CN106754809A - Aleuronat, its encoding gene and application with anti-imidazolinone herbicide activity - Google Patents

Abstract

Aleuronat, its encoding gene and application with anti-imidazolinone herbicide activity, it is the mutein of wheat Acetohydroxyacid synthase, its amino acid sequence is as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3, the expression of protein source Acetohydroxyacid synthase gene in wheat No. 6 chromosomes 6A, 6B or 6D, wheat Acetohydroxyacid synthase is obtained by external mutation, is the characteristics of its amino acid sequence：Compared with wild type, Ser630 sites, Ser629 sites and Ser627 site amino acids are lacked in No. 6 chromosomes 6A, 6B and 6D respectively, the mutant protein confrontation imidazolinone herbicide is resistant, and the plant of its encoding gene conversion has the activity of anti-imidazolinone herbicide.

Description

With anti-imidazolinone herbicide activity aleuronat, its encoding gene and Using

Technical field

The invention belongs to herbicide resistant protein matter field, and in particular to the wheat with anti-imidazolinone herbicide activity Protein, its encoding gene and its application.

Background technology

Wheat is one of big staple food grain crop of China four (other staple food grains are paddy rice, corn, potato), and yield concerns the steady of country Fixed and safety.But, weeds win honour for wheat, strive fertilizer, strive water, cause the Wheat Production underproduction, or even total crop failure.

Grassy weed, such as Triticum tauschii, bromegrass, wild oat, annual bluegrass etc. belong to not of the same race, more year life or together with wheat Nian Sheng, formalness seedling stage, Adult plant are all very much like with wheat, especially grow early stage and are difficult to recognize.In recent years, by Warm in winter climate, the reason such as few no-tillage area expands, weeds of wheat occurrence injury aggravates, Wheat Production constituted sternly Threaten again, and the gesture that harm spreads in extension.Plantation antiweed wheat can simply, economy, efficiently solve wheat paddock The harm of weeds.

Antiweed Acetohydroxyacid synthase (the acetohydroxy acid synthase, abbreviation of wheat endogenous AHAS) protein is produced by ahas gene mutations.AHAS protein is mainly distributed in microorganism and plant, in animal almost Do not exist, AHAS suppresses herbicide to person poultry harmless.Antiweed AHAS protein is produced by ahas gene mutations, and expression is anti-to remove Careless agent AHAS protein can make plant obtain Tolerance To Herbicides, solve the weed problem in field.But, wheat is heterologous 6 times of body plants, the homology and heterologous of gene is more complicated, and at present, the research and development to wheat cdna function both at home and abroad much fall After 2 times of body plants such as paddy rice, corn, wherein, wheat endogenous herbicide resistant protein matter research is very few.Therefore, excavate and study Wheat AHAS protein with antiweed activity has good novelty and economic worth.

At present, the method for cultivating anti-AHAS suppression herbicide wheat is with wheat seed or plant as material carries out chemistry Or physical mutagenesis, carry out genome mutation in plant.The test period of this method acquisition antiweed corn is long (to be more than 5 years), obtain new mutant it is difficult (mutation result is the replacement that the single base change of nucleotides causes single amino acids, easily with Mutation through existing is repeated), and chance of success is small (generally mutation success rate is less than hundred a ten thousandths), and many laboratories are carried out Research and development for many years cannot obtain new mutant.

The content of the invention

It is an object of the invention to provide aleuronat, its encoding gene with anti-imidazolinone herbicide activity And its application, it is artificial reconstructed wheat AHAS muteins, and the protein has anti-imidazolinone herbicide Activity, the plant of its encoding gene conversion has the activity of anti-imidazolinone herbicide.

Different from the acid substitution mutations body for being obtained by vivo mutations at present, the present invention uses amino acid deletion plan Slightly, it is mutated by outside genosome, transforms wheat AHAS protein, obtain wheat AHAS muteins, makes it have anti-removing Careless agent activity.

In order to achieve the above object, the present invention provides following technical scheme：

Aleuronat with anti-imidazolinone herbicide activity, it is the mutation of wheat Acetohydroxyacid synthase Body protein, its amino acid sequence such as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.7, SEQ ID Shown in No.8 or SEQ ID No.9.

Anti- weeding of its amino acid sequence of the invention as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3 The aleuronat of agent activity is precursor full length protein, and maturation protein is turned into after the precursor full length protein erasure signal peptide Matter, corresponding to the amino acid sequence of the precursor full length protein as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3 Row, the amino acid sequence of mature protein is respectively as shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.10.

Gene with anti-imidazolinone herbicide activity, it is that coding is described lives with anti-imidazolinone herbicide The nucleotide sequence of the aleuronat of property.

Further, the nucleotide sequence such as SEQ of aleuronat of the amino acid sequence as shown in SEQ ID No.1 Shown in ID No.4, or aleuronat of the amino acid sequence as shown in SEQ ID No.2 nucleotide sequence such as SEQ ID Shown in No.5, or aleuronat of the amino acid sequence as shown in SEQ ID No.3 nucleotide sequence such as SEQ ID No.6 It is shown, or aleuronat of the amino acid sequence as shown in SEQ ID No.7 nucleotide sequence such as SEQ ID No.10 institutes Show, or aleuronat of the amino acid sequence as shown in SEQ ID No.8 nucleotide sequence as shown in SEQ ID No.11, Or the nucleotide sequence of aleuronat of the amino acid sequence as shown in SEQ ID No.9 is as shown in SEQ ID No.12.

Protein with anti-imidazolinone herbicide activity of the present invention is used to cultivate anti-imidazolone type weeding The plant of agent.

A kind of method for obtaining anti-imidazolinone herbicide plant, including, by the wheat AHAS muteins Encoding gene be transformed into plant, the plant is produced with the active wheat acetyl hydroxyl of anti-imidazolinone herbicide The mutein of base acid enzyme.

Preferably, the nucleotide sequence of amino acid sequence encoding gene of aleuronat as shown in SEQ ID No.1 is such as Shown in SEQ ID No.4, the nucleotide sequence of amino acid sequence encoding gene of aleuronat as shown in SEQ ID No.2 is such as Shown in SEQ ID No.5, the nucleotide sequence of amino acid sequence encoding gene of aleuronat as shown in SEQ ID No.3 is such as Shown in SEQ ID No.6, the nucleotide sequence of amino acid sequence encoding gene of aleuronat as shown in SEQ ID No.7 is such as Shown in SEQ ID No.10, the nucleotide sequence of amino acid sequence encoding gene of aleuronat as shown in SEQ ID No.8 As shown in SEQ ID No.11, the nucleotides sequence of amino acid sequence encoding gene of aleuronat as shown in SEQ ID No.9 Row are as shown in SEQ ID No.12.

Further, the imidazolinone herbicide is not imazethapyr, imazamox or imazapic, but not It is limited to this several imidazolinone herbicide.

Further, the plant is wheat, corn or cotton.

The protein of antiweed activity of the present invention, the protein is ahas genes in wheat No. 6 chromosomes 6A, 6B, 6D By artificial reconstructed wheat AHAS muteins in expression, the expression of ahas genes in Wheat volatiles is come from, by open country Raw type wheat AHAS is by external mutation, the characteristics of obtain wheat AHAS muteins, its amino acid sequence：Expression dye The amino acid sequence of colour solid 6A mutators lacks Ser630 site amino acids compared with wild-type wheat AHAS.Expression dyeing The amino acid sequence of body 6B mutators lacks Ser629 site amino acids compared with wild-type wheat AHAS, expresses chromosome The sequence of 6D mutator amino acid lacks Ser627 site amino acids, these mutant eggs compared with wild-type wheat AHAS White matter is resistant to imidazolinone herbicide.

In the present invention, expression No. 6 amino acid sequences of chromosome 6A mutators of wheat as shown in SEQ ID No.1, its The amino acid sequence of mature protein is as shown in SEQ ID No.7；Expression No. 6 amino acid sequences of chromosome 6B mutators of wheat As shown in SEQ ID No.2, the amino acid sequence of its mature protein is as shown in SEQ ID No.8 for row；No. 6 dyeing of expression wheat The amino acid sequence of body 6D mutators as shown in SEQ ID No.3, the amino acid sequence such as SEQ ID of its mature protein Shown in No.9.

By in the AHAS mutant codes genetic transformation of present invention acquisition to plant, expressed in plant, made plant In contain AHAS muteins, can make plant that there is the activity of anti-imidazolinone herbicide.

The nucleotide sequence of AHAS mutant codes gene of the invention is not limited to wheat endogenous sequence, including described in expression The artificial synthesized nucleotide sequence of protein.

AHAS mutant is expressed in wheat, corn or cotton, transgenic wheat W-WA1M6, W-WA2M6, W- is obtained WA3M6, transgenic corns M-WA1M6, M-WA2M6, M-WA3M6, transgene cotton C-WA1M6, C-WA2M6, C-WA3M6, Genetically modified plants and wild-type plant seedling stage spray anti-imidazolidinone weedicide, and wild-type plant plant is all dead, transgenosis Plant all survives.Illustrate that the plant for expressing AHAS mutant of the present invention has the characteristic of anti-imidazolinone herbicide.

Compared with prior art, the present invention has the advantages that：

1) present invention uses amino acid deletion strategy, and rite-directed mutagenesis is carried out to amino acid, can be prominent after amino acid to deleting Variant proteins carry out external antiweed determination of activity, are provided to develop more new antiweed AHAS muteins Basis, with simple to operate, screening process is simple, strong innovation the advantages of, excavated wheat endogenous anti-herbicide gene, increase The species of anti-herbicide gene.

2) AHAS muteins of the invention are obtained by external mutation, and external mutation has designability By force, the incomparable advantage of vivo mutations such as short, strong innovation of test period, obtained the mutant time less than 2 months, meanwhile, Designed by specific mutation, it is to avoid repeated with AHAS muteins have been reported.

3) after the encoding gene of AHSA muteins of the present invention is expressed, the AHAS total length muteins of acquisition With the activity that AHAS no signal peptide Ripening Mutant protein is respectively provided with anti-imidazolinone herbicide.

Brief description of the drawings

Fig. 1 is the AHAS protein s DS-PAGE electrophoretograms in the embodiment of the present invention 1 after purification；

Wherein, swimming lane 1：WA1M6S protein after purification；Swimming lane 2：WA2M6S protein after purification；Swimming lane 3：Purifying WA3M6S afterwards；Protein swimming lane 4：WA1WS protein after purification；Swimming lane 5：WA2WS protein after purification；Swimming lane 6：It is pure WA3WS protein after change；Mk：Protein Marker, molecular weight is marked on the diagram.

Fig. 2 and Fig. 3 be the embodiment of the present invention 2 in WA1M6S, WA2M6S, WA3M6S and its control WA1WS, WA2WS, WA3WS is to imidazolinone herbicide imazethapyr and the resistance curve map of imazamox.

Specific embodiment

Below in conjunction with specific embodiment, the invention will be further described.

In following examples, unless otherwise specified for《Molecular Cloning:A Laboratory guide》(Science Press, 2002) is remembered Support method.

Primer synthesizes and sequencing student on commission's work Shanghai bioengineering limited company is carried out, and reagent, bacterial strain, carrier etc. are real Articles for use are tested to be bought from Hangzhou biotech company of Sigma.

Imidazoles cigarette acetic acid herbicide is " beans agree " that Shandong first reaches company, and diluted concentration is 200 times of dilution.Methyl miaow grass Cigarette herbicide is " hundred ridges lead to " of BASF Aktiengesellschaft, and diluted concentration is 1000 times of dilution.Imazamox herbicide is U.S. " the golden beans " of cyanamide company of state, diluted concentration is 100 times of dilution.

The method that embodiment 1 obtains AHAS muteins in wheat No. 6 chromosomes 6A, 6B and 6D, including following step Suddenly：

1 builds the ahas genes for deleting Ser630 (6A)/Ser629 (6B)/Ser627 (6D) amino acid

1.1 build the wheat ahas1 genes for deleting Ser630 (6A) amino acid

(1) by the method for many Polymerization chain reactions (PCR), the DNA pieces where ahas1 is amplified from Wheat volatiles Section A6A (public database NCBI sequence numbers：3996-7551 in TGACv1 473240_6AL), separated by agarose electrophoresis, It is purified into PCR primer, i.e. A6A.

Wherein, entering the performing PCR primer that uses of reaction is：

CH6AL-F：5’tttgtgtcgttttatactggtatag；

CH6AL-R：5’atcggtgtgacttagaatcggggtc.

PCR reaction systems are：The μ l of 2 × exo+ polymerase premixed liquid 50, the μ l of primer CH6AL-F (10 μM) 4, primer The μ l of CH6AL-R (10 μM) 4, the μ l of wild-type wheat genomic DNA 1 and the μ l of deionized water 41, cumulative volume are 100 μ l.

PCR programs：A) 95 DEG C, 10 minutes；B) 95 DEG C, 40 seconds；C) 52 DEG C, 40 seconds；D) 68 DEG C, 2 minutes；E) circulation step 2-4,25 times；F) 68 DEG C, 10 minutes；G) 16 DEG C, preserve.

With A6A as template, using primer 6AL F and TA A1EcoR, ahas1 genes wa1w (NCBI sequence numbers are amplified： 4575-6520 in TGACv1 473240_6AL), PCR primer is carried out into T clones (pGEMT, Promega companies of the U.S.), obtain T-WA1W。

Wherein, in PCR reaction systems and program, outside removing template and primer, other conditions are ibid.

The particular sequence of primer is：

6AL F：5’ccatggccgccgccacctcccccgc；

TA A1EcoR：5’gaattctcagtacgaggtcctgccatcaccc.

(2) with T-WA1W as template, using primer 6AL 630SF and 6AL 630SR, performing PCR reaction is entered, by PCR primer T clones are carried out, the mutant clone T-WA1M6 for deleting Ser630 amino acid is obtained.

Wherein, in PCR reaction systems and program, removing template and outer other conditions of primer are identical with step (1).

The particular sequence of primer is：

6AL 630SF：5’cacgtgctgcctatgatcccaggtggtgctttcaaggacatg；

6AL 630SR：5’catgtccttgaaagcaccacctgggatcataggcagcacgtg.

Wherein, as shown in SEQ ID NO.4, amino acid sequence is as shown in SEQ ID NO.1 for the DNA sequence dna of WA1M6.

1.2 build the wheat ahas2 genes for deleting Ser629 (6B) amino acid

Using with above-mentioned 1.1 build delete Ser630 (6A) amino acid wheat ahas1 genes in step identical PCR side Method, DNA fragmentation B6A (the NCBI sequences where ahas2 is amplified from Wheat volatiles using primer CH6BL-F and CH6BL-R Number：40831-44374 in TGACv1 500462_6BL), then with B6A as template, using primer 6BL F and TA A1EcoR, enter Performing PCR reacts, and amplifies ahas2 genes wa2w (NCBI sequence numbers：42182-44124 in TGACv1 500462), PCR is produced Thing carries out T clones, obtains T-WA2W, then with T-WA2W as template, using primer 6BL 629SF and 6BL 629SR, enter performing PCR Reaction, T clones are carried out by PCR primer, obtain the mutant clone T-WA2M6 for deleting Ser629 (6B) amino acid, wherein, As shown in SEQ ID NO.5, amino acid sequence is as shown in SEQ ID NO.2 for the DNA sequence dna of WA2M6.

Wherein, when expanding B6A, the particular sequence of the primer CH6BL-F and CH6BL-R that use is as follows：

CH6BL-F：5’ccacaaccgcgagtggaaatacc；

CH6BL-R：5’catgaagcaggaaaaagggat.

Wherein, when expanding ahas2 gene wa2w, the 6BL F primer particular sequences for using are as follows：

6BL F:5’ccatggccgcagccacctcccccgc；

Wherein, when the mutant WA2M6 of Ser629 amino acid is deleted in amplification, primer the 6BL 629SF and 6BL for using 629SR particular sequences are as follows：

6BL 629SF：5’cacgtgctgcctatgatcccaggtggtgcttttaaggacatg；

6BL 629SR：5’catgtccttaaaagcaccacctgggatcataggcagcacgtg.

1.3 build the wheat ahas3 genes for deleting Ser627 (6D) amino acid

Using with above-mentioned 1.2 build delete Ser630 (6A) amino acid wheat ahas1 genes in step identical PCR side Method, uses primer CH6DL-F and CH6DL-R, DNA fragmentation D6A (the NCBI sequences where AHAS3 is amplified from Wheat volatiles Row number：28689-32840 in TGACv1 527727_6DL), with D6A as template, use primer 6AL F and TA A1EcoR (ginsengs See step (1) in the present embodiment 1.1), amplify ahas3 genes wa3w (NCBI sequence numbers：In TGACv1 527727_6DL 29526-31462), PCR primer is carried out into T clones, obtains T-WA3W, then with T-WA3W as template, use primer 6AL 630SF With 6AL 630SR particular sequences referring to 1.1 steps (2) in the present embodiment), enter performing PCR reaction, PCR primer is carried out into T clones, The mutant clone T-WA3M6 for deleting Ser627 (6D) amino acid is obtained, wherein, the DNA sequence dna such as SEQ ID NO.6 of WA3M6 Shown, amino acid sequence is as shown in SEQ ID NO.3.

Wherein, during amplification of DNA fragments D6A, the particular sequence of primer CH6DL-F and CH6DL-R used is：

CH6DL-F：5’gtgtaaaagtagacatgtgtt；

CH6DL-R：5’tgcgaccccccacaacacccg.

2. express, purify the wheat AHAS mature proteins of erasure signal peptide

(1) T-WA1W with acquisition in above-mentioned steps 1.1, using primer 6AL BamF and TA A1EcoR, is carried out as template PCR is reacted, and PCR primer is carried out into T clones, obtains the wa1w gene clonings T-MA1WS of erasure signal peptide.

Wherein, in PCR reaction systems and program, outer other conditions of removing template and primer ibid, the tool of primer 6AL BamF Body sequence is：

6AL BamF：5’ggatccacaatgctccggccctggggcccgtccgag；

(2) protein expression vector is built, WA1WS is cloned into pGEX4T2, obtain expression no signal peptide AHAS wild types The carrier 4T2-WA1WS of protein.

(3) the carrier 4T2-WA1WS for expressing no signal peptide AHAS wild-type proteins is transferred to expression bacterial strain Rosetta In, centrifugation is obtained supernatant by GST posts by culture, harvesting, ultrasonic disruption cell, cleans GST posts, wash-out, finally Obtain ripe wild-type protein WA1WS.

With with above-mentioned steps 2 (1)-(3) identical method, respectively with above-mentioned steps 1 obtain T-WA2W, T-WA3W, T-WA1M6, T-WA2M6 and T-WA3M6 are template, enter performing PCR using corresponding primer and react, and PCR primer is carried out into T grams It is grand, protein expression vector is built, the expression maturation AHAS wild-type protein carriers 4T2-WA2WS of no signal peptide is obtained respectively With the expression maturation AHAS mutein carriers 4T2- of 4T2-WA3WS, no signal peptide and deletion Ser630 amino acid WA1M6S, no signal peptide and delete Ser629 amino acid expression maturation AHAS mutein carrier 4T2-WA2M6S and No signal peptide and the expression maturation AHAS mutein carrier 4T2-WA3M6S of Ser627 amino acid are deleted, then by above-mentioned table Expressed by expressing bacterial strain Rosetta respectively up to carrier, obtained the ripe wild-type protein of corresponding no signal peptide The ripe AHAS mutant proteins WA1M6S of WA2WS and WA3WS, no signal peptide and deletion Ser630 amino acid, its amino acid Sequence as shown in SEQ ID NO.7, DNA sequence dna is as shown in SEQ ID NO.10, no signal peptide and delete Ser629 amino acid Ripe AHAS mutant proteins WA2M6S, its amino acid sequence as shown in SEQ ID NO.8, DNA sequence dna such as SEQ ID Shown in NO.11, no signal peptide and the ripe AHAS mutant proteins WA3M6S of Ser627 amino acid is deleted, its amino acid sequence As shown in SEQ ID NO.9, DNA sequence dna is as shown in SEQ ID NO.12.

Wherein, with T-WA2W as template expanded when, the primer for using be 6BL BamF and TA A1EcoR, primer 6BL The particular sequence of BamF is：

6BL BamF：5’ggatccacaatgctccggccgtggggcccctccgag；

With T-WA3W as template expanded when, the primer for using be 6AL BamF and TA A1EcoR.

With T-WA1M6 as template expanded when, the primer for using be 6AL BamF and TA A1EcoR.

With T-WA2M6 as template expanded when, the primer for using be 6BL BamF and TA A1EcoR.

With T-WA3M6 as template expanded when, the primer for using be 6AL BamF and TA A1EcoR.

Wild-type protein WA1WS, WA2WS and the WA3WS that will be obtained, and mutein WA1M6S, WA2M6S And WA3M6S, SDS-PAGE electrophoresis detections are carried out, protein adhesive is obtained, protein adhesive is referring to Fig. 1.

As shown in Figure 1, the AHAS protein in swimming lane 1 to swimming lane 6 has obvious band in 90kDa positions, this position with Protein theory size is consistent.Additionally, the protein band accounts for major portion in the protein band of whole swimming lane, step is illustrated The rapid 2 AHAS protein for obtaining high-purity.

Embodiment 2 detects the resistance of wheat AHAS mutant protein confrontation herbicides

Wheat AHAS variant proteins WA1M6S, WA2M6S and WA3M6S for being obtained with embodiment 1 respectively, and AHAS are wild Raw type protein WA1WS, WA2WS and WA3WS is detection main body, and water is blank treatment, the difference with concentration at 0-100 μM Kind herbicide (imidazoles cigarette acetic acid and imazamox) is influence factor, carries out antiweed biologicall test.

Solution reaction system is configured in 2ml centrifuge tubes：450 μ l measure buffer solutions, 10 μ l AHAS protein (WA1M6S, WA2M6S, WA3M6S, WA1WS, WA2WS or WA3WS, 0.5 μ g/ μ l), 40 μ l influence factors solution (water is blank treatment, Herbicide is influence factor), the μ l of cumulative volume 500.

AHAS determination of activity buffer solutions：100mM Sodium Pyruvates, 10mM magnesium chlorides, 1mM TPP, 50 μM of FAD, 50mM phosphoric acid Salt, pH7.4.

Response procedures：Centrifuge tube containing different affecting factors reaction system is placed in into 37 DEG C to react 1 hour；20 μ l30% Sulfuric acid terminating reaction.60 DEG C are reacted 0.5 hour；The alpha-Naphthols of 250 μ l 1.7% are added, 0.17% creatine, 60 DEG C of colour developings 0.5 are small When.200 μ l are taken out from centrifuge tube, solution of the detection containing different affecting factors is in 525nm absorbances.

Testing result：Take herbicide concentration as the wild-type protein WA1WS treatment of 0 (influence factor solution is compareed for water) 525nm absorbances be 100% activity, calculate activity under the conditions of different affecting factors of wild type and mutein Ratio, draws curve map, as a result referring to Fig. 2-Fig. 3.

From Fig. 2-Fig. 3, with the increase of imidazolinone herbicide, WA1WS, WA2WS, WA3WS activity are reduced to 0；And WA1M6S, WA2M6S, WA3M6S activity still remain close to 100% activity in high concentration herbicide.Therefore, WA1M6S, WA2M6S, WA3M6S are resistant to imidazolinone herbicide.

Conversion and expression of the wheat ahas mutant genes of embodiment 3 in plant

In order to express AHAS muteins in unifacial leaf and dicotyledon, with (the letter of the carriers of pCambia 1300 1300) it is called carrier, AHAS Expression elements is built with capsicum mottle virus 35S (abbreviation 35S) promoter and terminator, 35S is opened Mover and terminator DNA sequence dna are shown in http://www.snapgene.com/resources/plasmid_files/plant_ Vectors/pCAMBIA1300/, comprises the following steps that：

(1) with the mutant clone T-WA1M6 of deletion Ser630 amino acid that obtains in embodiment 1 as template, using drawing Thing 6AL BamF and TA A1Sac (primer sets are as described in Example 1), by PCR and BamH1/Sac1 double digestions, obtain Ahas mutant fragments WA1M6T.

(2) it is template with 1300 carriers, it is double by PCR and BamH1/Hind3 using primer 35S-Hind and 35S-Bam Digestion, obtains promoter fragment 35S；

Wherein, primer sequence is：

35S-Hind：5’gcgaagcttcatggagtcaaagattcaaa；

35S-Bam：5’gtgggatccagtcccccgtgttctctccaaatgaa.

(3) it is template with 1300 carriers, using primer ter-Sac and ter-Kpn, by the double enzymes of PCR and BamH1/Hind3 Cut, obtain and terminate sub-piece ter；

Wherein, primer sequence is：

ter-Sac：5’gtggagctcagtagatgccgaccggatctgt；

ter-Kpn：5’cagggtacccgccgaattaattcggggga.

(4) HindIII/SacI double digestions are carried out by 1300, obtains fragment 1300HS, be attached with 35S and WA1M6T, Clone, obtains 1300-35S-WA1M6.

(5) 1300-35S-WA1M6 is carried out into SacI/KpnI double digestions, is connected with ter, cloned, obtained expression AHAS and dash forward The carrier 1300-WA1M6 of variant.

With the method same with above-mentioned steps (1)-(5), it is with the mutant clone T-WA2M6 for deleting Ser629 amino acid Template, obtains the carrier 1300-WA2M6 of expression AHAS mutant.Wherein, the primer for being used in step (1) be 6BL BamF and TA A1Sac (primer sets are as shown in the step 2 of embodiment 1).

With the method same with above-mentioned steps (1)-(5), it is with the mutant clone T-WA3M6 for deleting Ser627 amino acid Template, obtain expression AHAS mutant carrier 1300-WA3M6, wherein, the primer used in step (1) be 6AL BamF and TA A1Sac。

(6) carrier 1300-WA1M6,1300-WA2M6 and 1300-WA3M6 for expressing AHAS mutant are transferred to agriculture respectively In bacillus strain LBA4044, the Plant transformation Agrobacterium of expression AHAS muteins is obtained.

2. the plant of expression AHAS muteins is obtained

The preparation method of genetically modified plants is existing mature technology, and genetically modified plants preparation commission Shanghai is rich to pray biotechnology Co., Ltd is carried out.

Carrier 1300-WA1M6,1300-WA2M6,1300-WA3M6 are transferred to wheat, jade respectively using agrobacterium-mediated transformation In rice and cotton, transgenic wheat W-WA1M6, W-WA2M6, W-WA3M6, transgenic corns M-WA1M6, M-WA2M6, M- are obtained WA3M6, transgene cotton C-WA1M6, C-WA2M6, C-WA3M6.

In the genetically modified plants for obtaining：Transgenic wheat W-WA1M6, W-WA2M6, W-WA3M6, transgenic corns M- WA1M6, M-WA2M6, M-WA3M6, transgene cotton C-WA1M6, C-WA2M6, C-WA3M6 and correspondence wild-type plant seedling stage Spray herbicide, after ten days, counts the death rate, as a result referring to table 1.

Table 1

As shown in Table 1, wild-type plant plant is all dead, and genetically modified plants all survive, and illustrates the expression present invention The plant of AHAS muteins has anti-imidazolinone herbicide activity.

<110>Academy of Agricultural Sciences, Shanghai City

<120>Aleuronat, its encoding gene and application with anti-imidazolinone herbicide activity

<130> 1711039

<160> 12

<170> PatentIn version 3.5

<210> SEQ ID NO.1

<211> 646

<212> PRT

<213>Wheat（Triticum aestivum）

<400> 1

Met Ala Ala Ala Thr Ser Pro Ala Val Ala Phe Ser Gly Ala Ala Ala

1 5 10 15

Ala Ala Ala Ala Met Pro Lys Pro Ala Arg Gln Pro Leu Pro Arg His

20 25 30

Gln Pro Ala Ser Arg Arg Ala Leu Pro Ala Arg Val Val Arg Cys Cys

35 40 45

Ala Ala Pro Pro Ala Ala Ala Thr Ser Ala Ala Pro Pro Ala Thr Ala

50 55 60

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

65 70 75 80

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

85 90 95

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

100 105 110

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

115 120 125

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

130 135 140

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

145 150 155 160

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

165 170 175

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

180 185 190

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

195 200 205

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

210 215 220

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

225 230 235 240

Val Pro Ile Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

245 250 255

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

260 265 270

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

275 280 285

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

290 295 300

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

305 310 315 320

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

325 330 335

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

340 345 350

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

355 360 365

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

370 375 380

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

385 390 395 400

Ala Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

405 410 415

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

420 425 430

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

435 440 445

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

450 455 460

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

465 470 475 480

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

485 490 495

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

500 505 510

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

515 520 525

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

530 535 540

Leu Gly Met Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg

545 550 555 560

Ala His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro

565 570 575

Asp Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val

580 585 590

Thr Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr

595 600 605

Pro Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val

610 615 620

Leu Pro Met Ile Pro Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

625 630 635 640

Asp Gly Arg Thr Ser Tyr

645

<210> SEQ ID NO.2

<211> 645

<212> PRT

<213>Wheat（Triticum aestivum）

<400> 2

Met Ala Ala Ala Thr Ser Pro Ala Val Ala Phe Ser Gly Ala Ala Ala

1 5 10 15

Ala Ala Ala Ala Ile Pro Lys Pro Ala Arg Gln Pro Leu Pro Arg His

20 25 30

Gln Pro Ala Ser Arg Arg Ala Leu Pro Ala Arg Ile Val Arg Cys Cys

35 40 45

Ala Ala Ser Pro Ala Ala Thr Ser Val Ala Pro Pro Ala Thr Ala Leu

50 55 60

Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu Val

65 70 75 80

Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro Gly

85 90 95

Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile

100 105 110

Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser

115 120 125

Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser

130 135 140

Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu

145 150 155 160

Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met

165 170 175

Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg

180 185 190

Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro

195 200 205

Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly

210 215 220

Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val

225 230 235 240

Pro Val Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg Leu

245 250 255

Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu Val

260 265 270

Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala Ala

275 280 285

Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val

290 295 300

Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu

305 310 315 320

Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala

325 330 335

Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp

340 345 350

Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile Val

355 360 365

His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His

370 375 380

Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala

385 390 395 400

Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro Trp

405 410 415

His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe Lys

420 425 430

Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp

435 440 445

Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His

450 455 460

Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp

465 470 475 480

Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala

485 490 495

Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp

500 505 510

Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg

515 520 525

Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His Leu

530 535 540

Gly Met Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala

545 550 555 560

His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp

565 570 575

Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr

580 585 590

Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro

595 600 605

Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu

610 615 620

Pro Met Ile Pro Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly Asp

625 630 635 640

Gly Arg Thr Ser Tyr

645

<210> SEQ ID NO.3

<211> 643

<212> PRT

<213>Wheat（Triticum aestivum）

<400> 3

Met Ala Ala Ala Thr Ser Pro Ala Val Ala Phe Ser Gly Ala Thr Ala

1 5 10 15

Ala Ala Met Pro Lys Pro Ala Arg His Pro Leu Pro Arg His Gln Pro

20 25 30

Val Ser Arg Arg Ala Leu Pro Ala Arg Val Val Arg Cys Cys Ala Ala

35 40 45

Ser Pro Ala Ala Thr Ser Ala Ala Pro Pro Ala Thr Ala Leu Arg Pro

50 55 60

Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala

65 70 75 80

Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro Gly Gly Ala

85 90 95

Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn

100 105 110

His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr

115 120 125

Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro

130 135 140

Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser

145 150 155 160

Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly

165 170 175

Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile

180 185 190

Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val

195 200 205

Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val

210 215 220

Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val

225 230 235 240

Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys

245 250 255

Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu Val Gly Glu

260 265 270

Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala Ala Ser Gly

275 280 285

Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr

290 295 300

Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu

305 310 315 320

Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp

325 330 335

Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val

340 345 350

Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile Val His Ile

355 360 365

Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser

370 375 380

Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Asp Leu Leu

385 390 395 400

Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro Trp His Lys

405 410 415

Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe Lys Thr Phe

420 425 430

Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu

435 440 445

Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met

450 455 460

Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser

465 470 475 480

Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly

485 490 495

Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp

500 505 510

Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu

515 520 525

Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His Leu Gly Met

530 535 540

Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr

545 550 555 560

Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp Phe Val

565 570 575

Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr Lys Lys

580 585 590

Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro

595 600 605

Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met

610 615 620

Ile Pro Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly Asp Gly Arg

625 630 635 640

Thr Ser Tyr

<210> SEQ ID NO.4

<211> 1941

<212> DNA

<213>Wheat（Triticum aestivum）

<400> 4

atggccgccg ccacctcccc cgccgtcgca ttctccggcg ccgccgccgc cgccgccgcc 60

atgcccaagc ccgcccgcca gcctctcccg cgccaccagc ccgcctcgcg ccgcgcgctc 120

cccgcccgcg tcgtcaggtg ctgcgccgcg ccccccgctg ctgccacctc cgccgcgccc 180

cccgccaccg cgctccggcc ctggggcccg tccgagcccc gcaagggcgc cgacatcctc 240

gtcgaggcgc tcgagcgctg cggcatcgtc gacgtattcg cctaccccgg cggcgcgtcc 300

atggagatcc accaggcgct gacgcgctcg cccgtcatca ccaaccacct cttccgccac 360

gagcaggggg aggcgttcgc ggcgtccggc tacgcccgcg cgtccggccg cgtcggcgtc 420

tgcgtcgcca cctccggccc gggggccacc aacctcgtct ccgcgctcgc tgacgccctc 480

ctcgactcca tccccatggt cgccatcacg ggccaggtcc cccgccgcat gatcggcacg 540

gacgcgttcc aggagacgcc catagtggag gtcacgcgct ccatcaccaa gcacaactac 600

ctggtccttg acgtggagga tatcccccgc gtcatccagg aagccttctt cctcgcgtcc 660

tctggccgcc cggggccggt gctggttgat atccccaagg atatccagca gcagatggcc 720

gtgcctatct gggacacgcc gatgagtttg ccagggtaca tcgcccgcct gcccaagcca 780

ccatctactg aatcgcttga gcaggtcctg cgtctggttg gcgagtcacg gcgcccaatt 840

ctgtatgttg gtggtggctg cgctgcatct ggcgaggagt tgcgccgctt tgttgagctc 900

actgggattc cagttacaac tactcttatg ggccttggca acttccccag cgacgaccca 960

ctgtctctgc gcatgcttgg gatgcatggc actgtgtatg caaattatgc agtcgataag 1020

gctgacctgt tgcttgcatt tggtgtgcgg tttgatgatc gtgtgactgg gaaaatcgag 1080

gcttttgcaa gcaggtccaa gattgtgcac attgacattg acccagctga gattggcaag 1140

aacaagcagc cacatgtctc catttgtgca gatgttaagc ttgctttaca ggggttgaat 1200

gctctattaa atgggagcaa agcacaacag ggtctggatt ttggtccatg gcacaaggag 1260

ttggatcagc agaagaggga gtttcctcta ggattcaaga cttttggcga ggccatcccg 1320

ccgcaatatg ctatccaggt actggatgag ctgacaaaag gggaggcgat cattgctacc 1380

ggtgttgggc agcaccagat gtgggcggct cagtattaca cttacaagcg gccacggcag 1440

tggctgtctt cgtctggttt gggggcaatg ggatttgggt taccagctgc agctggcgct 1500

gctgtggcca acccaggtgt tacagttgtt gacattgatg gagacggtag tttcctcatg 1560

aacattcagg agttggcatt gatccgtatt gagaacctcc ctgtgaaggt gatgatattg 1620

aacaaccagc atctgggaat ggtggtgcaa tgggaggata ggttttacaa ggccaatcgg 1680

gcgcacacat accttggcaa cccagaaaat gagagtgaga tatatccaga ttttgtgacg 1740

attgctaaag gattcaacgt tccggcagtt cgtgtgacga agaagagcga agtcactgca 1800

gcaatcaaga agatgcttga gaccccaggg ccatacttgt tggatatcat cgtcccgcat 1860

caggagcacg tgctgcctat gatcccaggt ggtgctttca aggacatgat catggagggt 1920

gatggcagga cctcgtactg a 1941

<210> SEQ ID NO.5

<211> 1938

<212> DNA

<213>Wheat（Triticum aestivum）

<400> 5

atggccgcag ccacctcccc cgccgtcgca ttctcgggcg ccgccgccgc cgccgccgcc 60

atacccaaac ccgcccgcca gcctctcccg cgccaccagc ccgcctcgcg ccgcgcgctc 120

cccgcccgca tcgtcaggtg ctgcgccgcg tcccccgccg ccacctccgt cgcgcctccc 180

gccaccgcgc tccggccgtg gggcccctcc gagccccgca agggcgccga catcctcgtc 240

gaggcgctgg agcgctgcgg catcgtcgac gtcttcgcct accctggcgg cgcgtccatg 300

gagatccacc aggcgctgac gcgctcgcca gtcatcacca accacctctt ccgccacgag 360

cagggggagg cgttcgcggc gtccgggtac gcccgcgcgt ccggccgcgt cggcgtctgc 420

gtcgccacct ccggcccggg ggccaccaac ctcgtctccg cgctcgccga cgctctcctc 480

gactccatcc ccatggtcgc catcacgggc caggtccccc gccgcatgat cggcacggat 540

gcgttccagg agacgcccat cgtggaggtc acgcgctcca tcaccaagca caactacctg 600

gtccttgacg tggaggatat cccccgcgtc atccaggaag ccttcttcct cgcatcctct 660

ggccgcccgg ggccggtgct ggttgatatc cccaaggaca tccagcagca gatggctgtg 720

cctgtctggg acacgccgat gagtttgcca gggtacatcg cccgcctgcc caagccacca 780

tctactgaat cgcttgagca ggtcctgcgt ctggttggcg agtcacggcg cccaattctg 840

tatgttggtg gtggctgcgc tgcatctggt gaggagttgc gccgctttgt tgagctcact 900

gggattccag ttacaactac tcttatgggc cttggcaact tccccagtga cgacccactg 960

tctctgcgca tgctggggat gcatggcact gtgtatgcaa attatgcagt agataaggct 1020

gacctgttgc ttgcatttgg tgtgcggttt gatgatcgtg tgaccgggaa aatcgaggct 1080

tttgcaagca ggtccaagat tgtgcacatt gacattgacc cagctgagat tggcaagaac 1140

aagcagccac atgtctccat ttgtgcagat gttaagcttg ctttacaggg gttgaatgct 1200

ctattaaatg ggagcaaagc acaacagggt ctggattttg gtccatggca caaggagttg 1260

gatcagcaga agagggagtt tcctctagga ttcaagactt ttggtgaggc catcccgccg 1320

caatatgcta tccaggtact ggatgagctg acaaaagggg aggcgatcat tgccaccggt 1380

gttgggcagc atcagatgtg ggcggctcag tattacactt acaagcggcc acggcagtgg 1440

ctgtcttcgt ccggtttggg tgcaatggga tttgggttgc cagctgcagc tggcgctgct 1500

gtggccaacc caggtgttac agttgttgac attgatgggg acggtagttt cctcatgaac 1560

attcaggagt tggcgttgat ccgtattgag aacctcccag tgaaggtgat gatattgaac 1620

aaccagcatc tgggaatggt ggtgcagtgg gaggataggt tttacaaggc caaccgggcg 1680

cacacatacc ttggcaaccc agaaaatgag agtgagatat atccagattt tgtgacgatt 1740

gctaaaggat tcaacgttcc ggcagttcgt gtgacgaaga agagcgaagt cactgcagca 1800

atcaagaaga tgcttgagac cccagggcca tacttgttgg atatcattgt cccgcatcag 1860

gagcacgtgc tgcctatgat cccaggtggt gcttttaagg acatgatcat ggagggtgat 1920

ggcaggacct cgtactga 1938

<210> SEQ ID NO.6

<211> 1932

<212> DNA

<213>Wheat（Triticum aestivum）

<400> 6

atggccgccg ccacctcccc cgccgtcgca ttctcgggcg ccaccgccgc cgccatgccc 60

aaacccgccc gccatcctct cccgcgccac cagcccgtct cgcgccgcgc gctccccgcc 120

cgcgtcgtca ggtgttgcgc cgcgtccccc gccgccacct ccgccgcgcc tcccgcaacc 180

gcgctccggc cctggggccc gtccgagccc cgcaagggcg ccgacatcct cgtcgaggcg 240

ctcgagcgct gcggcatcgt cgacgtcttc gcctaccccg gcggcgcctc catggagatc 300

caccaggcgc tgacgcgctc gcccgtcatc accaaccacc tcttccgcca cgagcagggg 360

gaggcgttcg cggcgtccgg ctacgcccgc gcgtccggcc gcgtcggcgt ctgcgtcgcc 420

acctccggcc cgggggccac caacctcgtc tccgcgctcg ccgacgccct cctcgactcc 480

atccccatgg tcgccatcac gggccaggtc ccccgccgca tgatcggcac ggacgcgttc 540

caggagacgc ccatagtgga ggtcacgcgc tccatcacca agcacaacta cctggtcctt 600

gacgtggagg atatcccccg cgtcatccag gaagccttct tccttgcatc ctctggccgc 660

ccggggccgg tgctagttga tatccccaag gacatccagc agcagatggc tgtgcccgtc 720

tgggacactc caatgagttt gccagggtac atcgcccgcc tgcccaagcc accatctact 780

gaatcgcttg agcaggtcct gcgtctggtt ggcgagtcac ggcgcccaat tctgtatgtt 840

ggtggtggct gcgctgcatc tggcgaggag ttgcgccgct ttgttgagct cactgggatt 900

ccagttacaa ctactcttat gggccttggc aacttcccca gtgacgaccc actgtctctg 960

cgcatgctgg ggatgcatgg cactgtgtat gcaaattatg cagtcgataa ggctgacctg 1020

ttgcttgcat ttggtgtgcg gtttgatgat cgtgtgactg ggaaaatcga ggcttttgca 1080

agcaggtcca agattgtgca cattgacatt gacccagctg agattggcaa gaacaagcag 1140

ccacatgtct ccatttgtgc agatgttaag cttgctttac aggggttgaa tgatctatta 1200

aatgggagca aagcacaaca gggtctggat tttggtccat ggcacaagga gttggatcag 1260

cagaagaggg agtttcctct aggattcaag acttttggcg aggccatccc gccgcaatat 1320

gctatccagg tactggatga gctgacaaaa ggggaggcga tcattgccac cggtgttggg 1380

cagcaccaga tgtgggcggc tcagtattac acttacaagc ggccacggca gtggctgtct 1440

tcgtctggtt tgggggcaat gggatttggg ttaccagctg cagctggcgc tgctgtggcc 1500

aacccaggtg ttacagttgt tgacattgat ggagacggta gtttcctcat gaacattcag 1560

gagttggcat tgatccgtat tgagaacctc ccagtgaagg tgatgatatt gaacaaccag 1620

catctgggaa tggtggtgca gtgggaggat aggttttaca aggccaatcg ggcgcacaca 1680

taccttggca acccagaaaa tgagagtgag atatatccag attttgtgac gattgctaaa 1740

ggattcaacg ttccagcagt tcgagtgacg aagaagagcg aagtcactgc agcaatcaag 1800

aagatgcttg agaccccagg gccatacttg ttggatatca tagtcccgca tcaggagcac 1860

gtgctgccta tgatcccagg tggtgctttc aaggacatga tcatggaggg tgatggcagg 1920

acctcgtact ga 1932

<210> SEQ ID NO.7

<211> 582

<212> PRT

<213>Wheat（Triticum aestivum）

<400> 7

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

1 5 10 15

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

130 135 140

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Ile Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

290 295 300

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

325 330 335

Ala Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

340 345 350

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

355 360 365

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg

485 490 495

Ala His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro

500 505 510

Asp Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val

515 520 525

Thr Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr

530 535 540

Pro Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val

545 550 555 560

Leu Pro Met Ile Pro Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

565 570 575

Asp Gly Arg Thr Ser Tyr

580

<210> SEQ ID NO.8

<211> 582

<212> PRT

<213>Wheat（Triticum aestivum）

<400> 8

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

1 5 10 15

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

130 135 140

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Val Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

290 295 300

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

325 330 335

Ala Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

340 345 350

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

355 360 365

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg

485 490 495

Ala His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro

500 505 510

Asp Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val

515 520 525

Thr Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr

530 535 540

Pro Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val

545 550 555 560

Leu Pro Met Ile Pro Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

565 570 575

Asp Gly Arg Thr Ser Tyr

580

<210> SEQ ID NO.9

<211> 582

<212> PRT

<213>Wheat（Triticum aestivum）

<400> 9

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

1 5 10 15

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

130 135 140

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Val Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

290 295 300

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

325 330 335

Asp Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

340 345 350

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

355 360 365

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Trp Glu Asp Arg Phe Tyr Lys Ala Asn Arg

485 490 495

Ala His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro

500 505 510

Asp Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val

515 520 525

Thr Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr

530 535 540

Pro Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val

545 550 555 560

Leu Pro Met Ile Pro Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

565 570 575

Asp Gly Arg Thr Ser Tyr

580

<210> SEQ ID NO.10

<211> 1749

<212> DNA

<213>Wheat（Triticum aestivum）

<400> 10

ctccggccct ggggcccgtc cgagccccgc aagggcgccg acatcctcgt cgaggcgctc 60

gagcgctgcg gcatcgtcga cgtattcgcc taccccggcg gcgcgtccat ggagatccac 120

caggcgctga cgcgctcgcc cgtcatcacc aaccacctct tccgccacga gcagggggag 180

gcgttcgcgg cgtccggcta cgcccgcgcg tccggccgcg tcggcgtctg cgtcgccacc 240

tccggcccgg gggccaccaa cctcgtctcc gcgctcgctg acgccctcct cgactccatc 300

cccatggtcg ccatcacggg ccaggtcccc cgccgcatga tcggcacgga cgcgttccag 360

gagacgccca tagtggaggt cacgcgctcc atcaccaagc acaactacct ggtccttgac 420

gtggaggata tcccccgcgt catccaggaa gccttcttcc tcgcgtcctc tggccgcccg 480

gggccggtgc tggttgatat ccccaaggat atccagcagc agatggccgt gcctatctgg 540

gacacgccga tgagtttgcc agggtacatc gcccgcctgc ccaagccacc atctactgaa 600

tcgcttgagc aggtcctgcg tctggttggc gagtcacggc gcccaattct gtatgttggt 660

ggtggctgcg ctgcatctgg cgaggagttg cgccgctttg ttgagctcac tgggattcca 720

gttacaacta ctcttatggg ccttggcaac ttccccagcg acgacccact gtctctgcgc 780

atgcttggga tgcatggcac tgtgtatgca aattatgcag tcgataaggc tgacctgttg 840

cttgcatttg gtgtgcggtt tgatgatcgt gtgactggga aaatcgaggc ttttgcaagc 900

aggtccaaga ttgtgcacat tgacattgac ccagctgaga ttggcaagaa caagcagcca 960

catgtctcca tttgtgcaga tgttaagctt gctttacagg ggttgaatgc tctattaaat 1020

gggagcaaag cacaacaggg tctggatttt ggtccatggc acaaggagtt ggatcagcag 1080

aagagggagt ttcctctagg attcaagact tttggcgagg ccatcccgcc gcaatatgct 1140

atccaggtac tggatgagct gacaaaaggg gaggcgatca ttgctaccgg tgttgggcag 1200

caccagatgt gggcggctca gtattacact tacaagcggc cacggcagtg gctgtcttcg 1260

tctggtttgg gggcaatggg atttgggtta ccagctgcag ctggcgctgc tgtggccaac 1320

ccaggtgtta cagttgttga cattgatgga gacggtagtt tcctcatgaa cattcaggag 1380

ttggcattga tccgtattga gaacctccct gtgaaggtga tgatattgaa caaccagcat 1440

ctgggaatgg tggtgcaatg ggaggatagg ttttacaagg ccaatcgggc gcacacatac 1500

cttggcaacc cagaaaatga gagtgagata tatccagatt ttgtgacgat tgctaaagga 1560

ttcaacgttc cggcagttcg tgtgacgaag aagagcgaag tcactgcagc aatcaagaag 1620

atgcttgaga ccccagggcc atacttgttg gatatcatcg tcccgcatca ggagcacgtg 1680

ctgcctatga tcccaggtgg tgctttcaag gacatgatca tggagggtga tggcaggacc 1740

tcgtactga 1749

<210> SEQ ID NO.11

<211> 1749

<212> DNA

<213>Wheat（Triticum aestivum）

<400> 11

ctccggccgt ggggcccctc cgagccccgc aagggcgccg acatcctcgt cgaggcgctg 60

gagcgctgcg gcatcgtcga cgtcttcgcc taccctggcg gcgcgtccat ggagatccac 120

caggcgctga cgcgctcgcc agtcatcacc aaccacctct tccgccacga gcagggggag 180

gcgttcgcgg cgtccgggta cgcccgcgcg tccggccgcg tcggcgtctg cgtcgccacc 240

tccggcccgg gggccaccaa cctcgtctcc gcgctcgccg acgctctcct cgactccatc 300

cccatggtcg ccatcacggg ccaggtcccc cgccgcatga tcggcacgga tgcgttccag 360

gagacgccca tcgtggaggt cacgcgctcc atcaccaagc acaactacct ggtccttgac 420

gtggaggata tcccccgcgt catccaggaa gccttcttcc tcgcatcctc tggccgcccg 480

gggccggtgc tggttgatat ccccaaggac atccagcagc agatggctgt gcctgtctgg 540

gacacgccga tgagtttgcc agggtacatc gcccgcctgc ccaagccacc atctactgaa 600

tcgcttgagc aggtcctgcg tctggttggc gagtcacggc gcccaattct gtatgttggt 660

ggtggctgcg ctgcatctgg tgaggagttg cgccgctttg ttgagctcac tgggattcca 720

gttacaacta ctcttatggg ccttggcaac ttccccagtg acgacccact gtctctgcgc 780

atgctgggga tgcatggcac tgtgtatgca aattatgcag tagataaggc tgacctgttg 840

cttgcatttg gtgtgcggtt tgatgatcgt gtgaccggga aaatcgaggc ttttgcaagc 900

aggtccaaga ttgtgcacat tgacattgac ccagctgaga ttggcaagaa caagcagcca 960

catgtctcca tttgtgcaga tgttaagctt gctttacagg ggttgaatgc tctattaaat 1020

gggagcaaag cacaacaggg tctggatttt ggtccatggc acaaggagtt ggatcagcag 1080

aagagggagt ttcctctagg attcaagact tttggtgagg ccatcccgcc gcaatatgct 1140

atccaggtac tggatgagct gacaaaaggg gaggcgatca ttgccaccgg tgttgggcag 1200

catcagatgt gggcggctca gtattacact tacaagcggc cacggcagtg gctgtcttcg 1260

tccggtttgg gtgcaatggg atttgggttg ccagctgcag ctggcgctgc tgtggccaac 1320

ccaggtgtta cagttgttga cattgatggg gacggtagtt tcctcatgaa cattcaggag 1380

ttggcgttga tccgtattga gaacctccca gtgaaggtga tgatattgaa caaccagcat 1440

ctgggaatgg tggtgcagtg ggaggatagg ttttacaagg ccaaccgggc gcacacatac 1500

cttggcaacc cagaaaatga gagtgagata tatccagatt ttgtgacgat tgctaaagga 1560

ttcaacgttc cggcagttcg tgtgacgaag aagagcgaag tcactgcagc aatcaagaag 1620

atgcttgaga ccccagggcc atacttgttg gatatcattg tcccgcatca ggagcacgtg 1680

ctgcctatga tcccaggtgg tgcttttaag gacatgatca tggagggtga tggcaggacc 1740

tcgtactga 1749

<210> SEQ ID NO.12

<211> 1749

<212> DNA

<213>Wheat（Triticum aestivum）

<400> 12

ctccggccct ggggcccgtc cgagccccgc aagggcgccg acatcctcgt cgaggcgctc 60

gagcgctgcg gcatcgtcga cgtcttcgcc taccccggcg gcgcctccat ggagatccac 120

caggcgctga cgcgctcgcc cgtcatcacc aaccacctct tccgccacga gcagggggag 180

gcgttcgcgg cgtccggcta cgcccgcgcg tccggccgcg tcggcgtctg cgtcgccacc 240

tccggcccgg gggccaccaa cctcgtctcc gcgctcgccg acgccctcct cgactccatc 300

cccatggtcg ccatcacggg ccaggtcccc cgccgcatga tcggcacgga cgcgttccag 360

gagacgccca tagtggaggt cacgcgctcc atcaccaagc acaactacct ggtccttgac 420

gtggaggata tcccccgcgt catccaggaa gccttcttcc ttgcatcctc tggccgcccg 480

gggccggtgc tagttgatat ccccaaggac atccagcagc agatggctgt gcccgtctgg 540

gacactccaa tgagtttgcc agggtacatc gcccgcctgc ccaagccacc atctactgaa 600

tcgcttgagc aggtcctgcg tctggttggc gagtcacggc gcccaattct gtatgttggt 660

ggtggctgcg ctgcatctgg cgaggagttg cgccgctttg ttgagctcac tgggattcca 720

gttacaacta ctcttatggg ccttggcaac ttccccagtg acgacccact gtctctgcgc 780

atgctgggga tgcatggcac tgtgtatgca aattatgcag tcgataaggc tgacctgttg 840

cttgcatttg gtgtgcggtt tgatgatcgt gtgactggga aaatcgaggc ttttgcaagc 900

aggtccaaga ttgtgcacat tgacattgac ccagctgaga ttggcaagaa caagcagcca 960

catgtctcca tttgtgcaga tgttaagctt gctttacagg ggttgaatga tctattaaat 1020

gggagcaaag cacaacaggg tctggatttt ggtccatggc acaaggagtt ggatcagcag 1080

aagagggagt ttcctctagg attcaagact tttggcgagg ccatcccgcc gcaatatgct 1140

atccaggtac tggatgagct gacaaaaggg gaggcgatca ttgccaccgg tgttgggcag 1200

caccagatgt gggcggctca gtattacact tacaagcggc cacggcagtg gctgtcttcg 1260

tctggtttgg gggcaatggg atttgggtta ccagctgcag ctggcgctgc tgtggccaac 1320

ccaggtgtta cagttgttga cattgatgga gacggtagtt tcctcatgaa cattcaggag 1380

ttggcattga tccgtattga gaacctccca gtgaaggtga tgatattgaa caaccagcat 1440

ctgggaatgg tggtgcagtg ggaggatagg ttttacaagg ccaatcgggc gcacacatac 1500

cttggcaacc cagaaaatga gagtgagata tatccagatt ttgtgacgat tgctaaagga 1560

ttcaacgttc cagcagttcg agtgacgaag aagagcgaag tcactgcagc aatcaagaag 1620

atgcttgaga ccccagggcc atacttgttg gatatcatag tcccgcatca ggagcacgtg 1680

ctgcctatga tcccaggtgg tgctttcaag gacatgatca tggagggtga tggcaggacc 1740

tcgtactga 1749

Claims (8)

1. there is the aleuronat of anti-imidazolinone herbicide activity, it is the mutant of wheat Acetohydroxyacid synthase Protein, its amino acid sequence such as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.7, SEQ ID Shown in No.8 or SEQ ID No.9.

2. it is a kind of with anti-imidazolinone herbicide activity gene, its be coding claim 1 described in aleuronat Nucleotide sequence.

3. there is the gene of anti-imidazolinone herbicide activity as claimed in claim 2, it is characterised in that the amino acid The nucleotide sequence of aleuronat of the sequence as shown in SEQ ID No.1 is as shown in SEQ ID No.4, or amino acid sequence The nucleotide sequence of the aleuronat as shown in SEQ ID No.2 is as shown in SEQ ID No.5, or amino acid sequence is such as The nucleotide sequence of the aleuronat shown in SEQ ID No.3 is as shown in SEQ ID No.6, or amino acid sequence such as SEQ The nucleotide sequence of the aleuronat shown in ID No.7 is as shown in SEQ ID No.10, or amino acid sequence such as SEQ ID The nucleotide sequence of the aleuronat shown in No.8 is as shown in SEQ ID No.11, or amino acid sequence such as SEQ ID The nucleotide sequence of the aleuronat shown in No.9 is as shown in SEQ ID No.12.

4. having the aleuronat of anti-imidazolinone herbicide activity as claimed in claim 1 is used to cultivate anti-imidazolone Class herbicide plant.

5. a kind of method for obtaining anti-imidazolinone herbicide plant, including, by the volume of aleuronat described in claim 1 Code genetic transformation produces the wheat acetohydroxy acid synthesis with anti-imidazolinone herbicide activity in plant, making plant The mutein of enzyme.

6. the method for obtaining anti-imidazolinone herbicide plant according to claim 5, it is characterised in that the coding base The nucleotide sequence of cause such as SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.10, SEQ ID No.11 Or shown in SEQ ID No.12.

7. the method for obtaining anti-imidazolinone herbicide plant according to claim 5, it is characterised in that the imidazoline Type herbicides are at least one in imazethapyr, imazamox and imazapic.

8. the method that anti-imidazolinone herbicide plant is obtained according to claim any one of 5-7, it is characterised in that institute Plant is stated for wheat, corn or cotton.