CN102533764A - Figla gene promoter sequence, marking carrier built by same and application - Google Patents
Figla gene promoter sequence, marking carrier built by same and application Download PDFInfo
- Publication number
- CN102533764A CN102533764A CN2011104498578A CN201110449857A CN102533764A CN 102533764 A CN102533764 A CN 102533764A CN 2011104498578 A CN2011104498578 A CN 2011104498578A CN 201110449857 A CN201110449857 A CN 201110449857A CN 102533764 A CN102533764 A CN 102533764A
- Authority
- CN
- China
- Prior art keywords
- figla
- gene
- stem cells
- cell
- promoter sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a figla gene promoter sequence, a marking carrier built by the same and application. Bioinformatic analysis results prompt that a core promoter area is contained in a -856bp to +69bp area of a figla gene and participates in transcriptional regulation of genes. An experimental result shows that the promoter sequence can start expression of a downstream marking gene-enhanced green fluorescent protein (EGFP) after pluripotent stem cells are differentiated towards female generative cells. Furthermore, EGFP regulated and controlled by the promoter sequence is marked and serves as a screening marker for the pluripotent stem cells to be differentiated into the female generative cells.
Description
Technical field
The invention belongs to biological technical field, relate to in-vitro multiplication, differentiation, the separation of stem cell animal, particularly the labeled vector of Figla gene promoter sequence and structure thereof and application.
Background technology
The research of the generation of stem cell and sexual cell, propagation, differentiation is one of important topic of life science.In the animal reproduction breeding, high yield, the fine heredity sexual cell that places one's entire reliance upon is accomplished; The mankind, because female sex cell---the Infertility that the generation of ovum, dysmaturity etc. cause perplexs numerous patients' a realistic problem especially; In fundamental research, ovum is one of the most important research object of developmental biology research especially; Therefore the generation of female reproduction, the research of differentiation have great importance in livestock industry production and biomedical research.Yet the generation of higher mammal ovocyte, transfer, differentiation are accomplished fully in vivo; Therefore be difficult to dynamic real-time ground and detect and study molecular events (Hua J wherein; Sidhu KS.Recent advances in the derivation of germ cells from the embryonic stem cells [J] .Stem Cells and Development; 2008,17:399-411.).
Stem cell is one type and has self, the highly propagation and the cell colony of multidirectional differentiation potential.Embryonic stem cell (ES cell or ESCs) is to be separated and next multipotent stem cells by body early embryo inner cell mass (ICM) or archeocyte (PGCs).Because unique biological characteristics of embryonic stem cell; Make embryonic stem cell at cell replacement treatment, histoorgan reparation and reconstruction, gene therapy and developmental biology model, new drug development and toxicological experiment etc., nearly all life science and biomedicine field all have great importance.In recent years, scientist has also obtained the multipotent stem cells of similar embryonic stem cell from methods such as multiple source and the transfections of employing foreign gene.Can the cell of the used ES of having cell characteristics be commonly referred to as multipotent stem cells.
In recent years, (H ü bner K, Fuhrmann G such as H ü bner; Christenson LK et al.Derivation of oocytes from mouse embryonic stem cells [J] .Science, 2003,300:1251-1256.); (Toyooka Y, Tsunekawa N, Akasu R et al.Embryonicstem cells can form germ cells in vitro [J] .Proc Natl Acad Sci USA such as Toyooka; 2003,100:11457-11462.), (Geijsen N such as Geijsen; Horoschak M; Kim K et al.Derivation of embryonic germ cells and male gametes from embryonic stem cells [J] .Nature, 2004,427:148-154.) on " Science " and international top magazines such as " Nature ", being reported in the ES cytodifferentiation respectively is in embryoid (EBs) and the further process of differentiation thereof; There is the reproductive tract cell, further even possibly be divided into ovocyte or sperm.(Lacham-Kaplan O such as Lacham-kaplan; Chy H; Trounson A.Testicular cell conditioned medium supports differentiation of embryonic stem cells into ovarian structures containing oocytes [J] .Stem Cells; 2006; 24:266-273.) cultivate the EBs in ES cells source with newborn rat testicular cell conditioned medium, it is further grown for containing the ovary spline structure of ovocyte, expresses ovocyte specificity markers such as Figl α and ZP3.Find that male mice ES cell both possibly be divided into sperm and also possibly be divided into ovocyte (Kerkis A under vitamin A acid (RA) is induced; Fonseca SA; Serafim RC et al.In vitro differentiation of male mouse embryonic stem cells into both presumptive sperm cells and oocytes [J] .Cloning Stem Cells; 2007,9:535-548.).(Chen HF such as Chen; Kuo HC; Chien C-L et al.Derivation; Characterization and differentiation of human embryonic stem cells:comparing serum-containing versus serum-free media and evidence of germ cell differentiation [J] .Human Reproduction; 2007,22:567-577.) find that human ES cell is at the spontaneous ovocyte spline structure that is divided into of external possibility.(Hua J such as Hua; Sidhu KS.Coaxing hESC to form oocyte-like structures by co-culture with testicular extract and hormones [J] .The Open Stem Cell Journal; 2011; 3:34-45.) use the testis extract to combine reproductive hormone to induce human ES cell to break up to sexual cell, can obtain the cell that some have the ovocyte mark.Yet existing report inducing pluripotent stem cells breaks up the especially limited amount of ovocyte differentiation to sexual cell, poor repeatability, and wherein very important reasons is to lack special selection markers.Cause inducing process long, effect is unstable, therefore is difficult in the inside and outside and deeply inquires into relevant cell factor, microenvironment and some key genes in effect and the mechanism of stem cell in sexual cell growth atomization.
Discover; The reproductive tract a factor (Figla) is the transcription factor of first sexual cell specifically expressing; Key gene in the early stage follicular development is regulated and control, and can directly influence formation (Choi Y, Rajkovic A.Genetics of early mammalian folliculogenesis [J] the .Cellular and Molecular Life Sciences of primordial follicle; 2006,63 (5): 579-590; Soyal S M, Amleh A, Dean J.FIG α, a germ cell-specific transcription factor required for ovarian follicle formatiaon [J] .Development, 2000,127:4645-4654.).The Figla of mouse can find in the sex-ridge of the female embryo of 13.5d the earliest; And continuous expression in the growth course of ovarian follicle and sexual cell bunch; Formation for Zp expression of gene, zona pellucida has regulating effect (Huntriss J; Gosden R, Hinkins M et al.Isolation, characterization and expression of the human Factor In the Germline alpha (FIGLA) gene in ovarian follicles and oocytes [J] .Molecular Human Reproduction; 2002,8 (12): 1087-1095.).For female embryo, lack migration and propagation that Figla can not influence sexual cell, sex-ridge also can normally form appearance, the disappearance but the back ovocyte of being born can be degenerated rapidly can not form primordial follicle.And knock out the Figla gene and can cause infertile (the Liang L of female mouse; Soyal SM; Dean J.FIG α; A germ cell specific transcription factor involved in the coordinate expression of the zona pellucida genes [J] .Development, 1997,124:4939-4949.).Human Figla disappearance or sudden change may cause the development of ovary or oocyte maturation obstacle in various degree; Impel Premature Ovarian Failure (POF), infertile generation (Suzumori N; Pangas SA; Rajkovic A et al.Candidate genes for premature ovarian failure [J] .Current medicinal chemistry, 2007,14 (3): 353-357; Van Dooren MF; Bertoli-Avella AM; Oldenburg RA.Premature ovarian failure and gene polymorphisms [J] .Current opinion in obstetrics & gynecology, 2009,21 (4): 313-317.).
Summary of the invention
The problem that the present invention solves is the labeled vector and the application of Figla gene promoter sequence and structure thereof, makes up the marker gene that comprises the Figla gene promoter sequence, for multipotent stem cells provides new selection markers to the ovocyte differentiation.
The present invention realizes through following technical scheme:
A kind of Figla gene promoter sequence, its nucleotide sequence is shown in SEQ.ID.NO.1.
Marker gene based on the Figla gene promoter sequence makes up connects the fluorescent mark gene in the downstream of the Figla gene promoter sequence shown in the SEQ.ID.NO.1.
The described marker gene that makes up based on the Figla gene promoter sequence also connects the antibiotic-screening gene in the downstream of fluorescent mark gene.
A kind of expression vector that makes up based on the Figla gene promoter sequence; Comprise the Figla gene promoter sequence shown in the SEQ.ID.NO.1; Connect fluorescent mark gene EGFP in the downstream of Figla gene promoter sequence, connect antibiotic-screening gene neor in the downstream of EGFP.
The described expression vector that makes up based on the Figla gene promoter sequence is the pFigla-EGFP expression vector, through SalI and BamHI restriction enzyme site the Figla gene promoter is cloned into the pEGFP-1 expression vector.
The Figla gene promoter sequence carries transfection multipotent stem cells behind the fluorescent mark gene, induces the application of the selection markers that is divided into female sex cell as multipotent stem cells with it.
A kind of multipotent stem cells may further comprise the steps to the screening and the separation purification method of female sex cell differentiation:
1) the Figla gene promoter sequence of clone shown in SEQ.ID.NO.1, and the Figla gene promoter sequence is cloned into the pEGFP-1 expression vector through SalI and BamHI restriction enzyme site with the Figla gene promoter, obtain the pFigla-EGFP expression vector;
2) will treat that the multipotent stem cells of transfection and pFigla-EGFP expression vector hatch jointly, with the transfection of pFigla-EGFP expression vector among multipotent stem cells;
Go down to posterity behind the transfection 48h, use the clone of the nutrient solution screening G418 resistance comprise 200 μ g/mL G418, screened for 2 weeks after, the multipotent stem cells clone who obtains having the G418 resistance;
The multipotent stem cells that 3) will be in the G418 resistance of logarithmic phase is blown and beaten into single cell suspension with tryptic digestion; Remove feeder layer cells with the differential adherent method; With inducing the resuspended multipotent stem cells of basal liquid; Transfer in the not adherent ware and cultivate 2～3d, then it is transferred to the shop with in the culture plate of gelatin, add the adherent 5～6d that induces of 0.1 μ mol/L vitamin A acid;
Inducing basal liquid is the foetal calf serum of non-essential amino acid+15% volumetric concentration of H-DMEM substratum+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% volumetric concentration;
After inducing 5～6d, be purified into the GFP positive cell through selected by flow cytometry apoptosis, carry out the detection of reproduction expression of specific gene through RT-PCR, the GFP positive cell of screening is the female sex cell of differentiation.
Described going down to posterity handled on the Tissue Culture Plate of 2～5 generation mouse fetal inoblasts as feeder layer of 2h 37 ℃, 5% CO for multipotent stem cells being inoculated into 10 μ g/mL ametycins
2Cultivate under the saturated humidity condition, treat to go down to posterity when clonal expansion to 65～70% o'clock merges;
Nutrient solution is the FBS of non-essential amino acid+10ng/mL LIF+15% volumetric concentration of H-DMEM nutrient solution+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% volumetric concentration.
Described multipotent stem cells comprises the multipotent stem cells with embryonic stem cell characteristic in embryonic stem cell, induction type multipotent stem cells or adult tissue source.
Compared with prior art, the present invention has following beneficial technical effects:
1, the invention provides the sequence of the promoter region of Figla gene, FirstEF online analyzes and should have 1 CpG island in the zone, be positioned at-155～-58bp.Bioinformatic analysis results suggest Figla gene-856bp possibly comprise the core promoter zone of Figla gene and participate in the gene transcription regulation and control to+69bp zone.Experimental result shows that this promoter sequence can start the expression of downstream gene after multipotent stem cells is divided into female sex cell.Further, can this promoter sequence be divided into the selection markers of female reproduction stem cell as multipotent stem cells after with fluorescent protein gene markers.
2, the present invention has made up the pFigla-EGFP expression vector; With pFigla-EGFP transfection mouse ovarian primary cell; Marker gene GFP (fluorescent green protein) expresses; And transfection MEF cell is not found the GFP positive cell, shows that this expression vector has the advantages that the female sex cell specificity starts, and is that a kind of promotor specificity starts the carrier of expressing.
3, the present invention has made up the mES clone of carrying pFigla-EGFP with pFigla-EGFP transfection mESCs, and the growth characteristics of this mESCs do not change, and the clone is fine and close; The edge is smooth, is the alkaline phosphatase enzyme positive, expresses versatility marker gene Oct4; Sox2, Klf4, Nanog and C-myc.Suspension culture 3d can form EBs, has the triploblastica differentiation potential, can form teratoma.
4, the mESCs that carries pFigla-EGFP can carry out vitro differentiation, the EBs of suspension culture 3d is moved in the petridish that is covered with gelatin, most EBs can be in 24h adherent growth.Induce through RA, during the 2nd～3d, around the EBs outgrowth, more round cell occurs, volume is bigger, is the class archeocyte.Under fluorescent microscope, can be observed parts of fine cellular expression GFP this moment; Find that through immunofluorescence dyeing the GFP positive cell is expressed sexual cell marker gene Vasa and reduction division specific gene Scp3 simultaneously, during 6d; Be purified into GFP positive cell (5.2%) through selected by flow cytometry apoptosis; Carry out RT-PCR and detect, find it and express Figla and GFP, and control group is not expressed.Reproduction specific gene Vasa, reduction division specific gene Scp3 and Stra8, and female sex cell specific gene Figla and Zp3 are significantly higher than undifferentiated mESCs in the expression of GFP positive cell.
5, the mESCs that carries pFigla-EGFP can carry out differentiation in the body, and under the microenvironment of cultivating altogether with gonad cell, the mESCs that carries pFigla-EGFP can break up to sexual cell in vivo.Paraffin organization section immunofluorescence dyeing shows; In graft, there is the GFP positive cell, and expresses Vasa, the marker gene of sexual cell such as Stra8 and Scp3 simultaneously; But the part mESCs differentiation and development class ovocyte that to be volume bigger is expressed Figla and Zp3.
Description of drawings
Fig. 1 is a Figla gene promoter area structural representation;
Fig. 2 is the plasmid map of recombinant plasmid pFigla-EGFP;
Fig. 3 is that SalI and BamHI double digestion are identified positive recombinant plasmid pFigla-EGFP;
Fig. 4-1～4-2 is respectively the expression of results of the reporter gene of fluorescence microscope recombinant plasmid pFigla-EGFP at MEF and ovary primary cell;
Fig. 5 is the mESCs microscopic examination figure of transfection pFigla-EGFP;
Fig. 6-the 1st, the microscopic examination of the EBs that the mESCs of transfection pFigla-EGFP forms, Fig. 6-2 is the detected result figure of the agarose gel electrophoresis after its triploblastica gene of amplification;
Fig. 7-the 1st, the fluorescence microscope transfection expression of results of the mESCs of the pFigla-EGFP reporter gene GFP after inducing; Fig. 7-the 2nd, the detected result figure of the agarose gel electrophoresis after the GFP gene amplification of its mRNA;
Fig. 8 is the immunofluorescence dyeing expression of results of GFP and sexual cell marker gene after the mESCs vitro differentiation of pFigla-EGFP that shown transfection;
Fig. 9 be to transfection the mESCs of the pFigla-EGFP result that carries out the fluidic cell sorting after inducing;
Figure 10 is the result that the sexual cell marker gene of the GFP positive cell of quantitative PCR detection selected by flow cytometry apoptosis is expressed;
The expression of results of GFP and sexual cell marker gene after the interior differentiation of mESCs body of pFigla-EGFP that Figure 11 has been immunofluorescence dyeing demonstration transfection.
Embodiment
Enforcement illustration below in conjunction with concrete is done further detailed description to the present invention, and said is to explanation of the present invention rather than qualification.
1, the clone of Figla gene promoter sequence
1) Figla gene 5 ' end control region bioinformatic analysis
First base A with Figla gene translation initiator codon ATG is+1, chooses the dna fragmentation of 5 ' end upper reaches 2000bp and uses sequence as the analysis of CpG island, transcription initiation site analysis, promoter Analysis and transcription factor binding site point analysis.And (Promoter 2.0, and Promoter ScanII BDGP) obtains the gene promoter area data message to utilize online promoter Analysis software.
Promoter 2.0 Prediction (http://www.cbs.dtu.dk/services/Promoter/) prediction Figla genetic transcription initiation site is positioned at-300bp;
PROMOTER SCAN (http://thr.cit.nih.gov/molbio/proscan/) Query Result shows that there is conservative potential transcription factor binding site point in above-mentioned Figla gene control region; Comprise AP-2, T-Ag, Sp1; USF and RXR-α, the structural representation of Figla promoter region is as shown in Figure 1.
FirstEF online (http://rulai.cshl.org/tools/FirstEF/) analyzes and should have 1 CpG island in the zone, be positioned at-155～-58bp (referring to Fig. 1);
Comprehensive above-mentioned each bioinformatic analysis result, prompting-856bp possibly comprise the core promoter zone of Figla gene to the+69bp zone and participate in gene transcription and regulate and control.
2) Figla promoter region reporter gene vector construction
Utilize the design amplification of Primer Premier 5.0 primer-design softwares comprise promotor-sequence between 856bp zone and the+69bp zone, design upstream and downstream primer is also selected suitable restriction enzyme, specifically designs following primer:
Upstream primer: 5 ' CG
GTCGACCCCCATCTAGCCTCCACACG 3 '
Downstream primer: 5 ' GC
GGATCCGTCAAGACCACGGGCAGCAG 3 '
The line part is the SalI restriction enzyme site in the upstream primer, and underscore partly is the BamHI restriction enzyme site in the downstream primer;
Figla gene PCR amplification reaction system is 15 μ L, comprising: 10 * buffer, 1.5 μ L, MgCl
2(25mmol/L) 1.6 μ L, dNTP (2.5mmol/L) 1.2 μ L, Taq archaeal dna polymerase 0.1 μ L; Each 0.3 μ L of upstream and downstream primer (10 μ mol/L); 0.5 μ L mouse gene group DNA (genome extracts the mouse skin tissue that test kit extracts, and obtains genomic dna as template), ddH
2O9.5 μ L.
Response procedures: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 30s, 62 ℃ of annealing 30s, 72 ℃ are extended 45s, and totally 35 circulations are mended extension 10min, 4 ℃ of preservations for last 72 ℃.
Reclaim and purified pcr product, obtain the Figla promoter fragment, then PCR product, pEGFP-1 carrier for expression of eukaryon are connected with behind SalI and the BamHI double digestion respectively, it is cloned into the pEGFP-1 carrier for expression of eukaryon, construction recombination plasmid pFigla-EGFP.
Recombinant vectors pFigla-EGFP is carried out SalI and the evaluation of BamHI double digestion, and product occurs specific band through 1% agarose gel electrophoresis at 925bp and 4130bp place.
The plasmid map of constructed pFigla-EGFP carrier is as shown in Figure 2, can see that the Figla promoter sequence is connected with the EGFP green fluorescence protein gene afterwards, and have antibiotic-screening gene nero.
The SalI of pFigla-EGFP carrier and BamHI double digestion qualification result can be seen the Figla promotor target fragment and the remaining pEGFP-1 carrier framework of being cloned into shown in 3.
Obtain the Figla promoter sequence after the order-checking, nucleotide sequence is shown in SEQ.ID.NO.1.
2, the specificity of Figla promoter sequence starts
With pFigla-EGFP transfection mouse ovarian cell of former generation; Reporter gene GFP (fluorescent green protein) expresses (shown in Fig. 4-2), and transfection MEF does not find GFP positive cell (shown in Fig. 4-1); Show that the promotor specificity starts expression, promoter vector makes up successfully.Transfection method is: treat transfection former generation the mouse ovarian cell and MEF with 1 * 10
5Density be inoculated in 6 orifice plates and cultivate, behind the 24h according to the TurboFect of Fermentas company
TMThe transfection specification sheets carries out the transfection of pFigla-EGFP recombinant plasmid.6 μ g plasmids are added in the 1ml opti-MEM nutrient solution, add 12 μ l TurboFect transfection reagents again, gentle mixing.Behind the incubated at room 20min, the TurboFect/DNA mixture is evenly added in the petridish.3-4h after the transfection is replaced by the foetal calf serum of H-DMEM+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% non-essential amino acid+15% volumetric concentration.
3, the transfection of the cultivation of mESCs and pFigla-EGFP
1) cultivation of mouse embryo stem cell (mESCs) and transfection pFigla-EGFP
Mouse embryo stem cell (mESCs) is inoculated into handles 2～5 generation mouse fetal inoblasts (MEF) of 2h with 10 μ g/mL ametycins (density is 1～2 * 10 as feeder layer
5On individual/mL) Tissue Culture Plate, 37 ℃, 5%CO
2Cultivate in the saturated humidity incubator, treat to go down to posterity when mESCs clonal expansion about 70% merges;
The nutrient solution composition is the foetal calf serum of H-DMEM+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% non-essential amino acid+10ng/mL LIF+15% volumetric concentration;
The mESCs cell of treating transfection is with 1 * 10
5Density be inoculated in 6 orifice plates and cultivate, behind the 24h according to the TurboFect of Fermentas company
TMThe transfection specification sheets carries out the transfection of pFigla-EGFP recombinant plasmid.Be specially: 6 μ g plasmids are added in the 1ml opti-MEM nutrient solution, add 12 μ l TurboFect transfection reagents again, gentle mixing.Behind the incubated at room 20min, the TurboFect/DNA mixture is evenly added in the petridish.3-4h after the transfection is replaced by H-DMEM+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% non-essential amino acid+10ng/mL LIF+15%FBS and is cultivated.
Go down to posterity behind the transfection 48h, the cell after using 200 μ g/mL G418 to transfection screens, and screens to obtain G418 resistance clone (3 generations before screening 2 weeks; A large amount of necrocytosiss are arranged, and colony is not fine and close yet, along with continuing screening; Dead cell reduces, and the colony form is approaching with wild-type ESCs gradually: colony protuberance, cell are arranged closely; Ovalize or nest like, clear-cut margin, refractivity is strong).
96 orifice plates are inoculated with individual cells in G418 resistance clone digestion back, obtain the mESCs of the monoclonal pFigla-EGFP of carrying recombinant plasmid after the amplification cultivation.The mESCs microscopic examination figure of transfection pFigla-EGFP is as shown in Figure 5.
4, carry pFigla-EGFP mouse embryo stem cell (mESCs) induce differentiation
The mESCs that will be in the logarithmic phase reorganization blows and beats into single cell suspension with 0.05% tryptic digestion; Remove the MEF feeder layer cells with the differential adherent method, the centrifugal 5min of 1500r/min is with inducing the resuspended ESCs of basal liquid; Transfer in the not adherent ware and cultivate 3d, to form embryoid (EBs); Most EBs can be in 24h adherent growth.Along with the prolongation of incubation time, the cell around the EBs is grown to external transmigration gradually; Fig. 6-the 1st, the microscopic examination of the EBs that the mESCs of transfection pFigla-EGFP forms, Fig. 6-2 is the detected result figure of the agarose gel electrophoresis after its triploblastica gene of amplification;
The induced liquid composition is the foetal calf serum of H-DMEM nutrient solution+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% non-essential amino acid+15% volumetric concentration;
The EBs that will pass through behind the suspension culture 3d changes over to and is covered with in 48 well culture plates that 0.1% gelatin shop attaches to inhale embryonic tube, adds adherent the inducing of vitamin A acid (RA).
Induce through RA, during the 2nd～3d, more round cell around the EBs outgrowth, occurs; Volume is bigger, is the class archeocyte, under fluorescent microscope, can be observed parts of fine cellular expression GFP this moment; Specifically shown in Fig. 7-1; Because Figla specificly starts expression at female sex cell, the EGFP gene is expressed just shows it is that the Figla promoter sequence has started the EGFP expression of gene, and the cell that sends fluorescence so is exactly the female sex cell that has broken up; Fig. 7-the 2nd, the GFP of its mRNA level (upstream primer: gacgggaactacaagacacg; Cgaaagggca gattgtgtg) and Figla (upstream primer: ctctgctgcc cgtggtctt, downstream primer: the detected result figure of the agarose gel electrophoresis after gene amplification ctgctctgtg gtagaaacgg c) downstream primer:; Result's demonstration is expressed Figla and GFP through the RA inducing cell, and does not express Figla and GFP as the mESCs group of not sending fluorescence of contrast.
Further carry out immunofluorescence dyeing for the GFP positive cell, the result shows that the GFP positive cell expresses sexual cell marker gene Vasa and reduction division specific gene Scp3 (referring to Fig. 8) simultaneously;
When RA induces 6d, be purified into 5.2% GFP positive cell through selected by flow cytometry apoptosis, its concrete result is shown in 9, and the result shows mESCs after inducing to sexual cell, and 5.2% cell has started the Figla expression of gene; Further carrying out RT-PCR detects; Find reproduction specific gene Vasa; Reduction division specific gene Scp3 and Stra8, and female sex cell specific gene Figla and Zp3 be significantly higher than undifferentiated mESCs in the expression of GFP positive cell, above-mentioned detected result is shown in figure 10.
This shows that the mESCs that carries pFigla-EGFP can carry out vitro differentiation, and can be divided into the class female sex cell that GFP expresses.These express the cell expressing sexual cell specific gene of GFP, confirm GFP positive cell type of being female sex cell.
5, carry interior transplanting of body of the mESCs of pFigla-EGFP
The mESCs that digestion is collected and former generation the mouse ovarian cytomixis, centrifugal formation cell mass, move to 6～8 age in week the busulfan drug-treated mouse left side kidney tunicle under, put to death mouse after 1 month, collect the cell mass of transplanting.
The cell mass of transplanting shows through paraffin organization section statining and immunofluorescence dyeing; In graft, there is the GFP positive cell, and expresses Vasa simultaneously, Stra8 and Scp3; But the part mESCs differentiation and development class ovocyte that to be volume bigger is expressed Figla and Zp3.Can break up to female sex cell under the microenvironment that the mESCs that shows transfection pFigla-EGFP cultivates with gonad cell in vivo altogether, above-mentioned detected result is shown in figure 11.
Claims (9)
1. a Figla gene promoter sequence is characterized in that nucleotide sequence is shown in SEQ.ID.NO.1.
2. a marker gene that makes up based on the Figla gene promoter sequence is characterized in that, connects the fluorescent mark gene in the downstream of the Figla gene promoter sequence shown in the SEQ.ID.NO.1.
3. the marker gene that makes up based on the Figla gene promoter sequence as claimed in claim 2 is characterized in that, also connects the antibiotic-screening gene in the downstream of fluorescent mark gene.
4. expression vector that makes up based on the Figla gene promoter sequence; It is characterized in that; Comprise the Figla gene promoter sequence shown in the SEQ.ID.NO.1; Connect fluorescent mark gene EGFP in the downstream of Figla gene promoter sequence, connect antibiotic-screening gene neor in the downstream of EGFP.
5. the expression vector that makes up based on the Figla gene promoter sequence as claimed in claim 4; It is characterized in that; This expression vector is the pFigla-EGFP expression vector, through SalI and BamHI restriction enzyme site the Figla gene promoter is cloned into the pEGFP-1 expression vector.
6.Figla gene promoter sequence carries transfection multipotent stem cells behind the fluorescent mark gene, induces the application of the selection markers that is divided into female sex cell as multipotent stem cells with it.
7. a multipotent stem cells is characterized in that to screening and separation purification method that female sex cell breaks up, may further comprise the steps:
1) the Figla gene promoter sequence of clone shown in SEQ.ID.NO.1, and the Figla gene promoter sequence is cloned into the pEGFP-1 expression vector through SalI and BamHI restriction enzyme site with the Figla gene promoter, obtain the pFigla-EGFP expression vector;
2) will treat that the multipotent stem cells of transfection and pFigla-EGFP expression vector hatch jointly, with the transfection of pFigla-EGFP expression vector among multipotent stem cells;
Go down to posterity behind the transfection 48h, use the clone of the nutrient solution screening G418 resistance comprise 200 μ g/mL G418, screened for 2 weeks after, the multipotent stem cells clone who obtains having the G418 resistance;
The multipotent stem cells that 3) will be in the G418 resistance of logarithmic phase is blown and beaten into single cell suspension with tryptic digestion; Remove feeder layer cells with the differential adherent method; With inducing the resuspended multipotent stem cells of basal liquid; Transfer in the not adherent ware and cultivate 2～3d, then it is transferred to the shop with in the culture plate of gelatin, add the adherent 5～6d that induces of 0.1 μ mol/L vitamin A acid;
Inducing basal liquid is the foetal calf serum (FBS) of non-essential amino acid+15% volumetric concentration of H-DMEM substratum+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% volumetric concentration;
After inducing 5～6d, be purified into the GFP positive cell through selected by flow cytometry apoptosis, carry out the detection of reproduction expression of specific gene through RT-PCR, the GFP positive cell of screening is the female sex cell of differentiation.
8. multipotent stem cells as claimed in claim 7 is to the screening and the separation purification method of female sex cell differentiation; It is characterized in that; Described going down to posterity handled on the Tissue Culture Plate of 2～5 generation mouse fetal inoblasts as feeder layer of 2h 37 ℃, 5%CO for multipotent stem cells being inoculated into 10 μ g/mL ametycins
2Cultivate under the saturated humidity condition, treat to go down to posterity when clonal expansion to 65～70% o'clock merges;
Nutrient solution is the FBS of non-essential amino acid+10ng/mL LIF+15% volumetric concentration of H-DMEM nutrient solution+0.1mmol/L beta-mercaptoethanol+2mmol/L L-glutaminate+1% volumetric concentration.
9. multipotent stem cells as claimed in claim 7 is to the screening and the separation purification method of female sex cell differentiation; It is characterized in that described multipotent stem cells comprises the multipotent stem cells with embryonic stem cell characteristic in embryonic stem cell, induction type multipotent stem cells or adult tissue source.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104498578A CN102533764A (en) | 2011-12-19 | 2011-12-19 | Figla gene promoter sequence, marking carrier built by same and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104498578A CN102533764A (en) | 2011-12-19 | 2011-12-19 | Figla gene promoter sequence, marking carrier built by same and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102533764A true CN102533764A (en) | 2012-07-04 |
Family
ID=46341796
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104498578A Pending CN102533764A (en) | 2011-12-19 | 2011-12-19 | Figla gene promoter sequence, marking carrier built by same and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102533764A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107828826A (en) * | 2017-12-12 | 2018-03-23 | 南开大学 | A kind of external method for efficiently obtaining NSC |
| CN114276984A (en) * | 2021-12-31 | 2022-04-05 | 上海交通大学 | Method for transdifferentiation of female reproductive stem cells into functional sperms and application |
| CN114514313A (en) * | 2019-09-12 | 2022-05-17 | 株式会社迪瑟夫 | Method for inducing immature oocyte and method for producing mature oocyte |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250830A (en) * | 2011-07-05 | 2011-11-23 | 西北农林科技大学 | In-vitro separating and culturing method for germline stem cell |
-
2011
- 2011-12-19 CN CN2011104498578A patent/CN102533764A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250830A (en) * | 2011-07-05 | 2011-11-23 | 西北农林科技大学 | In-vitro separating and culturing method for germline stem cell |
Non-Patent Citations (5)
| Title |
|---|
| 《GenBank accession HQ662521》 20110505 Hu Y. et al Mus musculus Figla gene, promoter region and 5'UTR 1-2 , * |
| HU Y. ET AL: "Mus musculus Figla gene, promoter region and 5’UTR", 《GENBANK ACCESSION HQ662521》 * |
| YUE HU ET AL: "Derivation of oocyte-like cells from mouse embryonic stem cells", 《2010 3RD INTERNATIONAL CONFERENCE ON BIOMEDICAL ENGINEERING AND INFORMATICS》 * |
| 杨玉艾 等: "绿色荧光蛋白在胚胎干细胞研究中的应用", 《食草家畜》 * |
| 胡玥 等: "FIGLA基因真核表达载体的构建及其对生殖特异性基因表达调控的研究", 《中国细胞生物学学会全体会员代表大会暨第十二次学术大会论文摘要》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107828826A (en) * | 2017-12-12 | 2018-03-23 | 南开大学 | A kind of external method for efficiently obtaining NSC |
| CN114514313A (en) * | 2019-09-12 | 2022-05-17 | 株式会社迪瑟夫 | Method for inducing immature oocyte and method for producing mature oocyte |
| CN114276984A (en) * | 2021-12-31 | 2022-04-05 | 上海交通大学 | Method for transdifferentiation of female reproductive stem cells into functional sperms and application |
| CN114276984B (en) * | 2021-12-31 | 2024-01-16 | 上海交通大学 | Method for transdifferentiating female germ stem cells into functional sperm and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100335625C (en) | Cultured inner cell mass cells derived from ungulate embryos | |
| Virant-Klun et al. | Parthenogenetic embryo-like structures in the human ovarian surface epithelium cell culture in postmenopausal women with no naturally present follicles and oocytes | |
| Tiyaboonchai et al. | Utilization of the AAVS1 safe harbor locus for hematopoietic specific transgene expression and gene knockdown in human ES cells | |
| WO2001096532A2 (en) | Method of generating pluripotent mammalian cells by fusion of a cytoplast fragment with a karyoplast | |
| EP1487968A1 (en) | Methods of inducing differentiation of stem cells into a specific cell lineage | |
| WO1995010599A1 (en) | Embryonic stem cell-like cells | |
| CN101984050B (en) | Cell type used for producing induced pluripotent stem (iPS) cells and preparation method and application thereof | |
| Chen et al. | Suppression of ES cell differentiation by retinol (vitamin A) via the overexpression of Nanog | |
| Hu et al. | Stem cells derived from human first-trimester umbilical cord have the potential to differentiate into oocyte-like cells in vitro | |
| CN106754729B (en) | Method for preparing induced pluripotent stem cells by using Xist Tale inhibitory transcription factor | |
| Yi et al. | Medaka fish stem cells and their applications | |
| US9163214B2 (en) | Method for culturing stem cells | |
| CN102533764A (en) | Figla gene promoter sequence, marking carrier built by same and application | |
| JP2010166901A (en) | Method of culturing pluripotent stem cell using extracellular matrix from fetal membrane-derived cell | |
| CN102876700A (en) | PiggyBac transposon mediated muscle specific expression A-FABP (adipocyte fatty acid binding protein) universal vector construction method | |
| CN105671045B (en) | A kind of method of sheep embryo fibroblast homologous recombination repair frequency after raising gene editing | |
| Lee et al. | Blastomere aggregation using phytohemagglutinin-L improves the establishment efficiency of porcine parthenogenesis-derived embryonic stem-like cell lines | |
| US20050095708A1 (en) | Characterization and isolation of subsets of human embryonic stem cells (HES) and cells associated or derived therefrom | |
| JP6469371B2 (en) | A method for expressing a plurality of foreign genes in an embryoid body composed of induced pluripotent stem cells (iPS cells) | |
| WO2003040355A1 (en) | Characterization and isolation of subsets of human embryonic stem cells (hes) and cells associated or derived therefrom | |
| WO2013159313A1 (en) | Animal embryonic stem cell line, and preparation method and application thereof | |
| CN102533778A (en) | Method for promoting cell to differentiate into female genital cell based on overexpression of Figla gene | |
| WO2019173615A1 (en) | Sphingolipid-metabolizing proteins enhance the efficiency of gene editing in cells | |
| Ramos-Ibeas et al. | Characterisation of the deleted in azoospermia like (Dazl)–green fluorescent protein mouse model generated by a two-step embryonic stem cell-based strategy to identify pluripotent and germ cells | |
| WO2009098080A1 (en) | Induced blastocyst-like structures, methods of production and uses of the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120704 |