CN106754729B - Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor - Google Patents
Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor Download PDFInfo
- Publication number
- CN106754729B CN106754729B CN201611267083.6A CN201611267083A CN106754729B CN 106754729 B CN106754729 B CN 106754729B CN 201611267083 A CN201611267083 A CN 201611267083A CN 106754729 B CN106754729 B CN 106754729B
- Authority
- CN
- China
- Prior art keywords
- cells
- oct4
- tale
- ipscs
- xist
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/602—Sox-2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/603—Oct-3/4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/604—Klf-4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
Abstract
The invention discloses a method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factors, which improves the induction efficiency of mouse fibroblasts to the induced pluripotent stem cells by combining the inhibitory transcription factors R6 based on transcription-activated effector-like (Tale) combined with Xist first intron regions with the synergistic effect among Oct4, Sox2, Klf4 and c-Myc. And the obtained iPSCs have typical pluripotent stem cell characteristics, including participation in the development of chimeric mice. The method not only actively promotes the clinical application and research of iPSCs, but also provides a new technology and theoretical basis for researching how to obtain and improve iPSCs of other mammals such as human, pig, cattle and the like.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor in combination with Oct4, Sox2, Klf4 and c-Myc.
Background
Embryonic Stem Cells (ESCs) are a class of highly undifferentiated cells that have developmental totipotency. Can be proliferated indefinitely under appropriate conditions, and can differentiate all cells of tissues and organs of adult animals, such as hematopoietic cells, nerve cells, cardiac muscle cells, etc. Has application value in the fields of animal cloning, transgenic animal production, disease treatment, tissue engineering, regenerative medicine, disease mechanism and treatment research, drug discovery and evaluation and the like. However, ethical laws and immune rejection and other problems always restrict the further development and application of ESCs technology.
2006, japan scientists succeeded in reprogramming mouse somatic cells to ESCs state, i.e., Induced Pluripotent Stem Cells (iPSCs), by introducing 4 transcription factors Oct4, Sox2, c-Myc, Klf4, and then human iPSCs were obtained by similar genetic engineering methods, which have biological characteristics similar to ESCs, including the ability to differentiate all cells of tissues and organs of adult animals, such as neural precursor cells, functional mature nerve cells, hematopoietic precursor cells, hematopoietic cells, vascular endothelial cells, β cells secreting insulin, cardiac muscle cells, etc. 2009, chinese scientists zhou qi, mazengyi, shanghai, etc. obtaining live experimental mice using iPSCs, which first proved that iPSCs have totipotency as with ESCs, and also, since iPSCs were derived from autologous reprogramming, the field of stem cell transplantation, which has well avoided the use of stem cells for a long time around ethical theory, and the issue of human embryo transplantation, and the issue of rejection in medicine was also overcome.
However, research on the iPSCs technology is still in the early stage, and the low efficiency is one of the main obstacles facing the application of iPSCs. Among various induction methods, the retroviral vector has the highest efficiency of inducing cell reprogramming, which is only about 0.01%, and the lentivirus and adenovirus are lower. How to obtain an efficient iPSCs technology becomes a hot spot in the stem cell research field internationally at present.
The core of the iPSCs transformation technology is how to rapidly start the expression of cell endogenous genes such as Oct4 and Nanog through heterologous expression of genes such as Oct4 and Sox 2. In embryonic stem cells, pluripotency regulatory factors OCT4, SOX2, NANOG, and the like bind to Xist first intron region to regulate and maintain a low level state of Xist RNA. Recently, it was found that the factors binding in the first intron region of Xist also include the pluripotency regulatory factor TCF3 and PRDM14, and the early embryonic development regulatory factor CDX2, etc. Furthermore, it has been reported that Xist first intron has enhancer activity during differentiation of ESCs. As a key region for combining pluripotency factors, the apparent modification state of the first intron region of Xist is probably closely related to the reprogramming information of MEFs cells, and even the induction efficiency of iPSC can be improved.
The transcription-like activator-like effectors (TALEs) family of proteins are natural bacterial effector proteins from the plant pathogen xanthomonas. It is similar to eukaryotic transcription factors, regulates host gene transcription by recognizing specific DNA sequences, and promotes bacterial colonization. TALEs proteins synthesized in vitro have been applied to various aspects of genetic engineering, including Transcription Activator Like Effector Nucleases (TALENs) with genome editing function and Tale-dTFs for gene transcription modification and regulation, wherein the Tale-dTFs include inhibitory effector (Tale based transcription effectors, Tale R-dTF) and activating effector (Tale based transcription effectors, Tale a-dTF), their Tale proteins are linked with inhibitory domains (e.g., KRAB, etc.) and activating domains (e.g., VP64), respectively, and finally, various transcription regulators are recruited at the binding sites to achieve the purpose of changing epigenetic modification state of the binding sites and regulating target gene switches. Furthermore, Tale-dTFs have been successfully used in the reprogramming of MEF cells and the differentiation and transdifferentiation experiments of stem cells.
Therefore, the method for efficiently obtaining iPSCs by utilizing the Tale inhibitory transcription factor combined with the first intron of Xist is utilized to establish a method for efficiently obtaining iPSCs, so that not only is the clinical application and research of iPSCs actively promoted, but also a new technology and a theoretical basis are provided for researching how to obtain and improve iPSCs of other mammals such as human, pig, cattle and the like.
Disclosure of Invention
The technical problem to be solved by the invention is to provide a method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factors.
In order to solve the technical problems, the invention adopts the technical scheme that:
1. cell preparation
Obtaining fibroblast (MEF) of a fetal rat, selecting MEF with good growth state and mitomycin C for treatment, and using the MEF and mitomycin C as a feeding layer for inducing and culturing iPSCs.
Oct4-GFP MEFs were obtained, and Oct4-GFP MEF in good growth state was selected for electrotransfection and iPSCs were prepared.
2. Method for establishing high-efficiency obtaining induced pluripotent stem cells
In the method for establishing the high-efficiency induced pluripotent stem cell, a PiggyBac vector containing four transcription factors of Oct4, Sox2, Klf4 and c-Myc and a Xist Tale inhibitory transcription factor are used for transfection. Adding four transcription factors Oct4, Sox2, Klf4, c-Myc and a Tale inhibitory transcription factor R6 bound to a first intron region of Xist into an experimental group, and taking single treatment or combination of ConR without specific binding sites of the four transcription factors Oct4, Sox2, Klf4 and c-Myc as a control group to determine the efficiency of transfecting Oct4-GFP MEFs to obtain iPSCs by different combinations, thereby further determining the method for efficiently obtaining the iPSCs.
Electrotransfection is carried out according to the conventional method: four transcription factors Oct4, Sox2, Klf4, c-Myc and Xist Tale inhibitory factor R6 were transfected into well-grown Oct4-GFP MEFs by electroporation; . The following day, the medium was changed to a liquid medium for induction of iPSC supplemented with Dox (M15) until colonies were formed, and the colonies were subjected to alkaline phosphatase detection or colonies morphologically resembling embryonic stem cells were selected and expanded for culture, and further subjected to biological characterization of induced pluripotent stem cells. Clones that matched the biological characteristics of induced pluripotent stem cells were identified as induced pluripotent stem cells.
The morphological change of the cells is observed under a microscope. According to the clone formation condition, after inducing for 25-30 days, determining the efficiency of obtaining iPSCs by various methods; or mechanically passaging the clones to expand the culture and further performing biological characterization of the obtained clones.
Identification of biological characteristics of iPSCs
Alkaline phosphatase AP activity assay to determine if the ESCs-like clones obtained were positive for AP staining.
And (3) detecting the expression of ESCs related proteins in the ESC-like clones obtained by immunofluorescence, wherein antibodies are anti-Oct4 and anti-Nanog respectively. For nucleoproteins, PBT (PBS + 0.1% Triton-100) treatment was required to allow the corresponding antibodies to enter the nucleus and bind to the corresponding antigens.
The differentiation potential of ESCs-like clones was investigated by in vitro and in vivo differentiation experiments. In vitro differentiation was verified by the formation of embryoid bodies and the spontaneous differentiation of embryoid bodies into various cells. In vivo differentiation potential studies were performed by injecting the obtained ESC-like clones into NOD-SCID mice, observing teratoma formation and analyzing the differentiation of the mesoderm in teratomas.
And detecting the expression of ESCs pluripotent genes in the obtained ESC-like clone by RT-qPCR (reverse transcription-quantitative polymerase chain reaction), such as Oct4, Sox2, Nanog and the like.
Chimera preparation technology is used to research whether ESC-like cells can participate in the normal development of mouse to determine the capacity of ESC-like cells to participate in formation and development of individual.
The invention has the beneficial effects that: the method improves the induction efficiency of the mouse iPSCs, not only actively promotes the clinical application and research of the iPSCs, but also provides a new technology and theoretical basis for researching how to obtain and improve the iPSCs of other mammals such as human, pig, cattle and the like. .
Drawings
FIG. 1 is a flow chart of the present invention;
FIG. 2 is a schematic structural diagram of the Xist Tale inhibitory effector R6 of the present invention;
FIG. 3 is a binding site of a vector used in the present invention on Xist gene;
FIG. 4 shows Oct4-GFP MEFs (scale bar A, B500 μm and 200 μm, respectively) used in the present invention;
FIG. 5 is a morphological diagram of Oct4-GFP positive iPSC clone induced in the present invention (A, B scale bar 200 μm);
figure 6 is a graph of the induction efficiency of R6 increased iPSCs (relative fold, P < 0.0);
FIG. 7 is a graph of the growth of iPSCs obtained in the present invention (P15, scale bar 200 μm);
FIG. 8 shows typical stem cell characteristics of iPSCs obtained in the present invention (A: positive for Alkaline Phosphatase (AP) staining of iPSCs, scale bar 200 μm; B positive for immunofluorescence staining of pluripotency factors OCT4 and NANOG, scale bar 100 μm; C: ability of obtained iPSCs to differentiate into the three germ layers in vivo (teratoma test), scale bar 100 μm; D: ability of obtained iPSCs to differentiate into the three germ layers in vitro (embryoid body test), scale bar 100 μm; E: expression levels of pluripotency-related genes of obtained iPSCs and ESCs are similar; F: obtained iPSCs are involved in development of chimeric embryos in vitro; G: obtained iPSCs are involved in formation and development of chimeric mice).
Detailed Description
The invention is described in further detail below with reference to the following figures and detailed description:
the method for preparing the induced pluripotent stem cells by using the Xist Tale inhibitory transcription factor comprises the following steps:
1) cell preparation
Obtaining fibroblast MEF of a fetal rat, treating the MEF by mitomycin C, and using the MEF as a feeding layer for inducing and culturing iPSCs; obtaining Oct4-GFP MEFs;
2) method for obtaining induced pluripotent stem cells
Transfection with PiggyBac vector containing four transcription factors Oct4, Sox2, Klf4 and c-Myc and Xist Tale inhibitory transcription factor; the experimental group was supplemented with four transcription factors Oct4, Sox2, Klf4, c-Myc and the Tale inhibitory transcription factor R6 bound to the first intron region of Xist, and the control group was composed of four transcription factors Oct4, Sox2, Klf4, c-Myc treated alone or in combination with ConR without specific binding sites.
