZCJ and its offspring carries out indoors, in Seedling Stage
Insect resistace identification is carried out to parents and offspring's segregating population with death of seedling rate；The total DNA of pest-resistant sense worm single plant is extracted respectively,
The polymorphism primer and program that are obtained with reaction system same as front, screening carry out the PCR amplification of single plant, and statistics is anti-, feels
The frequency of occurrences and switch type of single plant label band simultaneously calculate cross-over value, calculate label and pest-resistant base with MapnakerEXP3.0b
Genetic distance because between.
The present invention further simultaneously discloses the purposes of above-mentioned molecular labeling: for rice whitebacked planthopper-resistance kind identification and
The assisted selection of the pest-resistant offspring of rice.
In the present invention, the acquisition pattern of near isogene based material ZCJ are as follows:
ZF802 first and spring river 06 (CJ06) hybridization obtain F1 generation plant, then using ZF802 as recurrent parent, in conjunction with point
Son label WBC2-12 and WBC2-20 assisted Selection, selects the single plant of the banding pattern containing CJ06 to continue to return with ZF802 in backcross progeny
It hands over, is selfed again after backcrossing 5 times once, the homozygous single plant with CJ06 target fragment is named as ZCJ.
Present invention molecular biology method screen and find from anti-white backed planthopper rice variety ZF802 it is new and
And it is stabilized molecular labeling and its method with whitebacked planthopper-resistance gene close linkage, it is auxiliary for rice whitebacked planthopper-resistance
Help selection and use；Insect resistace is showed due to studying material Whitebacked Planthopper used, is had to the white backed planthopper of China's rice region
Universal resistance.In addition, also contributing to Rice Resistance white backed planthopper new gene clone according to gained molecular labeling.
White backed planthopper is the Major Pests of hazard rice production, and the present invention is that two are obtained using molecule labelling method newly
With the molecular labeling of whitebacked planthopper-resistance gene close linkage.With this method, it not only overcomes needed for conventional breeding methods
The disadvantages of long period, can targetedly select anti insect gene to obtain and purposefully carry out in laboratory multiple anti-
The polymerization of property gene, to cultivate the new rice variety with stable resistance.Meanwhile it is anti-that the two white backed planthoppers can also be used
Property gene molecule marker, deeply carries out the clone of anti-white backed planthopper gene and carries out structure and function analysis to it, this for into
The molecular genetics mechanism that one step understands Rice Resistance white backed planthopper has positive meaning.Therefore, result of the present invention is in rice breeding
It is all significant in practice and pest-resistant theoretical research.Its advantage is specifically summarized as follows:
1), the molecular labeling of the invention with whitebacked planthopper-resistance gene close linkage is the Xian in confrontation white backed planthopper
The new label obtained in the filial generation single plant of rice ZF802 and its resistance has very strong resistance to rice white backed planthopper,
And be stabilized, it can be used for the identification of rice whitebacked planthopper-resistance kind and the assisted selection of the pest-resistant offspring of rice.
2), the material not only water resistant rice white backed planthopper used in the present invention, also there is certain brown planthopper resistant ability, has general
Time pest-resistant characteristic.Therefore, it is expected to be cloned into new whitebacked planthopper-resistance gene according to resulting molecular labeling.
It 3) is, cloning rice whitebacked planthopper-resistance gene, gene sequencing and a turn anti-white backed planthopper trans-genetic hybrid rice are ground
Study carefully and has established good basis.
Detailed description of the invention
Specific embodiments of the present invention will be described in further detail with reference to the accompanying drawing.
Fig. 1 is the genetic distance schematic diagram between STS molecular labeling WBC2-12 and WBC2-20 and anti insect gene WBPH2；
Fig. 2 is the electrophoretic band figure of the molecular labeling of detection molecules label WBC2-12 and pest-resistant sex-kink；
Fig. 3 is the electrophoretic band figure of the molecular labeling of detection molecules label WBC2-20 and pest-resistant sex-kink；
Fig. 4 is the electrophoretic band figure of molecular labeling WBC2-12 identification rice varieties whitebacked planthopper-resistance；
Fig. 5 is the electrophoretic band figure for 3 parts of breeding for pest resistance materials that molecular labeling WBC2-12 assisting sifting obtains；
Fig. 6 is the electrophoretic band figure of molecular labeling WBC2-20 identification rice varieties whitebacked planthopper-resistance；
Fig. 7 is the electrophoretic band figure for 3 parts of breeding for pest resistance materials that molecular labeling WBC2-20 assisting sifting obtains；
Symbol in above-mentioned Fig. 1~7 is explained as follows respectively:
1 represents: the nearly gene based material ZCJ such as sense worm；
2 represent: pest-resistant parent ZF802；
3 represent: the F1 plant of ZF802/ZCJ；
4,5,6 represent: the pest-resistant single plant of ZF802 and ZCJ filial generation, this pest-resistant single plant is by after hybridization and certainly
It hands over, is obtained after molecular marker screening；
S is represented: without the sense worm single plant of the filial generation of anti-white backed planthopper gene；
P1~P5 respectively refers to insect-proof rice material: another name for Sichuan Province is extensive 527, raise spoke Xian 5, Hunan short morning No. 9, Zhejiang 733,29 are green；P6
~P10 respectively refers to sense worm rice material: no loadtransformer, E Wan 5, northern land 129, Suyunuo, eastern agriculture 416.
Specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in
This.
Embodiment 1 obtains the molecular labeling WBC2-12 mutually chain with Rice Resistance white backed planthopper gene with STS molecular labeling:
Specific practice is: rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, with
Sense worm kind near isogene based material ZCJ is hybridized, and selfing obtains F2 segregating population, and identification obtains 70 from group offspring
The recessive individual of strain (that is, the individual for showing as sense worm) is analyzed for linkage relationship.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
The DNA of 1 volume is successively added to extract solution (0.35M sorbitol in order；0.1M Tris,pH8.2；0.005M
EDTA；Remaining is water), karyorhexis liquid (the 0.2M Tris, pH7.5 of 1 volume；0.05M EDTA；2M NaCl；0.055M
CTAB；Remaining is water) and 0.4 volume 5% (mass concentration) sarkosyl solution (i.e. lauroyl-sarcosine sodium
Aqueous solution)；It is eventually adding sodium hydrogensulfite, is configured to DNA Extraction buffer；Sodium hydrogensulfite is in DNA Extraction buffer
Final concentration of 0.02M.
2), the rice leaf of recessive individual pest-resistant to above-mentioned ZF802, ZCJ and 70 plants is handled as follows respectively:
1., weigh the rice leaf liquid nitrogen grinding powdering of 0.1g, the above-mentioned steps 1 of 700 μ l are then added) prepare
DNA Extraction buffer, 65 DEG C water-bath 40 minutes.Again plus the chloroform of 700 μ l: isoamyl alcohol (volume ratio of 24:1), and mix.10,
000rpm is centrifuged 5 minutes, supernatant is transferred in new centrifuge tube.
2., after 1. above-mentioned steps are centrifuged in resulting supernatant plus 2/3~1 times of volume pre-cooling isopropanol, gently mix
It is even to DNA precipitate.13,000rpm centrifugations 8 minutes, pour out supernatant.
3., with the 200 μ l of alcohol of 70% (volumetric concentration) wash above-mentioned steps 2. resulting DNA sediment again.
4., by the DNA airing after above-mentioned washing and be dissolved in 100 μ l TE buffers or pure water.
5., the concentration of ultraviolet spectrophotometry detection above-mentioned steps 4. resulting DNA sample, 0.7% Ago-Gel
The integrality of electrophoresis detection DNA.
Complete suitable DNA is used for PCR amplification, and incomplete DNA is then extracted again, until obtaining complete DNA.
Two, STS is analyzed:
STS design of primers according to OryzasativaLcv.Nipponbare and the result of 93-11 sequence alignment design suitable primer for ZF802 and
The polymorphism of ZCJ is screened, and the STS primer 2 pair of Shanghai Shen Neng betting office compounding design is entrusted, specific as shown in table 1:
2 pairs of STS primer sequences that table 1. synthesizes
1, PCR amplification
(1), reaction system:
Oryza sativa genomic dna 20ng/ul 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM
DNTP 2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH2O 10.8ul, total system 20ul.
(2), response procedures:
95 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 1 minute, and 55 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72℃
Polishing 10 minutes.
2, electrophoresis detection
Amplified production 20ul is taken, with 4.0% Ago-Gel (containing 0.5%ug/ul EB) electrophoresis, is seen under ultraviolet lamp
Examine simultaneously film recording result.
We carry out polymorphism analysis using 2 couples of STS primer pair ZF802 and ZCJ, wherein there is 1 between of primer table parents
Reveal polymorphism.STS analysis further is carried out to primer pair ZF802, ZCJ and its filial generation single plant with this, finds STS primer
Banding pattern WBC2-12 the same with thoughts worm material ZCJ in the filial generation single plant of institute thoughts worm.Illustrate STS primer WBC2-
12 contact with the presence of Rice Resistance white backed planthopper characteristic.
WBC2-12 primer sequence are as follows: left wing 5 '-GCG AGG TCA CGA GGA CTA TC-3 ', 5 '-TCT CGG of right flank
AAG TCG AGG AAC TG-3 ', is positioned on the 2nd chromosome of rice.
And the performance results of primer WBC2-10 are as follows: do not have polymorphism between parents.
Primer WBC2-12PCR expands sequence of the resulting molecular labeling WBC2-12 in ZF802 are as follows: GCGAGGTCACG
AGGACTATCTTCTATGGTGTTACTCGTATCGGTATCAGAACTGTTGTTATGTGTTTTAATTTTTCATTGCTATGTG
CTCAGCAGTTCCTCGACTTCCGAGA；
Primer WBC2-12PCR expands sequence of the resulting molecular labeling WBC2-12 in ZCJ are as follows: GCGAGGTCACGAG
GACTATCTTCTATGGTGTTACTGGTATCGGTATCAGAACTACCGTCTATTGTGTTACTGGTATCGGTATCAGAACT
GTTGTTATGTGTTTAATTTTTCATTGCTATGTGCTCAGCAGTTCCTCGACTTCCGAGA。
Three, the linkage analysis of STS molecular labeling WBC2-12
The identification of the whitebacked planthopper-resistance of ZF802 and near isogene based material ZCJ and its offspring carries out indoors, in Seedling Stage
Insect resistace identification is carried out to parents and offspring's segregating population with death of seedling rate；The total DNA for extracting recessive sense worm single plant, with
The same reaction system in front and program, the PCR amplification of single plant is carried out with primer WBC2-12, and statistics is anti-, sense single plant label band
The frequency of occurrences and switch type simultaneously calculate cross-over value, calculate the heredity between label and anti insect gene with MapnakerEXP3.0b
Distance.PCR amplification is carried out to 70 single plants of filial generation group with WBC2-12.The results show that having 65 single plants in 70 single plants
Banding pattern has 5 plants of banding pattern simultaneous with the banding pattern of parents, does not find and pest-resistant parent as sense worm material (recessive parent) ZCJ
The same single plant of this ZF802 banding pattern.This results showed that STS molecular labeling WBC2-12 and rice whitebacked planthopper-resistance
Close linkage, but still have certain exchange in sense worm single plant, as shown in Fig. 2, the single plant for parents' banding pattern occur shows to occur
Exchange.It is computed, recombination fraction 3.6%, the genetic distance between STS molecular labeling and anti insect gene is 3.6cM.
Embodiment 2: the molecular labeling WBC2-20 mutually chain with Rice Resistance white backed planthopper gene is obtained with STS molecular labeling:
For vegetable material with embodiment 1, specific practice is as follows:
One, DNA is extracted:
With embodiment 1.
Two, STS is analyzed:
STS design of primers according to OryzasativaLcv.Nipponbare and the result of 93-11 sequence alignment design suitable primer for ZF802 and
The polymorphism of ZCJ is screened, and entrusts the STS primer 3 of Shanghai Shen Neng betting office compounding design right, specific as shown in table 2:
3 pairs of STS primer sequences that table 2. synthesizes
1, PCR amplification
(1), reaction system are as follows:
Oryza sativa genomic dna 20ng/ul 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM
DNTP 2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH2O 10.8ul, total system 20ul.
(2), response procedures:
95 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 1 minute, and 55 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72℃
Polishing 10 minutes.
2, electrophoresis detection
Amplified production 20ul is taken, with 4.0% Ago-Gel (containing 0.5%ug/ul EB) electrophoresis, is seen under ultraviolet lamp
Examine simultaneously film recording result.
We carry out polymorphism analysis using 3 couples of STS primer pair ZF802 and ZCJ, wherein there is 1 between of primer table parents
Reveal polymorphism.STS analysis further is carried out to primer pair ZF802, ZCJ and its filial generation single plant with this, finds STS primer
Banding pattern WBC2-20 the same with thoughts worm parent ZCJ in the filial generation single plant of institute thoughts worm.Illustrate STS primer WBC2-
20 contact with the presence of Rice Resistance white backed planthopper characteristic.
WBC2-20 primer sequence are as follows: 5 '-AAC AAT TTT TAT CTG CGT CAT ACA-3 ' of left wing, right flank 5 '-
TTC GTG ATT TCC TTC CTA ACC-3 ', is positioned on the 2nd chromosome of rice.
And the performance results of primer WBC2-19, WBC2-22 are as follows: do not have polymorphism between parents.
Sequence of the resulting molecular labeling WBC2-20 of primer WBC2-20 PCR amplification in ZF802 are as follows: AACAATTTTT
ATCTGCGTCATACATATAAGATTTATTATTTTTGTTTCTCTAGTTATAGATCAAATATAGGTCCCGTTTCCGTTTA
GTTCCTCAAAAGTTTTTCCCAAAAACATCACATTGAATCTTTGGACATATGCATGAAACGTTAAATATAGATTAAA
AGAAAAACTAATTACACGGTTAGGAAGGAAATCACGAA；
Sequence of the resulting molecular labeling WBC2-20 of primer WBC2-20 PCR amplification in ZCJ are as follows: AACAATTTTTAT
CTGCGTCATACATATAAGATTTATTATTTTTGTTTCTCTACATTGAATCTTTGGACACATGCATGAAGCGTTAAAT
ATAGATTAAAAGAAAAACTAATTGCACGGTTAGGAAGGAAATCACGAA。
Three, the linkage analysis of STS molecular labeling WBC2-20
The identification of the whitebacked planthopper-resistance of ZF802 and ZCJ parents and its offspring carries out indoors, in Seedling Stage with death of seedling
Rate carries out insect resistace identification to parents and offspring's segregating population；The total DNA for extracting recessive pest-resistant single plant, with same as front
Reaction system and program, carry out the PCR amplification of single plant with primer WBC2-20, statistics is anti-, the sense single plant label band frequency of occurrences and
Switch type simultaneously calculates cross-over value, calculates the genetic distance between label and anti insect gene with MapnakerEXP3.0b.With
WBC2-20 carries out PCR amplification to 70 single plants of filial generation group.The results show that having 67 single plants in 70 sense worm single plants
Banding pattern has the banding pattern of 3 single plants simultaneous with the banding pattern of parents, does not find and pest-resistant parent ZF802 as sense worm material ZCJ
The same single plant of banding pattern.This is the results showed that the whitebacked planthopper-resistance of STS molecular labeling WBC2-20 and rice closely connects
Lock, but still have certain exchange in pest-resistant single plant, if Fig. 3 shows, the single plant for parents' banding pattern occur shows to be exchanged.Through
It calculates, recombination fraction 2.1%, the genetic distance between STS molecular labeling and anti insect gene is 2.1cM.
Embodiment 3, the identification that rice whitebacked planthopper-resistance kind is carried out using WBC2-12
Specific practice is: the rice material of known whitebacked planthopper-resistance is chosen from China Paddy Rice Inst's germplasm resource bank
Each 5 parts, pest-resistant material are as follows: another name for Sichuan Province is extensive 527, raise spoke Xian 5, Hunan short morning No. 9, Zhejiang 733,29 are green；Feel worm material are as follows: no loadtransformer,
Hubei Province evening No. 5, northern land 129, Suyunuo, eastern agriculture 416, identify its whitebacked planthopper-resistance using STS primer WBC2-12.
One, DNA is extracted
With embodiment 1.
Two, STS is analyzed
With embodiment 1.
Three, the whitebacked planthopper-resistance of STS molecular labeling WBC2-12 and rice varieties
As a result as shown in figure 4, the banding pattern of 5 parts of pest-resistant materials compares (ZF802) equally with pest-resistant, and 5 parts are felt worm material
It is consistent that banding pattern then compares (ZCJ) with sense worm.This is the results showed that STS molecular labeling WBC2-12 can be used for the white back of rice
The resistance screening of plant hopper.
Embodiment 4, the assisted selection that the pest-resistant offspring of rice is carried out using WBC2-12:
Specific practice is: rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, with
Sense worm near isogene based material ZCJ is hybridized, and selfing obtains F2 segregating population, with molecular labeling WBC2-12 to segregating population
It is analyzed, banding pattern and the pest-resistant consistent single plant of parent ZF802 banding pattern in F2 segregating population is selected to be used for breeding improvement.
One, DNA is extracted
With embodiment 1.
Two, STS is analyzed
With embodiment 1.
Three, STS molecular labeling WBC2-12 carries out the assisted Selection of the pest-resistant offspring of rice
Anti insect gene donor rice variety ZF802 is hybridized with sense worm near isogenic lines ZCJ, and selfing obtains F2 and separates group
Body carries out genotyping to each single plant in F2 segregating population with STS molecular labeling WBC2-12, select banding pattern with it is pest-resistant
Consistent 3 single plants of parent's ZF802 banding pattern are further used for breeding improvement (Fig. 5), eliminate banding pattern and sense worm material ZCJ banding pattern one
It causes and the individual of heterozygosis banding pattern (while having ZF802 and ZCJ banding pattern), twig and shoot pest shows selected band ZF802 banding pattern
3 single plants show water resistant rice white backed planthopper.Should the results showed that SSR molecular marker WBC2-12 to can be used for rice white
The assisted selection of the pest-resistant offspring of backward flight lice.
Embodiment 5, the identification that rice whitebacked planthopper-resistance kind is carried out using WBC2-20:
Specific practice is: the rice material of known whitebacked planthopper-resistance is chosen from China Paddy Rice Inst's germplasm resource bank
Each 5 parts, pest-resistant material are as follows: another name for Sichuan Province is extensive 527, raise spoke Xian 5, Hunan short morning No. 9, Zhejiang 733,29 are green；Feel worm material are as follows: no loadtransformer,
Hubei Province evening No. 5, northern land 129, Suyunuo, eastern agriculture 416, identify its whitebacked planthopper-resistance using STS primer WBC2-20.
One, DNA is extracted
With embodiment 1.
Two, STS is analyzed
With embodiment 2.
Three, the whitebacked planthopper-resistance of STS molecular labeling WBC2-20 and rice varieties
As a result as shown in fig. 6, the banding pattern of 5 parts of pest-resistant materials compares (ZF802) equally with pest-resistant, and 5 parts are felt worm material
It is consistent that banding pattern then compares (ZCJ) with sense worm.This is the results showed that STS molecular labeling WBC2-20 can be used for the white back of rice
The resistance screening of plant hopper.
Embodiment 6, the assisted selection that the pest-resistant offspring of rice is carried out using WBC2-20:
Specific practice is: rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, with
Sense worm near isogene based material ZCJ is hybridized, and selfing obtains F2 segregating population, with molecular labeling WBC2-20 to segregating population
It is analyzed, banding pattern and the pest-resistant consistent single plant of parent ZF802 banding pattern in F2 segregating population is selected to be used for breeding improvement.
One, DNA is extracted
With embodiment 1.
Two, STS is analyzed
With embodiment 2.
Three, STS molecular labeling WBC2-20 carries out the assisted Selection of the pest-resistant offspring of rice
Anti insect gene donor rice variety ZF802 is hybridized with sense worm near isogenic lines ZCJ, and selfing obtains F2 and separates group
Body carries out genotyping to each single plant in F2 segregating population with STS molecular labeling WBC2-20, select banding pattern with it is pest-resistant
Consistent 3 single plants of parent's ZF802 banding pattern are further used for breeding improvement (Fig. 7), eliminate banding pattern and sense worm material ZCJ banding pattern one
It causes and the individual of heterozygosis banding pattern (while having ZF802 and ZCJ banding pattern), twig and shoot pest shows selected band ZF802 banding pattern
3 single plants show water resistant rice white backed planthopper.Should the results showed that SSR molecular marker WBC2-20 to can be used for rice white
The assisted selection of the pest-resistant offspring of backward flight lice.
The above list is only a few specific embodiments of the present invention for finally, it should also be noted that.Obviously, this hair
Bright to be not limited to above embodiments, acceptable there are many deformations.Those skilled in the art can be from present disclosure
All deformations for directly exporting or associating, are considered as protection scope of the present invention.
<110>China Paddy Rice Inst
<120>molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application
<160> 4
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>WBC2-12 forward primer
<400> 1
gcgaggtcac gaggactatc 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>WBC2-12 reverse primer
<400> 2
tctcggaagt cgaggaactg 20
<210> 3
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>WBC2-20 forward primer
<400> 3
aacaattttt atctgcgtca taca 24
<210> 4
<211> 21
<212> DNA
<213>artificial sequence
<220>
<223>WBC2-20 forward primer
<400> 4
ttcgtgattt ccttcctaac c 21
Claims (3)
1. the mutually chain molecular labeling with Rice Resistance white backed planthopper gene, using rice as species, it is characterized in that: the molecule mark
Remember that primer is selected from following primer pair, nucleotides sequence therein is classified as 5 ' → 3 ',
WBC2-12 is positive: GCGAGGTCACGAGGACTATC
It is reversed: TCTCGGAAGTCGAGGAACTG；
WBC2-20 is positive: AACAATTTTTATCTGCGTCATACA
It is reversed: TTCGTGATTTCCTTCCTAACC.
2. the molecular labeling mutually chain with Rice Resistance white backed planthopper gene according to claim 1, it is characterized in that: described
WBC2-12 is positioned on the 2nd chromosome of rice；The WBC2-20 is positioned on the 2nd chromosome of rice.
3. the purposes of molecular labeling as claimed in claim 1 or 2, it is characterized in that: for rice whitebacked planthopper-resistance kind
The assisted selection of identification and/or Rice Resistance white backed planthopper offspring；
The primer of the molecular labeling is selected from following primer pair, wherein
WBC2-12 left wing primer sequence: GCGAGGTCACGAGGACTATC
Right flank primer sequence: TCTCGGAAGTCGAGGAACTG；
WBC2-20 left wing primer sequence: AACAATTTTTATCTGCGTCATACA
Left wing's primer sequence: TTCGTGATTTCCTTCCTAACC；
When the primer carries out PCR amplification, reaction system are as follows: oryza sativa genomic dna 20ng/ul 1ul, 10 × PCR Buffer
2.0ul, 25mM MgCl22.0ul, 2mMdNTP 2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.2ul,
ddH2O 10.8ul, total system 20ul；
Response procedures are as follows: 95 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 1 minute, and 55 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, and 40 are followed
Ring；72 DEG C polishing 10 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710158024.3A CN106754910B (en) | 2017-03-16 | 2017-03-16 | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710158024.3A CN106754910B (en) | 2017-03-16 | 2017-03-16 | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754910A CN106754910A (en) | 2017-05-31 |
| CN106754910B true CN106754910B (en) | 2019-11-19 |
Family
ID=58966670
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710158024.3A Active CN106754910B (en) | 2017-03-16 | 2017-03-16 | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754910B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116004894A (en) * | 2022-11-25 | 2023-04-25 | 浙江师范大学 | Rice sogatella furcifera resistance major QTL linkage molecular marker and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101294161A (en) * | 2008-04-22 | 2008-10-29 | 中国水稻研究所 | Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN106480066A (en) * | 2016-10-31 | 2017-03-08 | 广西壮族自治区农业科学院水稻研究所 | A kind of new gene Wbph9 (t) of Rice Resistance white backed planthopper and its molecule labelling method and application |
-
2017
- 2017-03-16 CN CN201710158024.3A patent/CN106754910B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101294161A (en) * | 2008-04-22 | 2008-10-29 | 中国水稻研究所 | Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN106480066A (en) * | 2016-10-31 | 2017-03-08 | 广西壮族自治区农业科学院水稻研究所 | A kind of new gene Wbph9 (t) of Rice Resistance white backed planthopper and its molecule labelling method and application |
Non-Patent Citations (4)
| Title |
|---|
| Virulence of long-term laboratory populations of the brown planthopper,;Khin Khin Marlar MYINT等;《Appl. Entomol. Zool.》;20091231;第44卷(第1期);第149-153页 * |
| 分子标记辅助选择创制抗白背飞虱水稻恢复系;张建福等;《中国水稻科学》;20130510;第27卷(第3期);第329-334页 * |
| 水稻抗白背飞虱基因Wbph2的初步定位;刘志岩等;《中国水稻科学》;20021230;第16卷(第4期);第311-314页 * |
| 野生稻抗病虫基因的挖掘和利用;闫影等;《作物杂志》;20110815;第1-6页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754910A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jamaloddin et al. | Marker Assisted Gene Pyramiding (MAGP) for bacterial blight and blast resistance into mega rice variety “Tellahamsa” | |
| Das et al. | Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar | |
| Sundaram et al. | Marker assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety | |
| CN101294161B (en) | Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof | |
| CN106754954B (en) | A kind of corn MS8 gene mutation bodies and its method for identifying molecules and application | |
| CN102586240B (en) | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN106434944A (en) | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica | |
| CN108949925A (en) | A kind of molecular detecting method for quick and precisely identifying Weedy Rice and cultivated rice | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| CN101358232A (en) | Molecular marker linked with bruchid resistance gene in mung bean | |
| CN106754910B (en) | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application | |
| CN108239675B (en) | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof | |
| Babar et al. | Development of Basmati lines by the introgression of three bacterial blight resistant genes through marker-assisted breeding | |
| CN110358861A (en) | R13I14 is marked with rice wide spectrum high resistance to hoja blanca gene Xa45 (t) compact linkage molecule | |
| CN113652423B (en) | Method for auxiliary identification of drought resistance of wheat to be detected and special molecular marker thereof | |
| AU2020103450A4 (en) | Molecular marker of Sogatella furcifera, Horváth resistance gene WBPH2 and application thereof | |
| Omara et al. | Molecular and genetic analysis of leaf rust resistance genes in two new Egyptian wheat cultivars | |
| Kulaeva et al. | Fine mapping of a cdt locus mutation that leads to an increase in the tolerance of pea (Pisum sativum L.) to cadmium | |
| Chen et al. | Marker-assisted development and evaluation of monogenic lines of rice cv. Kaohsiung 145 carrying blast resistance genes | |
| Jamal et al. | Marker-Analysis of Leaf Resistance Bacterial in Rice | |
| CN110358862A (en) | With the molecular labeling Hxjy-14 of rice wide spectrum high resistance to hoja blanca gene Xa45 (t) close linkage | |
| CN111304359B (en) | Molecular marker closely linked with salt tolerance of rice seed germination and application thereof | |
| CN105385772B (en) | Primer for screening wheat leaf rust resistance QTL and its application | |
| Olawuyi et al. | Genetic Assessment of Amaranthus Linn. Genotypes in Treatment Combinations of Glomus clarum and Leucaena leucocephala Lam. Using Simple Sequence Repeat (SSR) Marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |