CN106754910A - The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application - Google Patents
The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application Download PDFInfo
- Publication number
- CN106754910A CN106754910A CN201710158024.3A CN201710158024A CN106754910A CN 106754910 A CN106754910 A CN 106754910A CN 201710158024 A CN201710158024 A CN 201710158024A CN 106754910 A CN106754910 A CN 106754910A
- Authority
- CN
- China
- Prior art keywords
- wbc2
- rice
- paddy rice
- gene
- molecular labeling
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of molecular labeling mutually chain with Rice Resistance white backed planthopper gene, using paddy rice as species, the molecular labeling primer is selected from primer pair WBC2 12, WBC2 20.WBC2 12 is positioned on the chromosome of paddy rice the 2nd；WBC2 20 is positioned on the chromosome of paddy rice the 2nd.The present invention can be used for the identification of paddy rice whitebacked planthopper-resistance kind and/or the assisted selection of the pest-resistant offspring of paddy rice.
Description
Technical field
The invention belongs to agricultural biotechnology engineering, molecule more particularly to mutually chain with paddy rice whitebacked planthopper-resistance gene
Mark and its preparation method.
Background technology
Paddy rice white backed planthopper (Sogatella furcifera, Horv á th) is the main of China and Southeast Asia paddy rice producing region
One of insect, since the eighties, with China's High-Yielding Hybrid Rice technology popularization and may be relevant with hybrid vigour crop give birth to
Reason factor, white backed planthopper has turned into Insect Pests in Rice.Recorded according to Chinese agriculture yearbook, time, aggrieved face are retransmitted in planthopper
50% of product more than China's paddy rice gross area.1991, the planthopper on a large scale that China occurs was caused harm and causes nearly 1,600,000,000 kilograms of rice
The loss of paddy, injured area up to 2,9,330,000 hm2；Planthoppers in 2005 great outbursts again, is superimposed effect with rice leaf roller in addition
Should, planthopper is caused harm up to more than 2.6 hundred million mu times.Therefore, the preventing and treating of Whitebacked Planthopper has turned into the important interior of Guarantee Grain Production
Hold.
The main rice varieties of establishing in large scale are low without resistant gene or resistance level, are the inherences of white backed planthopper outburst
Reason, adds a large amount of administrations of chemical fertilizer, and the sense worm paddy rice flourished provides abundance for the quick breeding of white backed planthopper
Food source.For a long time, the preventing and treating of white backed planthopper is mainly by applying chemical insecticide.However, the abuse of agricultural chemical insecticide,
The rice planthopper natural enemy in rice field is killed, the rampant again of white backed planthopper is induced on the contrary.In addition, Sogatella migrating property on a large scale
Insect, annual paddy growth season, white backed planthopper with spring and summer warm moist air, from south toward north by for China's rice region of moving into district by district.
White backed planthopper early period of origination, the polypide of nymph is small, disguised strong, is difficult to be found by peasant, and preventing and treating enables it a large amount of not in time
Breeding, insect pest is just able to prevalence；The paddy rice maturation pustulation period of insect pest outburst, rice strain growing way is vigorous, and insecticide is applied into rice strain base
The operation in portion is extremely difficult, and adding adult has good mobility and the stronger resistance to the action of a drug, as a result causes harm repeatedly and the underproduction.
Rice Resistance disease pest breeding practice proves, using anti-white backed planthopper gene or cultivates polymerization separate sources resistant gene
New varieties are methods the most cost-effective in paddy rice white backed planthopper integrated control.Even if the rice varieties of plantation are only with medium
The resistant gene of level, is also enough to the collective control of white backed planthopper is below horizontal what is caused harm, will not cause white backward flight
Lice great outburst or actual harm and production loss.
On the other hand, with the development of molecular biology, make to be difficult to identify, Resistant proterties easily affected by environment is used
Marker assisted selection has been possibly realized, and the technology not only can carry out the selection of accurate stabilization in early generation, and separation can be overcome single
The aobvious recessive and pure heterozygosis problem of strain, so as to accelerate breeding process, improves breeding efficiency, but the basis of the technology is to possess
Excellent target gene and the therewith molecular labeling of close linkage.
To realize above-mentioned task, new resistant gene is excavated, the new mark for developing close linkage turns into the white backward flight of Rice Resistance
The key of lice molecular breeding.That carry out molecule Position Research to paddy rice whitebacked planthopper-resistance earliest is McCouch, is applied first
TN1 (in platform local No. 1)/IR36 NILs navigate to Wbph1 between two RFLP marks RG146 and RG445, but by
It is that multicopy is marked in RFLP marks, and is difficult to be used as selected marker；Hereafter, Wbph2 and Wbph6 (t) are also successively positioned,
But their genetic distance is respectively 25.6cM and 21.2cM, practical application still has very big difficulty.
2008100613306 invention《The molecular labeling mutually chain with Rice Resistance white backed planthopper gene and its development approach》
Disclose molecular labeling RM6917, AP4741 mutually chain with Rice Resistance white backed planthopper gene；RM6917 is positioned at the dye of paddy rice the 6th
On colour solid, the genetic distance between its SSR molecular marker and anti insect gene is 2.6cM.AP4741 is also positioned at the chromosome of paddy rice the 6th
On, the genetic distance between its STS molecular labeling and anti insect gene is 3.3cM.
2012100453977 invention《The molecular labeling mutually chain with Rice Resistance white backed planthopper gene and its application》It is open
A kind of molecular labeling primer RM401, Wbsca1 mutually chain with Rice Resistance white backed planthopper gene；RM401 is positioned at paddy rice the 4th
On chromosome, the genetic distance between its SSR molecular marker and anti insect gene is 5.3cM；Wbsca1 is also positioned at the dyeing of paddy rice the 4th
On body, the genetic distance between its STS molecular labeling and anti insect gene is 1.2cM.
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of molecular labeling mutually chain with Rice Resistance white backed planthopper gene
And application thereof, molecular labeling and whitebacked planthopper-resistance gene close linkage obtained by the present invention can be used for paddy rice white backed planthopper and resist
Property assisted selection.
In order to solve the above-mentioned technical problem, the present invention provides a kind of molecule mark mutually chain with Rice Resistance white backed planthopper gene
Note, using paddy rice as species, the molecular labeling primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
WBC2-12 is positive：GCGAGGTCACGAGGACTATC
Reversely：TCTCGGAAGTCGAGGAACTG；
WBC2-20 is positive：AACAATTTTTATCTGCGTCATACA
Reversely：TTCGTGATTTCCTTCCTAACC.
As the improvement of molecular labeling of the invention：WBC2-12 is positioned on the chromosome of paddy rice the 2nd；WBC2-20 is also positioned
In on the chromosome of paddy rice the 2nd (Fig. 1).
Present invention also offers the development approach of above-mentioned molecular labeling, comprise the following steps：
1), carried out with the near isogene based material ZCJ of sense worm as resistant gene donor parents using rice variety ZF802 miscellaneous
Hand over, so as to obtain the individual plant as filial generation twig and shoot pest；
2), with CTAB (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonium Bromide)
Method extracts parental rice seedling and filial generation seedling genomic DNA；
3), using SSR (simple repeated sequence, simple sequence repeat) and/or STS (sequence tagged sites
Sequence-tagged site) molecule labelling method carries out the screening of paddy rice whitebacked planthopper-resistance molecular labeling；
4) two STS molecular labelings WBC2-12 and WBC2-20, are filtered out.
The molecular labeling WBC2-12 and WBC2-20 mutually chain with Rice Resistance white backed planthopper gene, specifically uses following methods
Obtain：
1), rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, it is near with sense worm
Isogenic line material ZCJ is hybridized, and anti-, sense worm individual plant is the bases such as the anti-of acquisition, sense worm are near by hybridization, backcrossing and selfing
Because being for combo and the assignment of genes gene mapping.
2) parental rice seedling and filial generation seedling genomic DNA, are extracted with CTAB methods.
3) screening of paddy rice whitebacked planthopper-resistance molecular labeling, is carried out using SSR and STS molecule labelling methods；
4) two STS molecular labeling WBC2-12 and WBC2-20, are filtered out, through linkage analysis, find the two mark with
Rice Resistance white backed planthopper gene is mutually chain.
The side of the screening molecular labeling mutually chain with Rice Resistance white backed planthopper gene is carried out using SSR and STS molecular labelings
Method is specifically：
(1), STS primers DNA polymorphism analysis between parents CJ06 and TN1 and their filial generation：
Screened with STS labelling techniques, completed the Nipponbare (http of sequencing to genome first://
) and 93-11 (http rgp.dna.affrc.go.jp://www.rise.genomics.org.cn) sequence carry out sequence ratio
Right, the result according to Nipponbare and 93-11 sequence alignments designs suitable primer is used for the polymorphism screening of ZF802 and ZCJ, draws
The synthesis of thing commission Shanghai Shen Neng betting offices, in the enterprising performing PCR amplification of PTC-225 PCR instruments, PCR reaction systems are：20ng/ul
Oryza sativa genomic dna 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM dNTP 2.0ul, 10uM draw
Thing 2.0ul, 5U/ul Taq archaeal dna polymerases 0.2ul, ddH2O 11.8ul, total system 20ul.Response procedures：95 DEG C are denatured 5 points
Clock；94 DEG C are denatured 1 minute, and 52 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72 DEG C 10 minutes；Product detection：
Containing 0.5%ug/ul EB 4.0% agarose gel electrophoresis, observation and film recording result under uviol lamp.
(2), the linkage analysis of molecular labeling
The whitebacked planthopper-resistance identification of ZF802 and near isogene based material ZCJ and its offspring is carried out indoors, in Seedling Stage
Insect resistace identification is carried out to parents and offspring's segregating population with death of seedling rate；The STb gene of pest-resistant sense worm individual plant is extracted respectively,
The PCR for carrying out individual plant with the polymorphism primer and program that are obtained with above same reaction system, screening is expanded, and statistics is anti-, sense
The frequency of occurrences and switch type of individual plant mark band simultaneously calculate cross-over value, and mark and pest-resistant base are calculated with MapnakerEXP3.0b
Therefore the genetic distance between.
The present invention further simultaneously discloses the purposes of above-mentioned molecular labeling：For paddy rice whitebacked planthopper-resistance kind identification and
The assisted selection of the pest-resistant offspring of paddy rice.
In the present invention, the acquisition pattern of near isogene based material ZCJ is：
ZF802 first and spring river 06 (CJ06) hybridization obtain F1 generation plant, then with ZF802 as recurrent parent, with reference to point
Son mark WBC2-12 and WBC2-20 assisted Selections, individual plant of the selection containing CJ06 banding patterns continues to be returned with ZF802 in backcross progeny
Hand over, the individual plant of the band CJ06 target fragments of homozygosis once, is named as ZCJ by selfing again after being returned 5 times.
The present invention be screened from anti-white backed planthopper rice variety ZF802 and found with molecular biology method it is new and
And the molecular labeling and its method of stable existence and whitebacked planthopper-resistance gene close linkage, it is auxiliary for paddy rice whitebacked planthopper-resistance
Help selection and use；Because the material Whitebacked Planthopper of research institute shows insect resistace, its white backed planthopper to China's rice region has
Universal resistance.In addition, also contributing to Rice Resistance white backed planthopper new gene DCRP according to gained molecular labeling.
White backed planthopper be hazard rice production Major Pests, the present invention be using molecule labelling method obtain two it is new
With the molecular labeling of whitebacked planthopper-resistance gene close linkage.Profit in this way, needed for not only overcoming conventional breeding methods
The shortcomings of time cycle is long, targetedly can select in laboratory anti insect gene to obtain and purposefully carry out multiple resisting
The polymerization of property gene, so as to cultivate the new rice variety with stable resistance.Meanwhile, the two white backed planthoppers can also be used and resists
Property gene molecule marker, the clone for deeply carrying out anti-white backed planthopper gene simultaneously carries out 26S Proteasome Structure and Function analysis to it, and this is for entering
The molecular genetics mechanism that one step understands Rice Resistance white backed planthopper has positive meaning.Therefore, result of the present invention is in rice breeding
It is all significant in practice and pest-resistant theoretical research.Its advantage is specifically summarized as follows：
1), the molecular labeling with whitebacked planthopper-resistance gene close linkage of the invention, is the Xian in confrontation white backed planthopper
The new mark obtained in the filial generation individual plant of rice ZF802 and its resistance, has very strong resistance to paddy rice white backed planthopper,
And stable existence, can be used for the identification of paddy rice whitebacked planthopper-resistance kind and the assisted selection of the pest-resistant offspring of paddy rice.
2), the material not only water resistant rice white backed planthopper used by the present invention, also has certain brown planthopper resistant ability, with general
Time pest-resistant characteristic.Therefore, the molecular labeling according to gained is expected to be cloned into new whitebacked planthopper-resistance gene.
3) be, cloning rice whitebacked planthopper-resistance gene, gene sequencing and turn an anti-white backed planthopper trans-genetic hybrid rice grind
Study carefully and established good basis.
Brief description of the drawings
Specific embodiment of the invention is described in further detail below in conjunction with the accompanying drawings.
Fig. 1 is the genetic distance schematic diagram between STS molecular labeling WBC2-12 and WBC2-20 and anti insect gene WBPH2；
Fig. 2 is the electrophoretic band figure of detection molecules mark WBC2-12 and the molecular labeling of pest-resistant sex-kink；
Fig. 3 is the electrophoretic band figure of detection molecules mark WBC2-20 and the molecular labeling of pest-resistant sex-kink；
Fig. 4 is the electrophoretic band figure that molecular labeling WBC2-12 identifies rice varieties whitebacked planthopper-resistance；
Fig. 5 is the electrophoretic band figure of 3 parts of breeding for pest resistance materials that molecular labeling WBC2-12 assisting siftings are obtained；
Fig. 6 is the electrophoretic band figure that molecular labeling WBC2-20 identifies rice varieties whitebacked planthopper-resistance；
Fig. 7 is the electrophoretic band figure of 3 parts of breeding for pest resistance materials that molecular labeling WBC2-20 assisting siftings are obtained；
Symbol in above-mentioned Fig. 1~7 is explained as follows respectively：
1 represents：The nearly gene based material ZCJ such as sense worm；
2 represent：Pest-resistant parent ZF802；
3 represent：The F1 plant of ZF802/ZCJ；
4,5,6 represent：The pest-resistant individual plant of ZF802 and ZCJ filial generations, this pest-resistant individual plant is by after hybridization and certainly
Hand over, obtained after molecular marker screening；
S is represented：Without the sense worm individual plant of the filial generation of anti-white backed planthopper gene；
P1~P5 refers to insect-proof rice material respectively：Another name for Sichuan Province extensive 527, to raise spoke Xian 5, Hunan short morning No. 9, Zhejiang 733,29 blue or green；P6
~P10 refers to sense worm rice material respectively：No loadtransformer, Hubei Province evening No. 5, northern land 129, Suyunuo, eastern agriculture 416.
Specific embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This.
Embodiment 1, obtain the molecular labeling WBC2-12 mutually chain with Rice Resistance white backed planthopper gene with STS molecular labelings：
Specific practice is：Rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, with
Sense worm kind near isogene based material ZCJ is hybridized, and selfing obtains F2 segregating populations, and identification obtains 70 from colony offspring
Strain recessive individual (that is, showing as feeling the individuality of worm) is for linkage relationship analysis.
First, DNA is extracted
1) DNA Extraction buffers, are prepared：
The DNA of 1 volume is added to extract solution (0.35M sorbitol successively in order；0.1M Tris,pH8.2；0.005M
EDTA；Remaining is water), karyorhexis liquid (the 0.2M Tris, pH7.5 of 1 volume；0.05M EDTA；2M NaCl；0.055M
CTAB；Remaining is water) and 0.4 volume 5% (mass concentration) sarkosyl solution (i.e. lauroyl-sarcosine sodium
The aqueous solution)；Sodium hydrogensulfite is eventually adding, DNA Extraction buffers are configured to；Sodium hydrogensulfite is in DNA Extraction buffers
Final concentration of 0.02M.
2), recessive individual rice leaf pest-resistant to above-mentioned ZF802, ZCJ and 70 plants is handled as follows respectively：
1. the rice leaf liquid nitrogen grinding powdering of 0.1g, is weighed, the above-mentioned steps 1 of 700 μ l are subsequently adding) prepare
DNA Extraction buffers, 65 DEG C of water-baths 40 minutes.Again plus 700 μ l chloroform:Isoamyl alcohol (24:1 volume ratio), and mix.10,
000rpm is centrifuged 5 minutes, and supernatant is transferred in new centrifuge tube.
2., Jia 2/3 in the supernatant of gained after 1. above-mentioned steps are centrifuged~isopropanol of 1 times of volume precooling, gently mix
It is even to DNA precipitation.13,000rpm centrifugations 8 minutes, pour out supernatant.
3. the DNA sediments of above-mentioned steps 2. gained, are washed with the μ l of alcohol 200 of 70% (volumetric concentration) again.
4., by the DNA airings after above-mentioned washing and it is dissolved in 100 μ l TE buffer solutions or pure water.
5., ultraviolet spectrophotometry detection above-mentioned steps 4. gained DNA sample concentration, 0.7% Ago-Gel
The integrality of electrophoresis detection DNA.
Complete suitable DNA is expanded for PCR, and incomplete DNA is then extracted again, until obtaining complete DNA.
2nd, STS analyses：
STS design of primers according to the result of Nipponbare and 93-11 sequence alignments design suitable primer be used for ZF802 and
The polymorphism screening of ZCJ, the STS primer 2s pair of commission Shanghai Shen Neng betting offices compounding design are specific as shown in table 1：
2 pairs of STS primer sequences of the synthesis of table 1.
1st, PCR amplifications
(1), reaction system：
Oryza sativa genomic dna 20ng/ul 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM
DNTP 2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerases 0.2ul, ddH2O 10.8ul, total system 20ul.
(2), response procedures：
95 DEG C are denatured 5 minutes；94 DEG C are denatured 1 minute, and 55 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72℃
Polishing 10 minutes.
2nd, electrophoresis detection
Amplified production 20ul is taken, with 4.0% Ago-Gel (containing 0.5%ug/ul EB) electrophoresis, is seen under uviol lamp
Examine and film recording result.
We carry out polymorphism analysis using 2 couples of STS primer pairs ZF802 and ZCJ, wherein there is 1 primer table between parents
Reveal polymorphism.STS analyses are further carried out to primer pair ZF802, ZCJ and its filial generation individual plant with this, STS primers are found
WBC2-12 is in the filial generation individual plant of institute thoughts worm with the banding pattern that thoughts worm material ZCJ is the same.Illustrate STS primers WBC2-
12 contact with the presence of Rice Resistance white backed planthopper characteristic.
WBC2-12 primer sequences are：Left wing 5 '-GCG AGG TCA CGA GGA CTA TC-3 ' ,-TCT CGG of right flank 5 '
AAG TCG AGG AAC TG-3 ', are positioned on the chromosome of paddy rice the 2nd.
And the performance results of primer WBC2-10 are：Do not have polymorphism between parents.
Sequences of the molecular labeling WBC2-12 in ZF802 obtained by primer WBC2-12PCR amplifications be：
GCGAGGTCACGAGGACTATCTTCTATGGTGTTACTCGTATCGGTATCAGAACTGTTGTTATGTGTTTTAATTTTTCA
TTGCTATGTGCTCAGCAGTTCCTCGACTTCCGAGA；
Sequences of the molecular labeling WBC2-12 in ZCJ obtained by primer WBC2-12PCR amplifications be：
GCGAGGTCACGAGGACTATCTTCTATGGTGTTACTGGTATCGGTATCAGAACTACCGTCTATTGTGTTACTGGTATC
GGTATCAGAACTGTTGTTATGTGTTTAATTTTTCATTGCTATGTGCTCAGCAGTTCCTCGACTTCCGAGA。
3rd, the linkage analysis of STS molecular labelings WBC2-12
The whitebacked planthopper-resistance identification of ZF802 and near isogene based material ZCJ and its offspring is carried out indoors, in Seedling Stage
Insect resistace identification is carried out to parents and offspring's segregating population with death of seedling rate；Extract the STb gene of recessive sense worm individual plant, with
Above same reaction system and program, the PCR amplifications of individual plant are carried out with primer WBC2-12, and statistics is anti-, sense individual plant marks band
The frequency of occurrences and switch type simultaneously calculate cross-over value, and the heredity between mark and anti insect gene is calculated with MapnakerEXP3.0b
Distance.70 individual plants of filial generation colony are entered with performing PCR with WBC2-12 to expand.Result shows there are 65 individual plants in 70 individual plants
Banding pattern has 5 plants of banding pattern simultaneous with the banding pattern of parents as sense worm material (recessive parent) ZCJ, does not find and pest-resistant parent
The same individual plant of this ZF802 banding patterns.This test result indicate that：STS molecular labelings WBC2-12 and the whitebacked planthopper-resistance of paddy rice
Close linkage, but still have certain exchange in worm individual plant is felt, as shown in Fig. 2 the individual plant for parents' banding pattern occur shows occur
Exchange.It is computed, its recombination fraction is 3.6cM for the genetic distance between 3.6%, STS molecular labelings and anti insect gene.
Embodiment 2：The molecular labeling WBC2-20 mutually chain with Rice Resistance white backed planthopper gene is obtained with STS molecular labelings：
Vegetable material is with embodiment 1, and specific practice is as follows：
First, DNA is extracted：
With embodiment 1.
2nd, STS analyses：
STS design of primers according to the result of Nipponbare and 93-11 sequence alignments design suitable primer be used for ZF802 and
The polymorphism screening of ZCJ, the STS primers 3 pairs of commission Shanghai Shen Neng betting offices compounding design are specific as shown in table 2：
3 pairs of STS primer sequences of the synthesis of table 2.
1st, PCR amplifications
(1), reaction system is：
Oryza sativa genomic dna 20ng/ul 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM
DNTP 2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerases 0.2ul, ddH2O 10.8ul, total system 20ul.
(2), response procedures：
95 DEG C are denatured 5 minutes；94 DEG C are denatured 1 minute, and 55 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72℃
Polishing 10 minutes.
2nd, electrophoresis detection
Amplified production 20ul is taken, with 4.0% Ago-Gel (containing 0.5%ug/ul EB) electrophoresis, is seen under uviol lamp
Examine and film recording result.
We carry out polymorphism analysis using 3 couples of STS primer pairs ZF802 and ZCJ, wherein there is 1 primer table between parents
Reveal polymorphism.STS analyses are further carried out to primer pair ZF802, ZCJ and its filial generation individual plant with this, STS primers are found
WBC2-20 is in the filial generation individual plant of institute thoughts worm with the banding pattern that thoughts worm parent ZCJ is the same.Illustrate STS primers WBC2-
20 contact with the presence of Rice Resistance white backed planthopper characteristic.
WBC2-20 primer sequences are：- AAC AAT TTT TAT CTG CGT CAT the ACA-3 ' of left wing 5 ', right flank 5 '-
TTC GTG ATT TCC TTC CTA ACC-3 ', are positioned on the chromosome of paddy rice the 2nd.
And the performance results of primer WBC2-19, WBC2-22 are：Do not have polymorphism between parents.
Sequences of the molecular labeling WBC2-20 in ZF802 obtained by primer WBC2-20 PCR amplifications be：
AACAATTTTTATCTGCGTCATACATATAAGATTTATTATTTTTGTTTCTCTAGTTATAGATCAAATATAGGTCCCGT
TTCCGTTTAGTTCCTCAAAAGTTTTTCCCAAAAACATCACATTGAATCTTTGGACATATGCATGAAACGTTAAATAT
AGATTAAAAGAAAAACTAATTACACGGTTAGGAAGGAAATCACGAA；
Sequences of the molecular labeling WBC2-20 in ZCJ obtained by primer WBC2-20 PCR amplifications be：
AACAATTTTTATCTGCGTCATACATATAAGATTTATTATTTTTGTTTCTCTACATTGAATCTTTGGACACATGCATG
AAGCGTTAAATATAGATTAAAAGAAAAACTAATTGCACGGTTAGGAAGGAAATCACGAA。
3rd, the linkage analysis of STS molecular labelings WBC2-20
The whitebacked planthopper-resistance identification of ZF802 and ZCJ parents and its offspring is carried out indoors, in Seedling Stage with death of seedling
Rate carries out insect resistace identification to parents and offspring's segregating population；Extract the STb gene of recessive pest-resistant individual plant, with it is above same
Reaction system and program, the PCR amplifications of individual plant are carried out with primer WBC2-20, statistics is anti-, the frequency of occurrences of sense individual plant mark band and
Switch type simultaneously calculates cross-over value, and the genetic distance between mark and anti insect gene is calculated with MapnakerEXP3.0b.With
WBC2-20 enters performing PCR amplification to 70 individual plants of filial generation colony.Result shows, there is 67 individual plants in 70 sense worm individual plants
Banding pattern has banding pattern of 3 banding patterns of individual plant simultaneous with parents as sense worm material ZCJ, does not find and pest-resistant parent ZF802
The same individual plant of banding pattern.This test result indicate that：STS molecular labelings WBC2-20 closely connects with the whitebacked planthopper-resistance of paddy rice
Lock, but still have certain exchange in pest-resistant individual plant, such as Fig. 3 shows, the individual plant for parents' banding pattern occur shows to there occurs exchange.Through
Calculate, its recombination fraction is 2.1cM for the genetic distance between 2.1%, STS molecular labelings and anti insect gene.
Embodiment 3, the identification that paddy rice whitebacked planthopper-resistance kind is carried out using WBC2-12
Specific practice is：The rice material of known whitebacked planthopper-resistance is chosen from China Paddy Rice Inst's germplasm resource bank
Each 5 parts, pest-resistant material is：Another name for Sichuan Province extensive 527, to raise spoke Xian 5, Hunan short morning No. 9, Zhejiang 733,29 blue or green；Feeling worm material is：No loadtransformer,
Hubei Province evening No. 5, northern land 129, Suyunuo, eastern agriculture 416, its whitebacked planthopper-resistance is identified using STS primers WBC2-12.
First, DNA is extracted
With embodiment 1.
2nd, STS analyses
With embodiment 1.
3rd, the whitebacked planthopper-resistance of STS molecular labelings WBC2-12 and rice varieties
Result is as shown in figure 4,5 parts of banding patterns of pest-resistant material compare (ZF802) equally with pest-resistant, and 5 parts are felt worm material
Banding pattern is then consistent with sense worm control (ZCJ).This test result indicate that：STS molecular labelings WBC2-12 can be used for paddy rice and carry on the back in vain
The resistance screening of plant hopper.
Embodiment 4, the assisted selection that the pest-resistant offspring of paddy rice is carried out using WBC2-12：
Specific practice is：Rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, with
Sense worm near isogene based material ZCJ is hybridized, and selfing obtains F2 segregating populations, with molecular labeling WBC2-12 to segregating population
It is analyzed, the banding pattern individual plant consistent with pest-resistant parent ZF802 banding patterns is used for breeding improvement in selection F2 segregating populations.
First, DNA is extracted
With embodiment 1.
2nd, STS analyses
With embodiment 1.
3rd, STS molecular labelings WBC2-12 carries out the assisted Selection of the pest-resistant offspring of paddy rice
Anti insect gene donor rice variety ZF802 is hybridized with sense worm NIL ZCJ, and selfing obtains F2 and separates group
Body, carries out genotyping with STS molecular labelings WBC2-12 to each individual plant in F2 segregating populations, selection banding pattern with it is pest-resistant
3 consistent individual plants of parent's ZF802 banding patterns are further used for breeding improvement (Fig. 5), eliminate banding pattern with sense worm material ZCJ banding patterns one
The individuality of heterozygosis of making peace banding pattern (while having ZF802 and ZCJ banding patterns), twig and shoot pest shows, selected with ZF802 banding patterns
3 individual plants show water resistant rice white backed planthopper.Should test result indicate that：It is white that SSR molecular marker WBC2-12 can be used for paddy rice
The assisted selection of the pest-resistant offspring of backward flight lice.
Embodiment 5, the identification that paddy rice whitebacked planthopper-resistance kind is carried out using WBC2-20：
Specific practice is：The rice material of known whitebacked planthopper-resistance is chosen from China Paddy Rice Inst's germplasm resource bank
Each 5 parts, pest-resistant material is：Another name for Sichuan Province extensive 527, to raise spoke Xian 5, Hunan short morning No. 9, Zhejiang 733,29 blue or green；Feeling worm material is：No loadtransformer,
Hubei Province evening No. 5, northern land 129, Suyunuo, eastern agriculture 416, its whitebacked planthopper-resistance is identified using STS primers WBC2-20.
First, DNA is extracted
With embodiment 1.
2nd, STS analyses
With embodiment 2.
3rd, the whitebacked planthopper-resistance of STS molecular labelings WBC2-20 and rice varieties
Result is as shown in fig. 6,5 parts of banding patterns of pest-resistant material compare (ZF802) equally with pest-resistant, and 5 parts are felt worm material
Banding pattern is then consistent with sense worm control (ZCJ).This test result indicate that：STS molecular labelings WBC2-20 can be used for paddy rice and carry on the back in vain
The resistance screening of plant hopper.
Embodiment 6, the assisted selection that the pest-resistant offspring of paddy rice is carried out using WBC2-20：
Specific practice is：Rice variety ZF802 of the anti insect gene donor parents from China Paddy Rice Inst's Germplasm Bank, with
Sense worm near isogene based material ZCJ is hybridized, and selfing obtains F2 segregating populations, with molecular labeling WBC2-20 to segregating population
It is analyzed, the banding pattern individual plant consistent with pest-resistant parent ZF802 banding patterns is used for breeding improvement in selection F2 segregating populations.
First, DNA is extracted
With embodiment 1.
2nd, STS analyses
With embodiment 2.
3rd, STS molecular labelings WBC2-20 carries out the assisted Selection of the pest-resistant offspring of paddy rice
Anti insect gene donor rice variety ZF802 is hybridized with sense worm NIL ZCJ, and selfing obtains F2 and separates group
Body, carries out genotyping with STS molecular labelings WBC2-20 to each individual plant in F2 segregating populations, selection banding pattern with it is pest-resistant
3 consistent individual plants of parent's ZF802 banding patterns are further used for breeding improvement (Fig. 7), eliminate banding pattern with sense worm material ZCJ banding patterns one
The individuality of heterozygosis of making peace banding pattern (while having ZF802 and ZCJ banding patterns), twig and shoot pest shows, selected with ZF802 banding patterns
3 individual plants show water resistant rice white backed planthopper.Should test result indicate that：It is white that SSR molecular marker WBC2-20 can be used for paddy rice
The assisted selection of the pest-resistant offspring of backward flight lice.
Finally, in addition it is also necessary to it is noted that listed above is only several specific embodiments of the invention.Obviously, this hair
It is bright to be not limited to above example, there can also be many deformations.One of ordinary skill in the art can be from present disclosure
The all deformations directly derived or associate, are considered as protection scope of the present invention.
<110>China Paddy Rice Inst
<120>The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application
<160> 4
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>WBC2-12 forward primers
<400> 1
gcgaggtcac gaggactatc 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>WBC2-12 reverse primers
<400> 2
tctcggaagt cgaggaactg 20
<210> 3
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>WBC2-20 forward primers
<400> 3
aacaattttt atctgcgtca taca 24
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>WBC2-20 forward primers
<400> 4
ttcgtgattt ccttcctaac c 21
Claims (3)
1. the molecular labeling mutually chain with Rice Resistance white backed planthopper gene, using paddy rice as species, it is characterized in that：The molecule mark
Note primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
WBC2-12 is positive：GCGAGGTCACGAGGACTATC
Reversely：TCTCGGAAGTCGAGGAACTG；
WBC2-20 is positive：AACAATTTTTATCTGCGTCATACA
Reversely：TTCGTGATTTCCTTCCTAACC.
2. the molecular labeling mutually chain with Rice Resistance white backed planthopper gene according to claim 1, it is characterized in that：It is described
WBC2-12 is positioned on the chromosome of paddy rice the 2nd；The WBC2-20 is positioned on the chromosome of paddy rice the 2nd.
3. the purposes of molecular labeling as claimed in claim 1 or 2, it is characterized in that：For paddy rice whitebacked planthopper-resistance kind
Identification and/or the assisted selection of the pest-resistant offspring of paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710158024.3A CN106754910B (en) | 2017-03-16 | 2017-03-16 | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710158024.3A CN106754910B (en) | 2017-03-16 | 2017-03-16 | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754910A true CN106754910A (en) | 2017-05-31 |
| CN106754910B CN106754910B (en) | 2019-11-19 |
Family
ID=58966670
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710158024.3A Active CN106754910B (en) | 2017-03-16 | 2017-03-16 | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754910B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024108865A1 (en) * | 2022-11-25 | 2024-05-30 | 浙江师范大学 | Major qtl linkage molecular marker for sogatella furcifera resistance in rice, and use |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101294161A (en) * | 2008-04-22 | 2008-10-29 | 中国水稻研究所 | Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN106480066A (en) * | 2016-10-31 | 2017-03-08 | 广西壮族自治区农业科学院水稻研究所 | A kind of new gene Wbph9 (t) of Rice Resistance white backed planthopper and its molecule labelling method and application |
-
2017
- 2017-03-16 CN CN201710158024.3A patent/CN106754910B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101294161A (en) * | 2008-04-22 | 2008-10-29 | 中国水稻研究所 | Numerator mark concatenated with whitebacked planthopper resistance genes of rice, and developing method thereof |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN106480066A (en) * | 2016-10-31 | 2017-03-08 | 广西壮族自治区农业科学院水稻研究所 | A kind of new gene Wbph9 (t) of Rice Resistance white backed planthopper and its molecule labelling method and application |
Non-Patent Citations (4)
| Title |
|---|
| KHIN KHIN MARLAR MYINT等: "Virulence of long-term laboratory populations of the brown planthopper,", 《APPL. ENTOMOL. ZOOL.》 * |
| 刘志岩等: "水稻抗白背飞虱基因Wbph2的初步定位", 《中国水稻科学》 * |
| 张建福等: "分子标记辅助选择创制抗白背飞虱水稻恢复系", 《中国水稻科学》 * |
| 闫影等: "野生稻抗病虫基因的挖掘和利用", 《作物杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024108865A1 (en) * | 2022-11-25 | 2024-05-30 | 浙江师范大学 | Major qtl linkage molecular marker for sogatella furcifera resistance in rice, and use |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754910B (en) | 2019-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Das et al. | Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar | |
| Ram et al. | Genetic diversity among cultivars, landraces and wild relatives of rice as revealed by microsatellite markers | |
| Tar’an et al. | Genetic mapping of ascochyta blight resistance in chickpea (Cicer arietinum L.) using a simple sequence repeat linkage map | |
| Botanga et al. | Phenetic relationships among different races of Striga gesnerioides (Willd.) Vatke from West Africa | |
| Mourad et al. | Recent advances in wheat (Triticum spp.) breeding | |
| Singh et al. | Association mapping for mungbean yellow mosaic India virus resistance in mungbean (Vigna radiata L. Wilczek) | |
| CN101294161B (en) | Molecular mark interlinked with whitebacked planthopper resistance genes of rice, and developing method thereof | |
| Sun et al. | A novel er1 allele and the development and validation of its functional marker for breeding pea (Pisum sativum L.) resistance to powdery mildew | |
| CN102586240B (en) | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof | |
| CN106701926A (en) | Mapping of eggplant fruit color epistatic gene D, and InDel molecular marker development and application thereof | |
| Singh et al. | Genetic diversity and interrelationship among Indian and exotic melons based on fruit morphology, quality components and microsatellite markers | |
| CN112159858B (en) | Molecular marker closely linked with purple cauliflower gene and application thereof | |
| CN108949925A (en) | A kind of molecular detecting method for quick and precisely identifying Weedy Rice and cultivated rice | |
| CN106701972A (en) | Linkage molecular marker of main-effect QTL resistant to frogeye leaf spot of Zea may L. and application | |
| Singh et al. | Marker‐assisted forward breeding to develop a drought‐, bacterial‐leaf‐blight‐, and blast‐resistant rice cultivar | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| Beser et al. | Marker-assisted introgression of a broad-spectrum resistance gene, Pi40 improved blast resistance of two elite rice (Oryza sativa L.) cultivars of Turkey | |
| Sehrawat et al. | Introgression of mungbean yellow mosaic virus resistance in Vigna mungo (L.) Hepper and purity testing of F1 hybrids using SSRs | |
| CN101358232A (en) | Molecular marker linked with bruchid resistance gene in mung bean | |
| CN106754910B (en) | The molecular labeling of water resistant rice white backed planthopper gene WBPH2 and application | |
| KS et al. | Marker assisted pedigree breeding based improvement of the Indian mega variety of rice MTU1010 for resistance against bacterial blight and blast and tolerance to low soil phosphorus | |
| CN113652423B (en) | Method for auxiliary identification of drought resistance of wheat to be detected and special molecular marker thereof | |
| CN105506075A (en) | SNP (Single Nucleotide Polymorphism) marker related to resistance to alternaria kikuchiana and application | |
| AU2020103450A4 (en) | Molecular marker of Sogatella furcifera, Horváth resistance gene WBPH2 and application thereof | |
| CN110257545B (en) | Molecular marker for identifying hybrid paper mulberry and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |