CN106754882A - A kind of method of amidase PCR - Google Patents
A kind of method of amidase PCR Download PDFInfo
- Publication number
- CN106754882A CN106754882A CN201611247140.4A CN201611247140A CN106754882A CN 106754882 A CN106754882 A CN 106754882A CN 201611247140 A CN201611247140 A CN 201611247140A CN 106754882 A CN106754882 A CN 106754882A
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- amidase
- reaction
- quick
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method of amidase PCR, specially：Template DNA 0.4 uL, 5* quick uL of 2 uL, 20* fast PCR reinforcing agent of High fidelity PCR cushioning liquid 0.5, the uL of primer 1 0.3,0.6 uL of uL, DMSO of primer 2 0.3, the uL of quick exo+ polymerase 0.2, the uL of water 5.7 are added in PCR reaction tubes, constitute 10 uL reaction systems, it is warming up to 95 DEG C, keep 2min, DNA denaturation at 95 DEG C, keeps 30s, then in 20 s that annealed at 56 DEG C, most after primer extend at 72 DEG C, 2min is kept；Circulation 30 times, in 10min is kept at 72 DEG C, most preserves sample after 12 DEG C, carries out electrophoresis.The present invention is simple to operate, and referring to property is strong, and the condition for quickly obtaining preferable PCR has very strong operability.Additionally, probing into for the PCR conditions of the actinomyces higher for G C base-pair contents also has reference value higher, and experiment proves that the method for the amidase PCR can greatly improve target stripe amplification amount, the yield of raising target product.
Description
Technical field
The present invention relates to amidase PCR fields, and in particular to a kind of method of amidase PCR.
Background technology
Modern industry produces substantial amounts of amide substance.It is reported that the annual requirement of acrylamide from 1999 1.79
Hundred million pounds of increase to 2003 2.05 hundred million pounds, and its annual requirement still increasing year by year.And the discharge capacity of amide substance is then
Increase with the increase of industrial water requirement.However, amide substance is respectively provided with toxicity to human body, such as acrylamide to animal and
The toxic action of the mankind is mainly manifested in the toxic action to nervous system, wherein to the toxic action of peripheral nervous system especially
Substantially, the toxic action of Central nervous also has been reported that.Therefore, the treatment to amide-type industrial wastewater is significant and quarter is not allowed
It is slow.There are the technologies such as Inner electrolysis, advanced oxidation, hydrolysis acidification for amide substance processing method at present.In fact, in nature
In the presence of some plants and the degradable acid amides of microorganism, the reaction of enzymatic has the characteristics of efficient, action condition is gentle.But by
The content of enzyme is very low in protophyte, microorganism, and the enzyme for extracting protophyte and microorganism is very difficult, and price is high
Cause high cost, be unfavorable for industrial treatment.And transgenic technology transformation Escherichia coli etc. are used, make amidase high efficient expression,
The price of enzyme can be then substantially reduced, the improvement for being easy to amide substance to pollute.
Because PCR is the first step of transgenic technology, and experiment condition carrying out for PCR is most important, especially right
In G-C contents DNA fragmentation high.Orthogonal experiment method has been used to optimize the report of PCR reaction conditions in the prior art, but it is transported
Numerous and diverse, experiment is time-consuming, is unfavorable for being carried out continuously for whole test operation.
The content of the invention
In view of above-mentioned the deficiencies in the prior art, it is an object of the invention to provide a kind of method of amidase PCR, it is intended to right
PCR experiment condition is optimized, and numerous and diverse to solve optimization PCR reaction condition computings in the prior art, experiment is time-consuming, is unfavorable for whole
The problem that individual test operation is carried out continuously.
Technical scheme is as follows：
A kind of method of amidase PCR, wherein, comprise the following steps：
A, in PCR reaction tubes add template DNA 0.4 uL, 5* quick High fidelity PCR cushioning liquid 2 uL, 20* quick
The uL of PCR reinforcing agents 0.5, the uL of primer 1 0.3,0.6 uL of uL, DMSO of primer 2 0.3, quick exo+ polymerase 0.2
UL, the uL of water 5.7, constitute 10 uL reaction systems；
Wherein, the primer 1 and the primer 2 sum are total primer amount of reaction system；
B, it is warming up to 95 DEG C, keeps 2min, DNA denaturation at 95 DEG C keeps 30s, then in 20 s that annealed at 56 DEG C, finally
In primer extend at 72 DEG C, 2min is kept；After so carrying out 30 circulations, in 10min is kept at 72 DEG C, most after 12 DEG C of guarantors
Storage sample product.
The method of described amidase PCR, wherein, also include：
C, 2.5 uL Sample Dilutions to 15uL are measured, then taking 7uL carries out electrophoresis experiment, and in gel imaging system imaging, protects
Deposit result.
The method of described amidase PCR, wherein, the template DNA is rare marine actinomycete
Salinispora arenicola。
The method of described amidase PCR, wherein,
The sequence of the primer 1 is：
Salinispora arenicola CNS-205-L: 5'GGGCATATGGCGGTGCAGGACATCA 3' (NdeI)；
The sequence of the primer 2 is：
Salinispora arenicola CNS-205-R: 5'CAGGAATTCCAGTTTCGTCATGCCC 3'(EcoRI)。
The method of described amidase PCR, wherein, the reaction is in the PCR instrument of model Bio-rad Bole's T100 types
Carry out.
The method of described amidase PCR, wherein, the electrophoresis experiment voltage is 60V, and electrophoresis time is 1h.
Beneficial effect：The method that the present invention uses easy amidase PCR, simple to operate, referring to property is strong, for quick
The condition for obtaining preferable PCR has very strong operability.Additionally, the PCR bars of the actinomyces higher for G-C base-pair contents
Probing into for part also has reference value higher, and experiment proves that the method for the amidase PCR can greatly improve target bar
Band amplification amount, improves the yield of target product.
Brief description of the drawings
Fig. 1 be amidase PCR of the present invention method in differential responses system electrophoresis result.
Fig. 2 is the electrophoresis result of the method products therefrom of amidase PCR of the present invention.
Fig. 3 is the gradient multiple dilutions electrophoresis result of the method products therefrom of amidase PCR of the present invention.
Specific embodiment
The present invention provides a kind of method of amidase PCR, to make the purpose of the present invention, technical scheme and effect more clear
Chu, clearly, the present invention is described in more detail below.It should be appreciated that specific embodiment described herein is only used to solve
The present invention is released, is not intended to limit the present invention.
The invention provides a kind of method of amidase PCR, the PCR is Polymease Chain Reaction (poly-
Polymerase chain reacts) abbreviation, PCR is a kind of molecular biology for amplifying the specific DNA fragmentation of amplification
Technology, it is considered as the special DNA replication dna of in vitro, and the maximum feature of PCR is that micro DNA can be significantly increased.
Using DNA, 95 DEG C of time variations turn into single-stranded to PCR in vitro, during low temperature (often at 60 °C or so) primer with it is single-stranded and then by base
The principle of complementary pairing is combined, then temperature regulating, to archaeal dna polymerase optimal reactive temperature (72 °C or so), archaeal dna polymerase is along phosphorus
Direction composition complementary strand of the acid to pentose (5'-3').
The template DNA used in the present invention is rare marine actinomycete Salinispora arenicola, the sequence of primer 1
It is classified as：Salinispora arenicola CNS-205-L:5'GGGCATATGGCGGTGCAGGACATCA 3'(NdeI),
The sequence of primer 2 is：Salinispora arenicola CNS-205-R: 5'CAGGAATTCCAGTTTCGTCATGCCC 3'
, and the primer 1 and the primer 2 sum are the primer total amount of reaction system (EcoRI).Amidase PCR's of the present invention
Method, comprises the following steps：
（One）Template DNA is added in PCR reaction tubes（Template ）The quick High fidelity PCR cushioning liquid of 0.4 uL, 5*
（5*FAST HiFidelity PCR Buffer）2 uL, 20* fast PCR reinforcing agents（20* FAST PCR Enhancer
）0.5 uL, primer 1（Primer 1）0.3 uL, primer 2（Primer 2）0.3 uL、DMSO（Dimethyl sulfoxide (DMSO)） 0.6
UL, quick exo+ polymerase（FAST HiFidelity polymerase）0.2 uL, the uL of water 5.7, composition 10 uL reactions
System；Wherein, the primer 1 and the primer 2 ratio are 1:1, the primer 1 is reaction system with the primer 2 sum
Primer total amount in primer total amount, i.e. 10 uL reaction systems is 0.6 uL, and the primer 1 respectively adds 0.3 uL with the primer 2.
In addition, 5*, 20* represent that the reagent accounts for the 5 ‰ of reaction system, 20 ‰ respectively, but appropriate adjustment is done during this experiment sample-adding.With
Upper reagent is purchased from TIANGEN Biotech (Beijing) Co., Ltd.；
（Two）After the completion of sample-adding, reaction tube is positioned over PCR instrument, wherein, the PCR instrument uses model Bio-rad Bole
T100 types.The PCR instrument manufactured based on PCR is a temperature control device, can be in DNA denaturation temperatures, renaturation temperature
It is controlled well between degree, elongating temperature.PCR instrument is set, it is carried out according to following procedure：95 DEG C are warming up to, are kept
2min, DNA denaturation at 95 DEG C, keeps 30s, then in 20 s that annealed at 56 DEG C, most after primer extend at 72 DEG C, keeps
2min；After so carrying out 30 circulations, in 10min is kept at 72 DEG C, most sample is preserved after 12 DEG C；
（Three）In order to verify the quality of gained sample under conditions above, electrophoresis experiment is carried out.Specially：Measure 2.5 uL samples dilute
Release to 15uL, then taking 7uL carries out electrophoresis, and in gel imaging system imaging, preserves result.
Certainly, obtained by the method for amidase PCR of the present invention is through substantial amounts of Experimental Research combining with theoretical analysis,
Illustrated by taking the probe process based on orthogonal experiment to the method for amidase PCR as an example below.
Orthogonal experiment is to carry out global design, Integrated comparative, system to experiment using the table of marshalling, i.e. orthogonal arrage
Meter analysis, realizes that leading to too small amount of experiment number finds preferable working condition, to reach highest production technology effect.Orthogonal arrage
Can the uniform sampling in factor excursion, make every time experiment all have stronger representativeness, because orthogonal arrage possesses equilibrium
The characteristics of dispersion, it is ensured that the requirement of experiment comprehensively, these experiments tend to purpose that is preferable or preferably reaching experiment.Tool
Body experimentation is as follows：
1st, reagent
Template DNA：Rare marine actinomycete Salinispora arenicola
Primer sequence 1：
Salinispora arenicolaCNS-205-L:5'GGGCATATGGCGGTGCAGGACATCA 3' (NdeI)
Primer sequence 2：
Salinispora arenicola CNS-205-R: 5' CAGGAATTCCAGTTTCGTCATGCCC 3'(EcoRI)。
Wherein, the template DNA is using the STb gene of rare marine actinomycete Salinispora arenicola as research material, institute
State primer 1 and the primer 2 is synthesized by Jin Sirui bio tech ltd.
2nd, process of the test
4 key factors and its each 3 quantization levels for choosing influence PCR reaction results carry out Orthogonal Experiment and Design, and select
L9（34）Orthogonal arrage.4 factors refer to primer total amount, DMSO consumptions, annealing temperature and annealing time, the primer total amount
For primer 1 and primer 2 sum, the primer 1 and primer 2 volume ratio are 1:1.Influence factor-level is expressed as table 1, by root
According to the experiment sequence number and 43 L of quantization level corresponding relation of influence factor of exploratory response system9（34）Orthogonal representation is table
2。
Prepare 9 PCR reaction tubes, and labelling experiment sequence number 1-9 according to Tables 1 and 2, according to 10 uL reaction systems one by one
Sample-adding, wherein, 9 reaction systems may be summarized to be：Template DNA：0.4uL;The quick High fidelity PCR cushioning liquid of 5*：2uL;
20* fast PCR reinforcing agents：0.5uL;Primer 1：B uL;Primer 2： B uL；DMSO ：A uL；H2O ：(6.9-A-2B)
uL；Quick exo+ polymerase：0.2uL.（For example, the reaction system of experiment serial number 1, adds template DNA：0.4uL;5* is fast
Fast High fidelity PCR cushioning liquid：2uL;20* fast PCR reinforcing agents：0.5uL;Primer 1：0.2 uL;Primer 2： 0.2
uL；DMSO ：0.2 uL；Then water is 6.9-0.2-2*0.2=6.1uL.）
After the completion of sample-adding, PCR instrument is set, it is carried out according to following procedure：95 DEG C are warming up to, 2min is kept；At 95 DEG C
DNA is denatured, and 30s is kept, then in 20 s that annealed at 56 DEG C, most after primer extend, 2min at 72 DEG C；After 30 circulations,
In 10min is kept at 72 DEG C, sample most is preserved after 12 DEG C, wherein, D represents numeral in D s, that is, the time annealed, s is the second
Abbreviation.
3rd, electrophoresis
Electrophoresis experiment can verify the quality of the method gained sample of amidase PCR.First, sample, 9 reaction systems are taken respectively
Each 2.5uL of sample of gained, is diluted with water to 15uL, and the PCR sample sizes of the dilution are 16.7%, then loading 7uL in
Ago-Gel, carries out electrophoresis experiment, electrophoresis 1h under 60V voltages.After completing experiment, remove gel and be placed on gel imaging system
Imaging, preserves result.
Further, the concrete operations of the electrophoresis experiment are as follows：
（1）Electrophoresis tank is installed
The running gel bed of lucite is cleaned, is dried, sealed the opening at two ends with adhesive tape, be placed on horizontal workbench
On, plug sample comb；
（2）The preparation of Ago-Gel
Weigh agarose 0.8g to be dissolved in 100ml electrophoretic buffers, put and be heated to dissolving completely in micro-wave oven（Need not be heated to
Boiling）, taking-up shakes up；
（3）Encapsulating
60 DEG C of agarose solution will be cooled to gently to pour on electrophoresis tank level board；
（4）After after agarose gel solidification, electrophoretic buffer is added in electrophoresis tank, then extract comb；
（5）Sample-adding
PCR sample 2.5ul are measured, the 12.5ul that adds water is mixed, and then takes 7ul samples, by the sample and sample loading buffer bromine phenol
Indigo plant presses 4：After 1 mixes, mixed liquor is added in sample cell with micropipettor, and record the point sample order and sample-adding amount of sample；
（6）Electrophoresis
Electrode cable is installed, the termination negative pole of loading wells one, another termination positive pole is turned on the power, and adjusts voltage to 60V, electrophoresis 1h,
When bromophenol blue is moved on to away from gel front 1-2cm, stop electrophoresis；
（7）Dyeing and observation
Gel is taken out, is placed on and 30min is dyeed in the dyeing liquor containing ethidium bromide, you can observed under the uviol lamp of 254nm, had
The position of fluorescent red-orange band, as DNA bands, or the film recording electrophoresis pattern under uviol lamp.
4th, interpretation
To make, experimental result is convenient to be analyzed, with amplified band according to target stripe（1500bp）Definition（70 points；It is designated as A）, it is miscellaneous
Band amplification quantity（30 points；It is designated as B）It is scale.A fractions are higher to represent that target stripe brightness is stronger, more clear；B fractions are got over
It is high then represent amplified band it is more shallow, it is miscellaneous band amplification quantity it is fewer.Orthogonal experiment probes into the electrophoretic image of the method for amidase PCR
Such as accompanying drawing 1, the appraisal result drawn with reference to accompanying drawing 3 is listed in table 3.Wherein, the document of the methods of marking reference includes：（Liu
Along branch, the orthogonal optimization [J] of PCR reaction conditions in the Gene Engineering Experi mental Teachings such as Deng Jianfeng, Tian Changen, Agriculture of Anhui science,
2012,40(24):12276-12278；）And（The orthogonal designs intiutive analysis methods such as what text, Liu Yunsheng, Chen Lihua optimization PCR
Condition [J], Hunan Medical University's journal, 1998,23 (4):403-404）Deng.
As shown in figure 1, from from right to left, be respectively tested number 1,2,3,4,5,6,7,8,9, M be as control scale.From figure
1 as can be seen that experiment the purpose band of sequence number 1,2,4 it is unintelligible, therefore, A item ratings are relatively low in table 3；The experiment purpose of sequence number 5,6,9
Band is more clear, therefore, A item ratings are higher in table 3, and experiment sequence number 5,6,9 is miscellaneous with shallower or negligible amounts, therefore, in table 3
Scoring is higher；And it is miscellaneous bright with more and color to test sequence number 3,7,8, therefore, score relatively low in table 3.
Therefore, according to above experimental data and interpretation of result, that is, the preferable reaction condition for drawing 10 uL reaction systems is
DMSO 0.6uL, primer total amount 0.6uL, 56 DEG C of annealing temperature, annealing time 20s.Orthogonal experiments are listed in table 4,
Table 4
It should be noted that the table 4 further arranges gained with reference to the data of table 3.Wherein, T1 is first water of this
Flat fraction sum, T2 is second horizontal score sum of this, and T3 is that the 3rd horizontal score of this is added
Sum（The water-glass such as table 1, the Score Lists such as table 3）.、、Respectively the average of T1, T2, T3, compares、
、The optimum level for not seeking the factor in the case of interaction factor can be drawn, highest scoring is the best bar of the level
Part.Therefore, the optimum level of each factor is combined, that is, is drawn preferable anti-in 10 uL reaction systems provided by the present invention
Condition is answered for DMSO 0.6uL, primer total amount 0.6uL, 56 DEG C of annealing temperature, annealing time 20s.
Further, by the sample obtained by the method for amidase PCR of the present invention according to above orthogonal experiment
Operating procedure carries out electrophoresis experiment, and the electrophoretic image for being drawn is as shown in Figure 2.Specifically, by heretofore described sample 2.5uL
15uL is diluted with water to, then loading 7uL carries out electrophoresis experiment, electrophoresis 1h in Ago-Gel under 60V voltages.Reference picture 1
With Fig. 2 as can be seen that the band of 10uL reaction systems of the present invention gained sample compared with Fig. 19 reaction systems each just
Hand over the reaction condition combination of experiment all bright, it was demonstrated that amplification efficiency is all high compared with each reaction condition combination in orthogonal experiment.
Further, for the method that amidase PCR of the present invention is preferably presented, the electricity of gradient dilution has been carried out
Swimming experiment.Specifically, the PCR samples obtained by the present invention are diluted with water into 15uL according to 2.5uL, first time dilution is designated as,
Then first time dilution 1,3,5,7uL is taken respectively and is diluted to 10uL again, then take 7uL loadings to Ago-Gel swimming lane respectively
1st, 2,3,4, and swimming lane 5 then takes first time dilution 3uL loading, electrophoresis 1 hour under 60V voltages.Obtained through gel imaging system
Result shown in Fig. 3.As shown in figure 3, from from right to left, being respectively tested number 1,2,3,4,5.In the middle of 1000-2000bp
1500bp is target stripe, and No. 9 brightness most bright to target stripe in Fig. 1 of the target stripe of No. 3 are similar in Fig. 3, even more bright.
No. 9 PCR sample sizes are that No. 3 PCR sample sizes are 8.35% in 16.7%, Fig. 3 in Fig. 1, and both expanding effects are similar, illustrates
Reaction condition amplification efficiency after optimizing through orthogonal experiment in invention is at least 2 times that each condition random is combined, and gradient is tried
Test result and show still and original similar by the band brightness obtained after different gradient multiple dilutions, side light is based on orthogonal examination
Test the amidase PCR optimum conditions that draw of method optimization effective.
Now with technology, the maximum problem of PCR reactions is exactly the exploration of PCR optimal conditions, and especially G-C contents are high
Sample, difficulty is bigger, and optimum condition is difficult to determine, time-consuming and influences the carrying out of follow-up a series of experiments.Reality of the invention
Test group has once carried out substantial amounts of research and probe to the PCR optimal conditions of the bacterial strain material, but the cost time very long does not touch yet
Rope goes out preferable condition.Also there is the report that examen is made to this in the prior art, such as（Liu Shunzhi, Deng Jianfeng, Tian Changen
Deng orthogonal optimization [J] Agriculture of Anhui science of PCR reaction conditions in Gene Engineering Experi mental Teachings, 2012,40 (24):12276-
12278）, but its mathematics computing is excessive, and experiment is complicated, is unfavorable for practical operation；Also researcher once probed into the orthogonal reality of simplicity
The method that method optimizes PCR is tested, such as（Orthogonal design-direct analysis for PCR optimization [J] such as what text, Liu Yunsheng, Chen Lihua
Hunan Medical University's journal, 1998,23 (4):403-404）, but it influences not bigger annealing time and moves back on PCR results
Fiery temperature is probed into.
This experiment uses L9（34）Orthogonal experiment method explores the optimal PCR conditions of Salinispora arenicola bacterial strains,
It is easy to operate, there is great operability to being quickly found out preferable PCR conditions, actinomyces higher to GC base-pair contents
PCR has reference value very much.The target stripe amplification amount of the amidase PCR method in the present invention compared with orthogonal experiment in each condition group
Close all high, it was demonstrated that the result for probing into gained based on orthogonal experiment is quite reliable.
But simultaneously there is certain limitation in experiment of the invention, can not such as illustrate the reciprocation of each factor, it is difficult to estimate
Experimental error etc..When the interactive relation of PCR terms and conditions is probed into, bigger orthogonal test table can be used, more meticulously set
Gradient, sets repetition etc..But during actual experiment, can by L934 orthogonal experiments, be quickly found out optimum condition so as to
The development of subsequent experimental.
In sum, the method for amidase PCR of the present invention, specially：Template DNA is added in PCR reaction tubes
The quick uL of 2 uL, 20* fast PCR reinforcing agent of High fidelity PCR cushioning liquid 0.5 of 0.4 uL, 5*, the uL of primer 1 0.3, draw
0.6 uL of uL, DMSO of thing 2 0.3, the uL of quick exo+ polymerase 0.2, the uL of water 5.7, constitute 10 uL reaction systems, heat up
To 95 DEG C, 2min is kept, DNA denaturation at 95 DEG C keeps 30s, then in 20 s that annealed at 56 DEG C, most draws after at 72 DEG C
Thing extends, and keeps 2min；Circulation 30 times, in 10min is kept at 72 DEG C, most preserves sample after 12 DEG C, carries out electrophoresis experiment.This
Invention is simple to operate, and referring to property is strong, and the condition for quickly obtaining preferable PCR has very strong operability.Additionally, for
Probing into for the PCR conditions of G-C base-pair contents actinomyces higher also has reference value higher, and experiment proves that described
The method of amidase PCR can greatly improve target stripe amplification amount, improve the yield of target product.
It should be appreciated that application of the invention is not limited to above-mentioned citing, and for those of ordinary skills, can
To be improved according to the above description or converted, all these modifications and variations should all belong to the guarantor of appended claims of the present invention
Shield scope.
Claims (7)
1. a kind of method of amidase PCR, it is characterised in that comprise the following steps：
A, in PCR reaction tubes add template DNA 0.4 uL, 5* quick High fidelity PCR cushioning liquid 2 uL, 20* quick
The uL of PCR reinforcing agents 0.5, the uL of primer 1 0.3,0.6 uL of uL, DMSO of primer 2 0.3, quick exo+ polymerase 0.2
UL, the uL of water 5.7, constitute 10 uL reaction systems；
Wherein, the primer 1 and the primer 2 sum are the primer total amount of reaction system；
B, it is warming up to 95 DEG C, keeps 2min, DNA denaturation at 95 DEG C keeps 30s, then in 20 s that annealed at 56 DEG C, finally
In primer extend at 72 DEG C, 2min is kept；Circulation 30 times, in 10min is kept at 72 DEG C, most preserves sample after 12 DEG C.
2. the method for amidase PCR according to claim 1, it is characterised in that also including step：
C, 2.5 uL Sample Dilutions to 15uL are measured, then taking 7uL carries out electrophoresis, and in gel imaging system imaging, preserves knot
Really.
3. the method for amidase PCR according to claim 1, it is characterised in that the template DNA is put for rare ocean
Line bacterium Salinispora arenicola.
4. the method for amidase PCR according to claim 1, it is characterised in that
The sequence of the primer 1 is：
Salinispora arenicola CNS-205-L: 5'GGGCATATGGCGGTGCAGGACATCA 3' (NdeI)；
The sequence of the primer 2 is：
Salinispora arenicola CNS-205-R: 5'CAGGAATTCCAGTTTCGTCATGCCC 3'(EcoRI)。
5. the method for amidase PCR according to claim 1, it is characterised in that the water is redistilled water.
6. the method for amidase PCR according to claim 1, it is characterised in that reaction is in model Bio-rad Bole
Carried out in the PCR instrument of T100 types.
7. the method for amidase PCR according to claim 2, it is characterised in that the electrophoretic voltage is 60V, during electrophoresis
Between be 1h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611247140.4A CN106754882A (en) | 2016-12-29 | 2016-12-29 | A kind of method of amidase PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611247140.4A CN106754882A (en) | 2016-12-29 | 2016-12-29 | A kind of method of amidase PCR |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106754882A true CN106754882A (en) | 2017-05-31 |
Family
ID=58929211
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611247140.4A Pending CN106754882A (en) | 2016-12-29 | 2016-12-29 | A kind of method of amidase PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754882A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103602752A (en) * | 2013-12-06 | 2014-02-26 | 亚能生物技术（深圳）有限公司 | Primer set and kit for detecting rare deletion type thalassemia |
| CN103898083A (en) * | 2014-04-21 | 2014-07-02 | 武汉大学 | Novel hydrolase superfamily amidase Azl13 and preparation and application thereof |
| CN104404011A (en) * | 2014-11-05 | 2015-03-11 | 浙江大学 | Amidase, coding gene and applications thereof |
| CN105255936A (en) * | 2015-10-15 | 2016-01-20 | 佛山科学技术学院 | Method for establishing salinispora arenlocola CNS-205 gene genetic manipulation system |
-
2016
- 2016-12-29 CN CN201611247140.4A patent/CN106754882A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103602752A (en) * | 2013-12-06 | 2014-02-26 | 亚能生物技术（深圳）有限公司 | Primer set and kit for detecting rare deletion type thalassemia |
| CN103898083A (en) * | 2014-04-21 | 2014-07-02 | 武汉大学 | Novel hydrolase superfamily amidase Azl13 and preparation and application thereof |
| CN104404011A (en) * | 2014-11-05 | 2015-03-11 | 浙江大学 | Amidase, coding gene and applications thereof |
| CN105255936A (en) * | 2015-10-15 | 2016-01-20 | 佛山科学技术学院 | Method for establishing salinispora arenlocola CNS-205 gene genetic manipulation system |
Non-Patent Citations (1)
| Title |
|---|
| 刘涛: "《科研思路与方法》", 31 August 2012, 中国中医药出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kuhn et al. | Comparison of ten different DNA extraction procedures with respect to their suitability for environmental samples | |
| CN104694662A (en) | Nucleic acid isothermal amplification reaction detecting method and detection kit based on nucleic acid isothermal amplification reaction detecting method | |
| Veselinyová et al. | Selected in situ hybridization methods: principles and application | |
| Lebuhn et al. | DNA and RNA extraction and quantitative real-time PCR-based assays for biogas biocenoses in an interlaboratory comparison | |
| CN107002069A (en) | The amplification method of cyclic DNA | |
| CN103882105A (en) | Method for measuring content of saturated hydrocarbon-degrading gene AlkB in petroleum-contaminated soil | |
| Cheung et al. | Specific quantification of Scenedesmus obliquus and Chlorella vulgaris in mixed-species algal biofilms | |
| Nakashima et al. | Multiple-gene silencing using antisense RNAs in Escherichia coli | |
| Zhao et al. | Optimization of photosynthetic bacteria wastewater treatment and study of microbial species diversity | |
| Reigstad et al. | Preparation of high-molecular weight DNA and metagenomic libraries from soils and hot springs | |
| Fujimoto et al. | RNA fluorescence in situ hybridization hybridisation using photo-cross-linkable beacon probes containing pyranocarbazole in living E. coli | |
| CN106754882A (en) | A kind of method of amidase PCR | |
| Knüppel et al. | In vivo RNA chemical footprinting analysis in archaea | |
| Atoui et al. | PCR-RFLP for Aspergillus species | |
| Lin et al. | Does capillary racetrack-based enrichment reflect the diversity of uncultivated magnetotactic cocci in environmental samples? | |
| CN104561343B (en) | Distinguish the primer and kit of detection low pathogenicity and highly pathogenic babesia motasi | |
| CN110512010B (en) | Kit and method for detecting transcription rate of rRNA of escherichia coli | |
| Sun et al. | Effects of different methods of DNA extraction for activated sludge on the subsequent analysis of bacterial community profiles | |
| CN104178575B (en) | Method and the kit of a kind of quick discriminating campylobacter fetus and venereal disease subspecies | |
| Ma et al. | Rapid detection of Prorocentrum donghaiense using nuclease protection assay integrated with dot nucleic acid chromatography strip | |
| CN108642149A (en) | A kind of quantitative detecting method of pig manure antibiotics resistance gene | |
| CN107312840A (en) | Duck derived component PCR detections positive criteria molecule, preparation and detection method | |
| Kuzyk et al. | Prosthecate aerobic anoxygenic phototrophs Photocaulis sulfatitolerans gen. nov. sp. nov. and Photocaulis rubescens sp. nov. isolated from alpine meromictic lakes in British Columbia, Canada [Erratum: October 2022, v. 204 (10); p. 646] | |
| Shoaei Naeeni et al. | Isolation and characterization of a bacterium with free glutaminase L-Asparaginase II from the Persian Gulf | |
| Yamazaki et al. | Targeted DNA Methylation in Mouse Early Embryos |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |
|
| RJ01 | Rejection of invention patent application after publication |