Specifically, the step 2) includes the steps of:
A. electrotransfection of Oct4-GFP MEF cells: when Oct4-GFP MEF cells reached 80% confluency, they were digested with 0.5g/L trypsin-0.02% EDTA for 5min at 37 deg.C, the digestion was stopped with an equal amount of medium, the cells were counted, and 1X 10 cells were collected6Centrifuging the cells/electrotransfer system at 1300rpm for 5 min; discard the supernatant and resuspend the cells with 100. mu.L of electrotransfer; then the cells are transferred into an electric rotating cup Sigma Z706086-50EA, an electric rotating instrument Lonza is selected,
procedure A-023 is electrically stimulated; adding 500 mu L of culture solution preheated in advance into the electric rotating cup, and finally inoculating the cell suspension into a culture dish which is prepared in advance and is paved with the feeder layer cells in the step 1) for culture; the 100. mu.L electrotransfer solution is Opti-MEM culture solution containing 1.0. mu.g TRE-Oct4, 2.0. mu.g TRE-CKS, 1.0. mu.g transposase HyBase and 1.0. mu.g CAG-rtTA; on this basis, the experimental group additionally added 2.0. mu.g of Tale inhibitory transcription factor R6 bound to the first intron of Xist, while the control group added no other vector, or added 2.0. mu.g of Tale inhibitory transcription factor ConR without specific binding site; CKS in TRE-CKS means c-Myc, Klf4 and Sox 2;
B. induction and establishment of iPSC after electrotransformation: the next day of electrotransfection, the culture solution is changed into fresh M15 culture solution added with 2 mug/mL Dox, and the culture solution is changed every other day; after 14 days, removing Dox, and changing to 2i culture solution for culture till 25-30 days until Oct4-GFP positive clone appears; and (3) performing microscopic examination and counting on the 25 th day under a fluorescent microscope, drawing a glass microneedle to pick out Oct4-GFP positive cell clones, transferring the picked iPSC clones into a round-bottom 96-well plate in which 30 mu L of 0.5g/L trypsin-0.02% EDTA digestive juice is added in advance by using a 10 mu L pipette gun, digesting for 8min at 37 ℃, adding an equal amount of culture solution after blowing and beating for several times to stop digestion, and inoculating the cells into the flat-bottom 96-well plate paved with the feeder cells in the step 1) to culture in a 37 ℃ 5% CO2 incubator until typical iPSC clones are formed.
In the step B, MEF is subjected to cooperative electrotransfection to form iPSC cells by combining four transcription factors Oct4, Sox2, Klf4 and c-Myc by using a Tale inhibitory transcription factor R6 bound to a first intron region of Xist, and specific binding sites of R6 are as follows: TTAAGTGTTATGGACAAGGA SEQ ID NO.1, reference gene sequence numbers in GeneBank: NC _ 000086.7.
The invention uses 3 culture mediums, and the concrete preparation method is as follows:
1. preparation of liquid medium for mouse fetal fibroblast (M10):
KnockoutDMEM containing 10% fetal bovine serum, 1 Xglutamine, 1 Xnonessential amino acids, 1 Xpenicillin.
2. Preparation of liquid medium for induction of iPSCs (M15):
contains 15% fetal calf serum, 1 Xglutamine, 1 Xnonessential amino acids, 1 Xpenicillin streptomycin, 0.1mM β -mercaptoethanol and 10 mM6Knockout DMEM U/ml LIF.
3. 2i/LIF culture solution:
contains N2, B27, 1 Xglutamine, 1 Xnonessential amino acids, 1 Xstreptomycin, 0.1mM β -mercaptoethanol and LIF (10)6U/ml), PD (1.0. mu.M), DMEM/F12 of CH (3.0. mu.M).
Example 1: preparation of the support
A mouse Oct4Tale R-dTF vector (reproducing to compiling using designing factors targeting enhancers (Gao et al, 2013)) is transformed into Tale R-dTF (R6) which can specifically recognize and combine with a Xist first intron region, and finally formed R6 is an expression vector (the structure and the combination site of Xist Tale inhibitory effector R6) driven by a Doxycine (Dox) dependent promoter TRE carried by a PB vector. The specifically identified DNA sequence was TTAAGTGTTATGGACAAGGA (reference gene sequence number in GeneBank: NC-000086.7)
Example 2: preparation of feeder layer cells
Taking MEFs growing to 80% confluence in 3-5 generations, sucking and removing the original culture solution, adding 6mL of MEF culture solution of mitomycin C with the final concentration of 10mg/L into a 100mm cell culture dish, and treating the cells for 2.5 h; discard the culture solutionAdding 5mL of D-PBS to wash the cells, repeating the washing for 3 times, completely removing mitomycin C, adding 2mL0.5g/L of trypsin-0.02% EDTA digestive juice, incubating and digesting the cells at 37 ℃ for 1min, observing the cell contraction and rounding under an inverted phase difference microscope, tapping the side wall of the culture dish by hand, taking the cell layer down from the bottom of the dish, and adding an equal amount of M10 culture solution to stop digestion; blowing and uniformly mixing the dish wall and the cell suspension by using an electric pipettor, collecting the cell suspension to a 15mL centrifuge tube for cell counting, centrifuging at 1000r/min for 3min, then removing the supernatant, and using frozen stock solution (10% FBS + 10% DMSO + 80% M10 culture solution) at 2 × 106The concentration of each tube is frozen, the tube is thawed when in use, and two 6-hole plates can be laid after each tube is thawed.
Example 3: establishment of Oct4-GFP MEFs
Sexual mature C57BL/6J female mouse and MF1 carrying Oct4-GFP, 129/sv male mouse are caged according to the proportion of 1 (male parent) to 2 (female parent), the pregnant mouse with 13.5d bolt is dissected to obtain fetal mouse, the head, the limbs and the tail are removed after cleaning, the fetal mouse is digested for 20min in 37 ℃ water bath by 0.5g/L trypsin-0.02% EDTA digestive juice, and the fetal mouse are mixed for several times; adding 0.5g/L trypsin-0.02% EDTA digestive solution, and digesting in water bath at 37 deg.C for 20 min. Blowing, stirring uniformly, adding culture solution to terminate digestion, and centrifuging at 1000rpm for 10 min. Removing supernatant, adding appropriate amount of culture solution, repeatedly beating for about 10 times, placing in T25 culture flask at 37 deg.C and 5% CO2Culturing in an incubator (Oct4-GFP MEFs growth state is shown in figure 4), and after reaching 80% confluence, carrying out 1: 3-1: 5 passages and culture, other cells were primary frozen.
Example 4: establishment of method for efficiently obtaining iPSCs (induced pluripotent stem cells)
1. Electrotransfection of Oct4-GFP MEFs: when the cells reached 80% confluence, they were digested with trypsin-0.02% EDTA at 0.5g/L for 5min at 37 deg.C, the digestion was stopped with an equal volume of medium, the cells were counted and 1X 10 cells were collected6Cells/electroporation system, centrifuge at 1300rpm for 5 min. The supernatant was discarded and the cells were resuspended in 100. mu.L of an electrotransfer solution (Opti-MEM medium containing 1.0. mu.g of TRE-Oct4, 2.0. mu.g of TRE-CKS, 2.0. mu. g R6, 1.0. mu.g of transposase HyBase, and 1.0. mu.g of CAG-rtTA). The cells were then transferred to an electric transfer cup (Sigma) and electric transfer was selectedThe instrument (a) was made of a Lonza,
) Procedure A-023 is electrically stimulated; mu.L of pre-warmed culture medium was added to the cuvette, and the cell suspension was finally inoculated into a previously prepared petri dish for culture. On this basis, the experimental group additionally added 2.0. mu.g of Tale inhibitory transcription factor R6 bound to the first intron of Xist, while the control group added no other vector, or added 2.0. mu.g of Tale inhibitory transcription factor ConR without specific binding site; the CKS in TRE-CKS refers to c-Myc, Klf4 and Sox2, and by comparison, the induction efficiency of the experimental group added with R6 to form iPS clone is obviously higher than that of the control group, wherein the induction efficiency of the experimental group in female is 3.5 times that of the control group, and the induction efficiency of the experimental group in male is 2.5 times that of the control group. (see FIG. 6 and statistics Table for the number of induced iPS clones)
Statistical table of induced iPS clone number
2. Oct4-GFP MEFs transferred into the vector were induced and cultured: the next day after the electrotransfer, the culture medium was changed to fresh M15 culture medium supplemented with 2. mu.g/mL doxycycline (Dox), and the medium was changed every other day. After 14 days, Dox was removed and cultured by changing to 2i medium for 25-30 days (until Oct4-GFP positive clone appeared, see FIG. 5).
3. The Oct4-GFP positive iPSC clones were counted and single clones were picked for establishment: at day 25, microscopic examination, counting and statistics of induction efficiency were carried out under a fluorescence microscope (see FIG. 6), glass microneedles were drawn to pick out Oct 4-GFP-expressing positive cell clones, and 10. mu.L of a pipette was used to transfer the picked iPSC clones into a cell line containing 30. mu.L of 0.5g/L trypsinDigesting in enzyme-0.02% EDTA digestive juice round-bottom 96-well plate at 37 deg.C for 8min, beating several times, adding equal amount of culture solution to stop digestion, inoculating in flat-bottom 96-well plate with trophoblast cells, incubating at 37 deg.C and 5% CO2Culturing in an incubator.
4. Subculturing and culturing iPSCs: and (3) cleaning the newly formed iPSC clone in the 96-well plate once by using DPBS, adding 0.5g/L trypsin-0.02% EDTA digestive juice, digesting for 5min at 37 ℃, stopping digestion after uniformly blowing, and centrifuging for 3min at 1300 rpm. The supernatant was discarded and re-suspended with the culture medium and inoculated into 12-well plates for culture (see FIG. 7 for the growth state of iPSCs).
Example 5: pluripotency identification of the obtained iPSCs
1. Alkaline phosphatase staining (AP staining)
The AP dye solution preparation method comprises the steps of uniformly mixing ① dye solution Sodium nitrate solution (1:50) and FRV-alkalescence solution (1:50) according to the ratio of 1:1, keeping out of the sun for 2min at room temperature, adding ② dye solution naphthalene-AS-BI alkaline solution (1:50) into Embryo water, adding prepared dye solution ② into dye solution ①, fully mixing, keeping out of the sun for standby and preparing at present.
And (3) culturing iPSCs by using a 12-hole plate until the 5 th day, abandoning the culture solution, adding DPBS for washing once, abandoning the DPBS, adding 300 mu L of 4% PFA into each hole, and fixing for 15min at room temperature. After PFA is discarded, the fabric is washed by Embryo water for 2 times, the Embryo water is discarded, 300 mu L of AP dye solution prepared in advance is added, and the fabric is placed for 30 to 60min at room temperature in a dark place. Photographs were observed under a microscope (AP of iPSCs stained strongly positive, see FIG. 8A).
2. immunofluorescent staining of iPSCs
iPS cells were digested and counted, inoculated at 1X 104Cells were plated in eight-well plates and immunofluorescent stained after 4 days in an incubator. Discarding the old culture solution, washing with PBS for 2 times, adding 4% PFA, and fixing at room temperature for 15 min; washing with PBS for 5min for 3 times; adding IF buffer (DPBS containing 1% BSA and 0.1% Triton), and standing at room temperature for 30 min; add I-antibody (Anti-Rat OCT4, Anti-Mouse NANOG) and protect from light overnight at 4 deg.C. Washing with IF buffer for 5min for 3 times; adding II antibody (Donkey Anti-Mouse IgG (H + L) and Goat Anti-Rat IgG), and standing at room temperature in the dark for 1H. Washing with IF buffer for 5min for 3 times; washing with PBS for 1 time; 333Dyeing with 42 dyes in dark for 3 min; washing with PBS for 1 time; and (3) disassembling the eight-hole plate, dripping the mounting liquid, covering a glass slide, and smearing the nail polish on the peripheral edge to finish mounting. Images were taken under confocal laser microscopy (immunofluorescent staining for iPSCs was positive, see fig. 8B).
3. Measurement of differentiation Capacity
① in vivo differentiation experiment, which comprises subculturing iPSCs successfully established until feeder layer cells are removed, digesting and counting cells, and collecting 1 × 10 cells6-2×106The cells were centrifuged at 1300rpm for 3min in a 1.5mL centrifuge tube, the supernatant was discarded, 500. mu.L of DPBS was added to the centrifuge tube to resuspend iPSCs, and the cell suspension was loaded into a 1mL syringe. One immunodeficient mouse was picked up, and the injection site (hind leg root) was wiped with alcohol and then injected subcutaneously (250. mu.L each for the hind legs on both sides). After 8 weeks, obvious tumor tissue was formed, and the separated tumor tissue was fixed in 4% paraformaldehyde, and hematoxylin and eosin staining was performed after tissue section preparation. Finally, the results were observed under a microscope, photographed, and analyzed (iPSCs can be differentiated into three germ layer tissues in vivo, see fig. 8C).
② in vitro differentiation experiment, 10mL of PBS was added to a 100mm dish in advance, iPSCs were digested and counted, and the cell concentration was adjusted to 1X 105one/mL and prepare 30. mu.L droplets on the dish lid using the cell suspension. Carefully turn the capsule over and cover the capsule and place the capsule at 37 ℃ in 5% CO2And (5) suspending in the incubator for culture. The cells can be observed to polymerize to form small spheres, i.e., embryoid bodies, on days 5-7. Transferring the formed embryoid bodies to an eight-well plate, adding 500 μ L M10 culture medium to each well, standing at 37 deg.C and 5% CO2Culturing in an incubator. Observing and changing liquid in the period, observing that the embryoid body diffuses and differentiates around by about 10 days, and carrying out immunofluorescence staining when no green fluorescence exists under the observation of a fluorescence microscope: discarding the culture solution in the eight-hole plate, washing with PBS for 2 times, discarding PBS, adding 4% PFA, standing at room temperature for 15min, and fixing; discarding 4% PFA, washing with washing solution I (PBS + 0.3% Triton) for 3 times, each for 5 min; wash I was discarded, wash II (PBS + 1% BSA + 0.3% Triton) was added and left at room temperature for 30min, primary antibody (AFP, T and NCAM1) was added and incubated overnight in a refrigerator at 4 ℃. AbandonWashing with washing solution I for 3 times (5 min each time) after removing primary antibody, adding secondary antibody (CY3 fluorescence labeled goat anti-rabbit IgG), and standing in dark for 1 h; washing with lotion I for 3 times, 5min each time; DPBS was washed 1 time and stained with DAPI for 15 min. Cleaning the DPBS for 1 time, removing the DPBS, splitting the eight-hole plate, dripping the mounting liquid, covering a glass slide, and smearing nail polish on the peripheral edge to finish mounting. Finally, the cells were observed under a confocal laser microscope and photographed (iPSCs have the ability to differentiate into cells of the three germ layers in vitro, see fig. 8D).
4. Detection of pluripotent gene expression of iPSCs by RT-qPCR
① extraction of total RNA of iPSCs, namely, the extraction of the total RNA of iPSCs is completed by utilizing an RNA extraction kit (Cat. No.74104, QIAGEN), and the concentration and the purity of the collected RNA are measured after the collected RNA is mixed evenly.
② iPSCs cDNA preparation, ice making in advance, melting reagent in the kit on ice, reverse transcription reaction system is 20 muL, which is divided into two parts of 5 muL and 15 muL, 5 muL system comprises 5 mug RNA, 1 muL primer, then preparing 5 muL system with water without nucleic acid, heating at 70 deg.C for 5min, then rapidly ice-cooling for at least 5min, centrifuging in a micro centrifuge for 10s, placing on ice until 15 muL system is added, 15 muL system comprises GoScript 5 Xbuffer solution 4.0 muL, MgCl2(final concentration 1.5-5.0mM) 2.5. mu.L, dNTP 1.0. mu.L, ribonuclease inhibitor 0.5. mu.L, GoScriptTM reverse transcriptase 1.0. mu.L, nucleic acid free water 6. mu.L. Mixing 5 μ L system and 15 μ L system, incubating at 25 deg.C for 5min, and incubating at 42 deg.C for 1 h.
③ Real-time quantitative PCR (RT-qPCR) reaction, melting the reagent in the kit on ice, mixing the sample evenly before using, and then carrying out centrifugal enrichment, wherein the primers used in the qPCR are shown in table 1.1, the reaction system of the qPCR is 20 muL (15 muL Mix I +5 muL Mix II, shown in table 1.2), the reaction conditions are shown in table 1.3, adding the sample into a 96-well plate, recording the sample adding information, sealing a transparent film, then carrying out centrifugation, connecting a computer with an RT-qPCR instrument (Thermo, TCR0096) after the centrifugation is finished, changing the IP address of the computer, opening the PikoReal software, selecting program setting parameters (the parameter setting is shown in table 1.3), and storing and analyzing the data after the RT-qPCR reaction is finished (shown in figure 8E).
TABLE 1.1 primer information required for RT-qPCR (SEQ ID NO.2-SEQ ID NO.15)
TABLE 1.2 RT-qPCR reaction System
Mix I：
| |
1× | 26× |
| SYBR(2×) | 10μL | 260μL |
| cDNA | 1μL | 26μL |
| Nuclear-Free water | 4μL | 104μL |
| 15μL |
Mix II：
| |
1× | 7× |
| Primer F+R(10μM) | 0.8μL | 5.6μL |
| Nuclear-Free water | 4.2μL | 29.4μL |
| 5μL |
TABLE 1.3 RT-qPCR reaction conditions
5. Preparation of chimeric mice
① preparation of microinjection needle, using horizontal microelectrode needle drawing instrument (P-97) to make the needle for micromanipulation, the selection procedure is P500, HEAT 365, PULL 55, VEL 120, TIME 100, the specification of the capillary glass tube used for drawing the ovum holding needle is 1.00mm O.D. × 0.58mm I.D, the specification of the capillary glass tube used for drawing the injection needle is 1.00mm O.D. × 0.78mm I.D, the diameter of the ovum holding needle after drawing is 90-120 μm O.D. × 18-21 μm I.D, and the diameter of the injection needle is 15-18 μm O.D. × 1215 μm I.D.
② obtaining donor blastocyst, which is to perform superovulation treatment on ICR female mouse and cage the ICR female mouse, detect the thrombus on the next day, and select the 3.5-day mouse blastocyst for the donor embryo prepared by chimera, the mouse is killed by breaking the neck in a sterile room for 3.5 days of pregnancy, the abdomen is upward, the mouse is disinfected by alcohol, the mouse is dissected by using ophthalmic scissors and sharp-pointed forceps, the uterus and the oviduct of the mouse are cut off and the fat and the uterine mesentery are removed, the uterus and the oviduct are put in a 60mm flat dish of M2 operating fluid, then the uterus and the oviduct are respectively washed by using the sharp-pointed forceps and a 1mL syringe (the needle is polished by breaking the tip), the needle is pulled by hand under a capillary glass tube alcohol lamp, the embryo is picked out by using a mouth suction tube, after the M2 is washed twice, the KSOM culture fluid is continuously washed twice, and then the KSOM culture fluid is put in a balanced state in advance to be cultured for standby.
③ preparation of chimera mouse, selecting lower generation mouse iPSCs with normal karyotype, inoculating into 6-well plate paved with 0.1% gelatin, culturing, when the confluence degree of cells reaches 70-80%, preparing chimera mouse, discarding culture solution before use, washing DPBS once, digesting with 0.5G/L trypsin-0.02% EDTA digestive solution for 5min, centrifuging at 1300rpm for 3min, discarding supernatant, suspending iPSCs by M2 operating solution, placing the remaining iPSCs in refrigerator at 4 deg.C, preparing a dish cover of 100mm culture dish, making 15 μ L M2 operating drop, covering with mineral oil, transferring digested cells and prepared embryo into operating drop with mouth suction tube to prepare chimera, perforating embryo transparent belt with piezoelectric rupture disk apparatus (Piezoxpert), injecting about 15 iPSCs, injecting into embryo, transferring the embryo into KSOM culture solution, partially injecting embryo into embryo sac, suturing embryo suction tube, injecting embryo into uterine cavity with uterine cavity, injecting embryo into uterine cavity, injecting embryo into uterine cavity, injecting into embryo suction tube, injecting into uterine cavity, injecting embryo, injecting into uterine cavity, injecting into embryo injecting needle, injecting.
The above-mentioned embodiments are only for illustrating the technical ideas and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the contents of the present invention and to carry out the same, and the present invention shall not be limited to the embodiments, i.e. the equivalent changes or modifications made within the spirit of the present invention shall fall within the scope of the present invention.
SEQUENCE LISTING
<110> method for producing induced pluripotent stem cells using Xist Tale inhibitory transcription factor
<120> Nengyusai Corsai livestock breed and breed Biotechnology research institute Co., Ltd
<130>
<160>15
<170>PatentIn version 3.5
<210>1
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> binding site of Xist Tale inhibitory transcription factor R6
<400>1
ttaagtgtta tggacaagga 20
<210>2
<211>24
<212>DNA
<213> mouse (Mus musculus)
<223> upstream primer of DNA sequence of transcription factor Oct4 Gene
<400>2
ctgagggcca ggcaggagca cgag 24
<210>3
<211>24
<212>DNA
<213> mouse (Mus musculus)
<223> downstream primer of DNA sequence of transcription factor Oct4 Gene
<400>3
ctgtagggag ggcttcgggc actt 24
<210>4
<211>25
<212>DNA
<213> mouse (Mus musculus)
<223> upstream primer of DNA sequence of transcription factor Sox2 Gene
<400>4
ggcagctaca gcatgatgca ggagc 25
<210>5
<211>24
<212>DNA
<213> mouse (Mus musculus)
<223> downstream primer of DNA sequence of transcription factor Sox2 gene
<400>5
ctggtcatgg agttgtactg cagg 24
<210>6
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> upstream primer of DNA sequence of transcription factor Nanog gene
<400>6
caggagtttg agggtagctc 20
<210>7
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> downstream primer of DNA sequence of transcription factor Nanog gene
<400>7
cggttcatca tggtacagtc 20
<210>8
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> upstream primer of DNA sequence of transcription factor Esrrb gene
<400>8
cacttgggga ccagatgagc 20
<210>9
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> downstream primer of DNA sequence of transcription factor Esrrb gene
<400>9
cggtacacga tgcccaagat 20
<210>10
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> upstream primer of DNA sequence of transcription factor Prdm4 gene
<400>10
gcatcctggt tcccacagag 20
<210>11
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> downstream primer of DNA sequence of transcription factor Prdm4 gene
<400>11
ctgcagaaca cgccaaagtg 20
<210>12
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> upstream primer of DNA sequence of transcription factor Stella Gene
<400>12
agcgcctttc ccaagagaag 20
<210>13
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> downstream primer of DNA sequence of transcription factor Stella Gene
<400>13
agggtctttc agcaccgaca 20
<210>14
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> upstream primer of DNA sequence of transcription factor Gapdh Gene
<400>14
accacagtcc atgccatcac 20
<210>15
<211>20
<212>DNA
<213> mouse (Mus musculus)
<223> downstream primer of DNA sequence of transcription factor Stella Gene
<400>15
tccaccaccc tgttgctgta 20
Claims (2)
1. A method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor, which comprises the following steps:
1) cell preparation
Obtaining fibroblast MEF of a fetal rat, treating the MEF by mitomycin C, and using the MEF as a feeding layer for inducing and culturing iPSCs; obtaining Oct4-GFP MEFs;
2) obtaining induced pluripotent stem cells
A. Electrotransfection of Oct4-GFP MEF cells: when Oct4-GFP MEF cells reached 80% confluency, they were digested with 0.5g/L trypsin-0.02% EDTA for 5min at 37 deg.C, the digestion was stopped with an equal amount of medium, the cells were counted, and 1X 10 cells were collected6Centrifuging the cells/electrotransfer system at 1300rpm for 5 min; discard the supernatant and resuspend the cells with 100. mu.L of electrotransfer; then the cells are transferred into an electric transfer cup and are electrically stimulated by an electric transfer instrument; to the direction ofAdding 500 mu L of culture solution preheated in advance into an electric rotating cup, and finally inoculating the cell suspension into a culture dish which is prepared in advance and is paved with the feeder layer cells in the step 1) for culture; the 100. mu.L electrotransfer solution is Opti-MEM culture solution containing 1.0. mu.g TRE-Oct4, 2.0. mu.g TRE-CKS, 1.0. mu.g transposase HyBase and 1.0. mu.g CAG-rtTA; on this basis, the experimental group additionally added 2.0. mu.g of Tale inhibitory transcription factor R6 bound to the first intron of Xist, the specific binding sites for R6 are as follows: TTAAGTGTTATGGACAAGGA SEQ ID NO.1, reference gene sequence numbers in GeneBank: NC-000086.7, while control group was supplemented with no other vector, or with 2.0. mu.g of Tale inhibitory transcription factor ConR without specific binding site; CKS in TRE-CKS means c-Myc, Klf4 and Sox 2;
B. induction and establishment of iPSC after electrotransformation: the next day of electrotransfection, the culture solution is changed into fresh M15 culture solution added with 2 mug/mL Dox, and the culture solution is changed every other day; after 14 days, removing Dox, and changing to 2i culture solution for culture till 25-30 days until Oct4-GFP positive clone appears; and (3) performing microscopic examination and counting on the 25 th day under a fluorescent microscope, drawing a glass microneedle to pick out Oct4-GFP positive cell clones, transferring the picked iPSC clones into a round-bottom 96-well plate in which 30 mu L of 0.5g/L trypsin-0.02% EDTA digestive juice is added in advance by using a 10 mu L pipette gun, digesting for 8min at 37 ℃, adding an equal amount of culture solution after blowing and beating for several times to stop digestion, and inoculating the cells into the flat-bottom 96-well plate paved with the feeder cells in the step 1) to culture in a 37 ℃ 5% CO2 incubator until typical iPSC clones are formed.
2. The method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor according to claim 1, wherein the electric rotor is Sigma Z706086-50EA, and Lonza is adopted as the electric rotor,
procedure A-023 is electrically stimulated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611267083.6A CN106754729B (en) | 2016-12-31 | 2016-12-31 | Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611267083.6A CN106754729B (en) | 2016-12-31 | 2016-12-31 | Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754729A CN106754729A (en) | 2017-05-31 |
| CN106754729B true CN106754729B (en) | 2020-03-17 |
Family
ID=58951844
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611267083.6A Active CN106754729B (en) | 2016-12-31 | 2016-12-31 | Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754729B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750000A (en) * | 2017-11-06 | 2019-05-14 | 内蒙古赛科星家畜种业与繁育生物技术研究院有限公司 | Novel animal cell line R6-MEFs method and purposes are prepared using XistTale inhibition transcription factor R6 |
| CN108251377B (en) * | 2018-01-16 | 2021-08-27 | 内蒙古大学 | Method for preparing feeder layer cells by using R6-MEF carrying Xist Tale inhibitory transcription factor R6 |
| CN108715869B (en) * | 2018-06-01 | 2020-12-08 | 华南农业大学 | Method for improving mammal cloning efficiency based on obtaining specific donor cells |
| CN113278686A (en) * | 2021-06-11 | 2021-08-20 | 扬州大学 | Method for researching DNA methylation regulation reprogramming process |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009061442A1 (en) * | 2007-11-06 | 2009-05-14 | Children's Medical Center Corporation | Method to produce induced pluripotent stem (ips) cells form non-embryonic human cells |
| CN103380212A (en) * | 2010-12-22 | 2013-10-30 | 菲特治疗公司 | Cell culture platform for single cell sorting and enhanced reprogramming of IPSCs |
| WO2015134652A1 (en) * | 2014-03-04 | 2015-09-11 | Bahram Valamehr | Improved reprogramming methods and cell culture platforms |
-
2016
- 2016-12-31 CN CN201611267083.6A patent/CN106754729B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009061442A1 (en) * | 2007-11-06 | 2009-05-14 | Children's Medical Center Corporation | Method to produce induced pluripotent stem (ips) cells form non-embryonic human cells |
| CN103380212A (en) * | 2010-12-22 | 2013-10-30 | 菲特治疗公司 | Cell culture platform for single cell sorting and enhanced reprogramming of IPSCs |
| WO2015134652A1 (en) * | 2014-03-04 | 2015-09-11 | Bahram Valamehr | Improved reprogramming methods and cell culture platforms |
Non-Patent Citations (4)
| Title |
|---|
| Xist Intron 1 Repression by Transcriptional-Activator-Like Effectors Designer Transcriptional Factor Improves Somatic Cell Reprogramming in Mice;JINDUN ZHANG等;《Stem Cells》;20180202;第37卷;第599-608页 * |
| Xist Tale R-dTFs来源的小鼠iPS细胞系的建立及多能性鉴定;梁延峰;《中国优秀硕士学位论文全文数据库 基础科学辑》;20170215(第02期);第A006-52页 * |
| Xist Tale R-dTFs来源的小鼠iPS细胞系的建立及多能性鉴定;梁延峰等;《中国畜牧兽医学会动物繁殖学分会第十八届学术研讨会暨中日韩第四届动物繁殖学术交流会》;20160818;第148页 * |
| 利用结合Xist第一内含子的Tale-dTF建立R6-MEF细胞系;翁雷;《中国优秀硕士学位论文全文数据库 基础科学辑》;20180115(第01期);第A006-18页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754729A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2552288C (en) | Novel culture systems for ex vivo development | |
| CN106754729B (en) | Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor | |
| JP5312804B2 (en) | Method for purifying stem cells, fetal cardiomyocytes and planned cardiomyocytes | |
| US8673633B2 (en) | Method for producing induced pluripotent stem cells with high efficiency and induced poluripotent stem cells prouced thereby | |
| Martinez-Fernandez et al. | c-MYC-independent nuclear reprogramming favors cardiogenic potential of induced pluripotent stem cells | |
| Zhu et al. | Transient in vitro epigenetic reprogramming of skin fibroblasts into multipotent cells | |
| CN101984050B (en) | Cell type used for producing induced pluripotent stem (iPS) cells and preparation method and application thereof | |
| WO2017097007A1 (en) | Differentiation medium and use thereof in preparation of neural stem cells | |
| CN113881624A (en) | Cell induction method | |
| Takada et al. | Monkey embryonic stem cell lines expressing green fluorescent protein | |
| CN114276984B (en) | Method for transdifferentiating female germ stem cells into functional sperm and application | |
| CN112608904B (en) | Method for efficiently and rapidly reprogramming somatic cells into neural stem cells and application thereof | |
| Li et al. | Using microRNAs to enhance the generation of induced pluripotent stem cells | |
| CN102533764A (en) | Figla gene promoter sequence, marking carrier built by same and application | |
| CN106282097A (en) | Induced multi-potent stem cell, the method preparing induced multi-potent stem cell | |
| CN101955910A (en) | Method for inducing porcine induced pluripotent stem cells | |
| JP5249789B2 (en) | Hair forming method and biological material | |
| Nie et al. | Reprogramming mature terminally differentiated adipocytes to induced pluripotent stem cells | |
| Dye | Developmental Cell Biology | |
| Li et al. | Research of blastocyte-like structure in chicken | |
| CN101671650B (en) | Inducible reprogramming method for efficiently inducing inducible pluripotent stem cell | |
| Zheng LiMing et al. | The state and application of livestock pluripotent stem cells. | |
| CN102586174A (en) | Pluripotent cell derived from cataract mouse model, its preparation method and application | |
| CN111440771A (en) | C L CN2 homozygous mutation-containing white matter encephalopathy patient specific induced pluripotent stem cell line | |
| Wang et al. | Nuclear reprogramming by nuclear transplantation and defined transcription factors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180712 Address after: 011517 the Inner Mongolia Autonomous Region Hohhot Sheng Le modern service industry gathering area, No. 1, cloud Valley Road East, Sai Kok sing headquarters Research Institute Applicant after: INNER MONGOLIA SAIKEXING LIVESTOCK BREEDING AND SEED INDUSTRY BIOTECHNOLOGY RESEARCH INSTITUTE CO., LTD. Applicant after: Inner Mongolia saikexing reproductive biotechnology (Group) Limited by Share Ltd Address before: 011517 the Inner Mongolia Autonomous Region Hohhot Sheng Le modern service industry gathering area, No. 1, cloud Valley Road East, Sai Kok sing headquarters Research Institute Applicant before: INNER MONGOLIA SAIKEXING LIVESTOCK BREEDING AND SEED INDUSTRY BIOTECHNOLOGY RESEARCH INSTITUTE CO., LTD. |
|
| TA01 | Transfer of patent application right | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Xihe Inventor after: Zhang Jindun Inventor after: Liu Pengtao Inventor after: Wang Xianxin Inventor after: Han Hongmei Inventor before: Zhang Jindun Inventor before: Li Xihe Inventor before: Liu Pengtao Inventor before: Liang Yanfeng Inventor before: Fan Lihong Inventor before: Han Hongmei |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |