CN106701804A - Multifunctional cellulase gene Mfcsg applicable to auricularia polytricha expression and application of multifunctional cellulase gene Mfcsg - Google Patents
Multifunctional cellulase gene Mfcsg applicable to auricularia polytricha expression and application of multifunctional cellulase gene Mfcsg Download PDFInfo
- Publication number
- CN106701804A CN106701804A CN201611153752.7A CN201611153752A CN106701804A CN 106701804 A CN106701804 A CN 106701804A CN 201611153752 A CN201611153752 A CN 201611153752A CN 106701804 A CN106701804 A CN 106701804A
- Authority
- CN
- China
- Prior art keywords
- gene
- expression
- mfcsg
- cellulase gene
- multifunctional
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01091—Cellulose 1,4-beta-cellobiosidase (3.2.1.91)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of microorganisms, in particular relates to a multifunctional cellulase gene Mfcsg applicable to auricularia polytricha expression and application of the multifunctional cellulase gene Mfcsg, and aims to solve the technical problem of providing a multifunctional cellulase gene applicable to auricularia polytricha expression. The multifunctional cellulase gene Mfcsg applicable to auricularia polytricha expression, which is provided by the invention, has nucleotide sequences as shown in SEQ ID No.4. The invention further provides an expression vector or host containing the multifunctional cellulase gene. The multifunctional cellulase gene can be efficiently expressed in an auricularia polytricha fungus, is capable of improving the intake property of an auricularia polytricha strain, can insrease the yield of auricularia polytricha, and has great values in commercial production of multifunctional cellulase preparations and yield increase of edible mushrooms such as auricularia polytricha.
Description
Technical field
The invention belongs to microbial technology field, and in particular to be suitable for the multifunctional cellulase gene of Uricularia polytricha expression
Mfcsg and its application.
Background technology
Energy resources are the important wealth of country, and particularly important effect is played in the development of social economy.Currentization
The stone energy is maintained at more than 85% for a long time in world's energy-consuming.But because fossil energy is non-renewable and pollutes environment, compel
Be essential alternative energy source to be excavated.And bioenergy have the advantages that it is renewable and environment-friendly.Cellulose degradation enzyme can be with profit
The reproducible bio-fuel of production, Huge value are decomposed with fibre substrate.
Cellulase be by cellulose degradation into the class of enzymes of the small-molecule substance such as cellobiose and glucose general name.From
Cellulose decomposition at least needs 3 kinds of cellulase synergistics to act on into glucose, and they are respectively that endoglucanase, circumscribed Portugal gather
Carbohydrase and beta-glucosidase.And study report and think the multifunctional cellulase gene (multi- that Pomacea canaliculata gastric tissue is separate
Functional cellulase gene, Mfc) endoglucanase, exoglucanase and beta-glucosidase can be encoded
Enzyme, promise well.It is animal sources gene but multifunctional cellulase gene (Mfc) comes from Pomacea canaliculata, may in other species
Cannot stability and high efficiency expression.Because the amino acid codes of each species are used with obvious species Preference, and close
Whether numeral obtains optimization and will directly affect the activities such as mRNA stability, influence cytoribosome protein translation.Based on this, to different
Source gene carry out codon optimization and transform so that foreign gene can complete genetic transformation and carry out high efficient expression be one research
Difficult point.
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of multifunctional cellulase gene of suitable Uricularia polytricha expression
Mfcsg。
The invention discloses a kind of cellulose enzyme gene Mfcsg, nucleotide sequence such as SEQ for being suitable for Uricularia polytricha expression
Shown in ID No.4.
Present invention also offers the expression vector containing the multifunctional cellulase gene M fcsg.
Specifically, described expression vector contains multifunctional cellulase gene M fcsg expression cassettes.
Specifically, described expression cassette from 5 ' to 3 ' includes elements below successively：It is Uricularia polytricha Gpd promoters, introne, many
Functional cellulose enzyme gene Mfcsg and Hpt gene.
The host containing the multifunctional cellulase gene M fcsg or described expression vectors that the present invention is also provided.
Specifically, described host is prokaryotes or fungi.
Specifically, described prokaryotes are Escherichia coli or Agrobacterium.
Present invention also offers purposes of the multifunctional cellulase gene M fcsg in cellulase is prepared.
Present invention also offers purposes of the described expression vector in cellulase is prepared.
Present invention also offers purposes of the described host in cellulase is prepared.
It is obvious poor that experiment analysis results of the present invention display Pomacea canaliculata exists on amino acid codes Preference with Uricularia polytricha
Different, if being directly transferred to Uricularia polytricha without codon optimization, the gene can not transcribe to form mRNA after may causing conversion, or shape
Stable existence is unable in host cell into mRNA.In translation, if the gene codon of Pomacea canaliculata is intracellular in Uricularia polytricha
Just rare codon, such issues that can cause the gene can not preferably to be translated, so as to influence the gene efficient expression.
Such as analysis finds that Uricularia polytricha has UUA, CUA, AUA, GUA rare codon, if being not excluded for these Uricularia polytricha rare codons
The sequence of son, then the exogenous gene expression of the Uricularia polytricha cell that transduction enters will be affected, and be difficult to realize foreign gene
High efficient expression is carried out in target host cell.And eliminate the sequence of the harmful effect factor design such as rare codon, repetitive sequence
Row will be the optimal material that foreign gene transduction enters host cell expression.This optimum experimental formed Mfcsg genetic fragments with
PPK2 connections build Agrobacterium transformation vector, are transduceed by AGL-1 engineering bacterias and enter Uricularia polytricha cell, have obtained high efficient expression,
There is pole significant difference, mycelia life with the sawdust materials mycelial growth rate of control strain (starting strain) in its transformant bacterial strain
Speed long improves 10.57% than control, improves material feeding speed of the mycelia in wood chip matrix, and this is also to codon optimization
The experimental verification of type gene efficient expression.
Pomacea canaliculata gene M fc and Uricularia polytricha transcript CDS codon preferences are compared analysis by the present invention, and according to
Reworked Mfcsg sequences are obtained according to Uricularia polytricha codon preference characteristic optimization, and has been obtained in Uricularia polytricha cell preferably
Expression.Experimental result is transformed and expressed and provides reference for Uricularia polytricha foreign gene, shows that the codon optimization of foreign gene changes
Making can realize heterologous gene in host cell high efficient expression.
Beneficial effects of the present invention：
The invention provides a kind of multi-functional multifunctional cellulase gene M fcsg of optimization, the gene can be in hair
High efficient expression in the fungies such as agaric.Recombinant plasmid containing the gene expression element is imported into Escherichia coli or Agrobacterium, is obtained
Recombinant bacterium.The fungies such as recombinant bacterium conversion Uricularia polytricha just can produce multifunctional cellulase albumen, Huo Zheti with fermentation batch
Uricularia polytricha bacterial strain material feeding ability high, lifts yield.Commercially produced for multifunctional cellulase preparation edible with Uricularia polytricha etc.
The lifting of bacterium yield has substantial worth.
Brief description of the drawings
The phylogenetic tree of Fig. 1 Pomacea canaliculata Mfc genes and other nearly source sequences.
Fig. 2 Optimization-type multifunctional cellulase gene (Mfc) sub- service condition of stream cipher.
The sequence alignment of Fig. 3 reworked Mfcsg genes and Mfc genes.Comparison result shows that two sequence similarities only have
0.801, there is notable difference between showing two sequences, vertical line correspondence base represents identical base.
Fig. 4 is recombinant vector schematic diagram.Pgpd1ap is Uricularia polytricha Gpd promoters, and gpdA is introne, and Mfcsg is Mfc
Genetic modification sequence, Hpt is hygromycin B resistant gene.
Fig. 5 is Mfcsg gene relative quantification PCR testing results.PCR analysis results show Mfcsg genes in transformed bacteria
High efficient expression in strain, and starting strain has no the gene expression signal.17 is starting strain；Agakimfc turns for Mfcsg genes
Change bacterial strain.Legend is calculated by the softwares of Bio-Rad CFX Manager 3.1 and generated.
Fig. 6 is that Mfcsg transgenic strains are relatively schemed with starting strain material feeding speed ratio.Material feeding rate results show Mfcsg bases
Because conversion bacterial strain material feeding speed is significantly higher than starting strain.17 is starting strain；Agakimfc is Mfcsg genetic transformation bacterial strains.
Specific embodiment
Material used in subordinate's embodiment：
Pomacea canaliculata, purchased from Chengdu green stone bridge market.
Competent cell DH5 α step its bio tech ltd purchased from Shanghai.
The bacterial strain that Uricularia polytricha bacterial strain " yellow ear 10 " Inst. of Soil Fertilizer, Sichuan Academy of Agriculture Science preserves, is to plant extensively
The commercialization bacterial strain planted, is commercially also readily available.
Reagent used in subordinate's embodiment：
This experiment RNA is extracted, 1st cDNA synthetic agent box is purchased from Nanjing Vazyme Biotechnology Co., Ltd., RT-PCR
Reagent synthesizes purchased from Sangon Biotech (Shanghai) Co., Ltd., and high-fidelity Taq enzyme is purchased from MBI Fermentas, pEASY-T1
Carrier is purchased from Quan Shijin Bioisystech Co., Ltd.
The clone of the multifunctional cellulase gene M fc of embodiment 1 and optimization
RNA is extracted after Pomacea canaliculata gastric tissue is obtained, cDNA is synthesized according to 1st cDNA synthetic agent box specification, used
Primer pair (mfcF1：5'-TCGACGACGCTTCAGTCAAGC-3', mfcR1：5'-GTTGCCCTCTGAGTGT CGCTC-3')
MFC gene orders are expanded by high-fidelity Taq enzyme PCR, be connected to for amplified fragments after adding " A " by purified amplified fragments and two ends
PEASY-T1 carriers, choose monoclonal and send Sangon Biotech (Shanghai) Co., Ltd. to survey after conversion plasmid to DH5 α competent cells
Sequence.Find that the gene order has 1188bp after sequencing, encode 395 amino acid, submission GenBank obtains the number of accepting and is
KF636134.1(SEQ ID No.1)。
By Pomacea canaliculata Mfc gene orders and nearly edge gene Egxa (FJ183727.1, Ampullaria crossean), Mfc
(EU599577.1, Ampullaria crossean), Egx1 (DQ848667.1, Pomacea canaliculata),
Xylanase (AY941794.1, Ampullaria crossean), Egx3 (DQ848668.1, Pomacea
Canaliculata), Egx1 (DQ848670.1, Pomacea canaliculata), Egx3 (DQ848669.1, Pomacea
Canaliculata sequence alignment) is carried out.Compared using MEGA4 softwares, phylogenetic tree construction (Fig. 1).By comparing
It was found that experiment clone obtains Mfc genes had differences with other nearly source genes, difference it is minimum be Egxa that Pomacea canaliculata is originated
(FJ183727.1) and Mfc (EU599577.1), genetic distance is respectively 0.006 and 0.007；Difference maximum is same source
Egx1 (DQ848670.1) and Egx3 (DQ848669.1), genetic distance is respectively 0.799 and 0.816.
Because the gene is that Pomacea canaliculata encodes zymoprotein, and follow-up study is needed in the expression of the eucaryotes such as Uricularia polytricha, because
This compares the coding codon of above-mentioned Pomacea canaliculata source multifunctional cellulase gene with Uricularia polytricha preferred codons.According to
Paul and Elizabeth (1991) screening principles[10]It is (close to terminate with TAA, TAG or TGA one with ATG as initiation codon
The complete CDS sequences of numeral and length more than 300bp), choose the work song of yellow ear 10 of Deyang Shifang Uricularia polytricha cultivation base collection
CDS (comp22688_c0_seq, ring research of nucleoside triphosphate hydrolase protein coding gene sequence, tool that the sequencing of entity sample is obtained
Have complete initiation codon ATG and terminator codon TAA, codon 4996) it is Uricularia polytricha test sample, to clone acquisition
Mfc genes are Pomacea canaliculata test sample, and Pomacea canaliculata and Uricularia polytricha codon access times and synonymous are calculated with CodonW softwares
Codon relative usage degree (Tables 1 and 2).
The Mfc Analysis of Characteristic of Codon Usage of table 1
The Uricularia polytricha CDS codon preferences of table 2 are analyzed
Note：RSCU values being marked with underscore more than 1 in Tables 1 and 2；Frequency of use highest codon is marked with " "
Note.
The codon of Mfc genes (altogether 396) access times and synonym phase with CodonW software analysis
To use degree (table 1).Wherein RSCU>1 codon amounts to 21, is the Preference codon of Pomacea canaliculata Mfc genes, wherein
This 4 codon RSCU >=2 of CUG, GUG, AGC, AGA, Preference is stronger.And Uricularia polytricha CDS (comp22688_c0_seq, ring
Research of nucleoside triphosphate hydrolase albumen) totally 4996 codon, RSCU>1 codon amounts to 26, and wherein RSCU >=2 codon has 5
Individual, respectively CUC, AUC, GUC, CGC, GGC, Preference are stronger.
Generally, the Pomacea canaliculata amino acid different from Uricularia polytricha preferred codons have 10 (not comprising initiation codon and
Terminator codon), the amino acid of identical preferred codons has 11, and difference preference's property codon accounts for half.Wherein RSCU >=2
In codon, Pomacea canaliculata Mfc genes have 4, and Uricularia polytricha CDS has 5.The codon preference of wherein 4 amino acid is most strong, point
It is not all each not phase of codon of leucine (Leu), valine (Val), serine (Ser), arginine (Arg), and preference
Together, the stronger isoleucine (Ile) of a Preference more than Uricularia polytricha.In terms of codon of the utilization rate less than 10%, statistics
It was found that Uricularia polytricha has the extremely low passwords of utilization rate such as leucine (UUA 2.4%, CUA 5.75%), valine (GUA 6.87%)
Son.Optimization-type multifunctional cellulase gene (Mfc) sub- service condition of stream cipher is shown in Fig. 2.
According to the Preference of codon, on the basis of amino acid composition order is not changed, to known multifunctional coded
Cellulose enzyme gene Mfc sequences are transformed, and some rare codons of Pomacea canaliculata are replaced with into Uricularia polytricha preference codon, are replaced
Change codon of the Uricularia polytricha utilization rate less than 10%, it is to avoid the stem of mRNA ribosome bind sites and translation initiation site occur
Ring structure, sequence of the screening with optimal RNA secondary structures and free energy, the multifunctional cellulase gene optimization for finally obtaining
Sequence Mfcsg (as shown in SEQ ID No.4).With discovery original series after DNAstar7.1.0 software detections and transformation sequence two
Individual sequence similarity only has 0.801, there is notable difference (Fig. 3) between showing two sequences.Sequence G/C content before optimization is
54.04%, it is inconsistent with Uricularia polytricha G/C content (58.16%).Not optimized Mfc sequences minimum free energy for-
, there is inverted repeats in 283.53Kcal/mol, sequence is not ideal.Improved Mfcsg sequences G/C content is from original Mfc
The 54.04% of sequence increases to 58.16%, consistent with Uricularia polytricha genetic background, does not have hairpin structure, repetitive sequence and reverse weight
Complex sequences, reaches experiment expected purpose, can be used as Uricularia polytricha gene transformation material.Relatively low free energy causes Optimization-type
Genetic transcription RNA structures more stablize, be more conducive to transcription and translation without hair clip and repetitive sequence structure, sequence optimisation effect is good
It is good.
The Uricularia polytricha Mfcsg genetic transformation bacterial strain quantitative PCR detections of embodiment 2
By Uricularia polytricha Gpd promoters, the expression sequence of Mfcsg and Hpt gene start codons to sequence composition between Nco I
(Gpd promoter primers are F to row：CGAAGTTTGAGGTGGTGCG, R：TTTAATTCAAGCAGTCAATGGATTG, such as SEQ ID
Shown in No.2), Mfcsg gene clonings are from Pomacea canaliculata and carried out codon transformation (as shown in SEQ ID No.4), Hpt genes
Initiation codon is amplified from ppk2 plasmids (as shown in SEQ ID No.5) to sequence PCR between Nco I, is inserted into PPK2 and (is purchased from
Hangzhou Gong Dao Bioisystech Co., Ltd) EcoR I and the sites of Nco I between the recombinant plasmid that obtains (collection of illustrative plates is shown in Fig. 4).By purchase
DH5 α reagents (Shanghai steps its bio tech ltd) competence is bought, conversion to specifications obtains transformant, and liquid amplifies
Plasmid is extracted after culture heat-shock transformed to AGL1 competent cells (Shanghai steps its bio tech ltd), obtain transformant
AGL1::Akimfc.Then pass through AGL1 engineering bacterias (AGL1::Akimfc) transduction obtains Uricularia polytricha conversion bacterial strain into Uricularia polytricha
AG-Akimfc.Bacterial strain is converted as test strain with AG-Akimfc, with starting strain as control strain, by transformant bacterial strain and right
According in inoculation to PDA liquid medium, mycelia is collected after 25 DEG C of culture 10d.RT-PCR is obtained after mycelial samples are extracted into RNA
1st cDNA are obtained, as template, using primer pair (GAPDF：5'-GCCGTATCGGTCGGATTGTGAC-3', GAPDR：5'-
TGAGCTTGCCGTCCTTGGTCT-3' Gapdh reference genes) are expanded, amplified fragments are 167bp.With primer pair (mfcrtF：
CGGCTACAACCTGGAGCTGTTC, mfcrtR：TGACTGGAGCGAGGCGATGT Optimization-type gene M fcsg) is expanded, piece is expanded
Section is 118bp.PCR amplification programs：95 DEG C of 40S, 1cycle；95 DEG C of 20S, 60 DEG C of 20S, plate read, 45cycles.Experiment
Result display Mfcsg expression quantity is high, and control strain is not detected by Mfcsg amplified signals (Fig. 5), illustrates multifunctional cellulase
Gene M fcsg has been transferred to Uricularia polytricha cell, and can obtain high efficient expression.
The Mfcsg genetic transformation bacterial strain material feeding aptitude tests of embodiment 3
In order to test the influence of Mfcsg gene pairs bacterial strain material feeding ability in Uricularia polytricha transformant AG-Akimfc, with the bacterium that sets out
Strain is control, and bacterial strain is converted as test strain with Akimfc.Transformant bacterial strain and control strain are inoculated into compost test tube
(culture material formula：Wood chip 33%, corncob 30%, rice bran 20%, cotton seed hulls 10%, corn flour 2%, lime 4%, gypsum
1%), 25 DEG C of cultures, in 14d, 18d, 22d, 24d line record mycelial growth tip location, then calculate average mycelial growth
Speed.Be present pole significant difference with compareing in experimental result display Akimfc conversion bacterial strain mycelial growth rates, improve than compareing
10.57% (Fig. 6), show the expression of reworked multifunctional cellulase gene M fcsg genes has pole to Uricularia polytricha material feeding ability
Big castering action, beneficial to Uricularia polytricha biological transformation ratio is improved, improves biological yield.
Bibliography
[1] the green Energy Development in China trend of Quan Peng --- clean coal utilization [J] Low Carbon Worlds .2015 (01):101-
102.
[2] Zhang Yuzhuo, Jiang Wenhua, Yu Zhufeng, wait world energy sourceses development trend and enlightenment [J] to China's energy revolution
Chinese engineering science .2015,17 (09):140-145.
[3]Yu G J,Yin Y L,Yu W H,et al.Proteome exploration to provide a
resource for the investigation of Ganoderma lucidum[J].PLoS One.2015,10(3):
e119439.
[4]Cao G,Zou D,Zhang X,et al.Bioenergy and Biomass Utilization[J]
.Biomed Res Int.2015,2015:857568.
[5] Yang Peizhou, Guo Liqiong, Wang Yihong, wait the molecule gram of Pomacea canaliculatas (Ampullaria crossean) mfc genes
Grand and sequence analysis [J] Chinese food journals .2008,8 (04):21-27.
[6] Yang Pei weeks multifunctional cellulases gene (mfc) clone and its expression study [D] in Coprinus cinereus
Agricultural University Of South China, 2008.
[7] Wang Yihong, Lin Junfang, Zhao Fengyun, wait the research of multifunctional cellulases gene (mfc) genetic transformation straw mushroom
[Z] Zhejiang Province, Chinas Hangzhou:20087.
[8] Ren Yanping, Yao Zhengpei, Ni Zhiyong, wait the Preference of plant adverse circumstance related gene codons to analyze [J] Hunan
Agricultural sciences .2014 (09):12-16.
[9]Presnyak V,Alhusaini N,Chen Y,et al.Codon Optimality Is a Major
Determinant of mRNA Stability[J].Cell.2015,160(6):1111-1124.
[10] Wu Zhengchang, Wang Jing, Zhao Qiaohui, wait the codon preference of lard polysaccharide binding-protein gene (LBP) to analyze
[J] Journal of Agricultural Biotechnologies .2013,21 (10):1135-1144.
[11] Zhao Yang, Liu Zhen, Yang Peidi, wait tea tree actin genes codon bias to analyze [Z] Chinese yunnan elder brothers
It is bright:20149.
[12] expression [J] the Jiangsu's agricultures of Peng Jingjing through the resisting cellulase of codon optimization in Escherichia coli
Report .2014,30 (03):497-502.
[13]Tokuoka M,Tanaka M,Ono K,et al.Codon Optimization Increases
Steady-State mRNA Levels in Aspergillus oryzae Heterologous Gene Expression
[J].Applied and Environmental Microbiology.2008,74(21):6538-6546.
SEQUENCE LISTING
<110>Inst. of Soil Fertilizer, Sichuan Academy of Agriculture Science
<120>It is suitable for multifunctional cellulase gene M fcsg and its application of Uricularia polytricha expression
<130> A161063KN
<160> 13
<170> PatentIn version 3.3
<210> 1
<211> 1188
<212> DNA
<213> artificial
<220>
<223>Pomacea canaliculata multifunctional cellulase gene M fc sequences
<400> 1
atgccctctg gtgctgctgg tgctggggtg accagcgaga tcgacagact gagaagaagc 60
gacataacgg tccacgtgaa tgttggtggt aacatcaacc acggtcaagt gagcattcgt 120
gtattacaaa agagaaaggc attcccgttc gggacatgtg tggccgcctg ggcctacaac 180
gatgggtcca aaggagcata ccgggatttc atccaccagc actacaactg ggcggtgcca 240
gaaaactcac tcaagtgggc tagcatcgaa cctaacaggg gacaaaagaa ctatcagcct 300
ggcctaaaca tgcttcacgg actgagaaat cacgggatta aggtgagagg tcacaacctg 360
gtgtggtctg tcgacaatac ggtgcagaac tgggtcaagg ctctgcatgg ggatgagctt 420
cgaaaggttg tccatgacca cattgtggaa accatcaaca catttaaggg attagtggag 480
cactgggatg tgaacaacga gaacctgcat ggccagtggt accagcatca actgaatgac 540
aatggctaca acctggaact gttccgtatc gcacacgccg ccgaccccaa cgtcaaactc 600
ttcctcaacg actacaacgt tgtgtccaac agttattcaa caaacgacta tcttcgacaa 660
ggtcaacagt ttaaggccgc taatgtgggt ctttacggtt tgggtgctca gtgccacttt 720
ggcgacgaaa gcgacccaga acccggtact aagcaacgtc tggatacttt agctcaagtg 780
ggcgtgccca tctgggccac tgagttggat gtggtagctt cggatgagaa cagacgagcg 840
gacttctacg agcacgcgct gacagtcctg tacggccatc atgccgtgga gggcatcctc 900
atgtggggct tctgggacaa ggcccaccgg cgtggtgcca gggctgctct tgttgtcgga 960
gacaacctgc agctgacggc ggccggacgt cgcgtgctgg agctctttga gcacaggtgg 1020
atgacagacg agacgcacaa cctggcagcg ggcactcagt tcacagtacg cggtttccat 1080
ggcgactacg aggtgcaagt catcgtccag ggtcaagagc acactaacct gaggcagacg 1140
ttctcgttgg gcaacggtcc ccacaccgtc aacattaatg ttagctag 1188
<210> 2
<211> 1021
<212> DNA
<213> artificial
<220>
<223>Gpd promoter sequences
<400> 2
cgaagtttga ggtggtgcga atacgctcgt aaggtgacaa tacagcataa ctgatatatc 60
ttgtgacaag ccatatcggg catatccccg gtcacatcgt cgagcggaat tttttctctt 120
tccagagtgc tagtgagatg cgactcttgt cgtactagct tagtgaacaa tgaccaagaa 180
agctcgtgaa gaggtcgggt ccggtcgcgc taatgtacag gatggcctta gctggagtat 240
agcagttaac tcgggagtga ttatacatcg gttgagaggt atttcgtttc aggccttgcc 300
tctaatccct tgctctgcat atgcaccaga taaatccgtt ttgtcgtaga tgcgagagtt 360
caggttttac gccaaaccga aaagagttgc atgagcatcc ctttatgctg gttatctgag 420
cgggcccgta tcctatcggc gttagagtgc agtcggagag ccgcatgtat cacggaaagg 480
actcgaacag ggagttttat ctatttttat tggtcgatat cagtcagatt gtcagtgcgt 540
caaagttgca tccataaggc tactacggtg aaaccggtgt atcctgggat atcatgaaat 600
ggttgtatgc agaagataag aataagagta gttctagaac aacaaaccca ggccagggag 660
gaagctgtag catttgcaag actttgcagg gcttttcaaa ggcacttcca tccaaagctc 720
gagcacggtt ccaggcaacc ttagtcatgg ggcgatagaa ctgaagaacg tttgctgatt 780
ggcagtccat cccaaaggac tcggccaata aatcctaccc aatcgcaggt ccgaggtact 840
aaagtgtttt aaggtctaga cttttagggc tattgtcgaa gtcacaacat cacgcaatca 900
agatttgact gaagcgcgat tatctataaa aggatcagtt gtgtttttcg tccgcatctt 960
ttccttgttc cacaaccttc gattctaaat acactccaat ccattgactg cttgaattaa 1020
a 1021
<210> 3
<211> 116
<212> DNA
<213> artificial
<220>
<223>PPK2 plasmid intron sequences
<400> 3
gtaagtactt tgctacatcc atactccatc cttcccatcc cttattcctt tgaacctttc 60
agttcgagct ttcccacttc atcgcagctt gactaacagc taccccgctt gagcag 116
<210> 4
<211> 1188
<212> DNA
<213> artificial
<220>
<223>Reworked multifunctional cellulase gene M fcsg sequences
<400> 4
atgccaagcg gtgctgcagg tgctggagtt acaagcgaga tcgacaggct taggcggtct 60
gatatcacag tccacgtcaa cgtcggtggt aacatcaacc acggtcaggt ctcgatccgg 120
gtcctccaga agcggaaggc gttcccattc ggaacctgcg tggcagcatg ggcatacaac 180
gacggtagta agggggcata ccgggacttc atacaccagc actacaactg ggctgtgccc 240
gagaactcgc tcaagtgggc ttccatcgag ccgaacaggg gacagaagaa ctaccagccg 300
ggattgaaca tgctgcacgg cctgcggaac catggaatca aggtgcgggg tcataacctc 360
gtgtggtcgg tggacaatac ggtgcagaac tgggtcaagg ctctgcacgg ggacgagctg 420
aggaaggtgg ttcacgacca tatcgtcgag accatcaaca cgttcaaggg cctggtggag 480
cactgggacg tcaacaatga gaacctccac ggccagtggt accagcacca gctgaacgac 540
aacggctaca acctggagct gttccggatc gcccacgctg ccgatcccaa tgtgaaactc 600
ttcctcaacg actacaatgt cgtctccaac agttactcga cgaacgacta tctccgccag 660
gggcagcagt tcaaagccgc caatgtcggt ctctacgggc tcggggcgca gtgccacttc 720
ggcgacgagt ctgaccccga accgggaact aagcaacggc ttgacacgct cgcgcaagtt 780
ggggttccga tttgggccac tgaactcgac gttgtcgcgt ctgatgagaa tcgccgcgcg 840
gatttctatg agcacgcgct tacggtcctc tatggacacc acgcggttga gggcattctc 900
atgtggggct tctgggacaa agcgcaccgg cgcggggcgc gggcggcgct tgttgttggg 960
gacaatttgc aattgactgc ggcgggccgc cgcgtccttg aattgtttga acatcggtgg 1020
atgactgacg agacgcataa tcttgccgcg ggcacccaat tcaccgtccg cgggtttcat 1080
ggcgactatg aggtccaagt cattgtccaa ggccaagagc ataccaacct ccggcaaacg 1140
ttctccttgg gcaatgggcc gcataccgtc aacataaacg tctcctaa 1188
<210> 5
<211> 347
<212> DNA
<213> artificial
<220>
<223>Hpt gene start codons are to sequence between Nco I
<400> 5
atgcctgaac tcaccgcgac gtctgtcgag aagtttctga tcgaaaagtt cgacagcgtc 60
tccgacctga tgcagctctc ggagggcgaa gaatctcgtg ctttcagctt cgatgtagga 120
gggcgtggat atgtcctgcg ggtaaatagc tgcgccgatg gtttctacaa agatcgttat 180
gtttatcggc actttgcatc ggccgcgctc ccgattccgg aagtgcttga cattggggaa 240
ttcagcgaga gcctgaccta ttgcatctcc cgccgtgcac agggtgtcac gttgcaagac 300
ctgcctgaaa ccgaactgcc cgctgttctg cagccggtcg cggaggc 347
<210> 6
<211> 21
<212> DNA
<213> artificial
<220>
<223>Primer mfcF1
<400> 6
tcgacgacgc ttcagtcaag c 21
<210> 7
<211> 21
<212> DNA
<213> artificial
<220>
<223>Primer mfcR1
<400> 7
gttgccctct gagtgtcgct c 21
<210> 8
<211> 19
<212> DNA
<213> artificial
<220>
<223>Gpd promoter sense primers
<400> 8
cgaagtttga ggtggtgcg 19
<210> 9
<211> 25
<212> DNA
<213> artificial
<220>
<223>Gpd promoter anti-sense primers
<400> 9
tttaattcaa gcagtcaatg gattg 25
<210> 10
<211> 22
<212> DNA
<213> artificial
<220>
<223>Primer GAPDF
<400> 10
gccgtatcgg tcggattgtg ac 22
<210> 11
<211> 21
<212> DNA
<213> artificial
<220>
<223>Primer GAPDR
<400> 11
tgagcttgcc gtccttggtc t 21
<210> 12
<211> 22
<212> DNA
<213> artificial
<220>
<223>Primer mfcrtF
<400> 12
cggctacaac ctggagctgt tc 22
<210> 13
<211> 20
<212> DNA
<213> artificial
<220>
<223>Primer mfcrtR
<400> 13
tgactggagc gaggcgatgt 20
Claims (10)
1. the multifunctional cellulase gene M fcsg of Uricularia polytricha expression is suitable for, it is characterised in that：Nucleotide sequence such as SEQ ID
Shown in No.4.
2. the expression vector of multifunctional cellulase gene M fcsg described in claim 1 is contained.
3. expression vector as claimed in claim 2, it is characterised in that：Described expression vector contains multifunctional cellulase base
Because of Mfcsg expression cassettes.
4. expression vector as claimed in claim 3, it is characterised in that：Described expression cassette from 5 ' to 3 ' includes following unit successively
Part：Uricularia polytricha Gpd promoters, introne, multifunctional cellulase gene M fcsg and Hpt gene.
5. multifunctional cellulase gene M fcsg described in claim 1 or the expression described in any one of claim 2~4 are contained
The host of carrier.
6. host as claimed in claim 5, it is characterised in that：Described host is prokaryotes or fungi.
7. host as claimed in claim 6, it is characterised in that：Described prokaryotes are Escherichia coli or Agrobacterium.
8. purposes of the multifunctional cellulase gene M fcsg in cellulase is prepared described in claim 1.
9. purposes of the expression vector described in any one of claim 2~4 in cellulase is prepared.
10. purposes of the host described in any one of claim 5~7 in cellulase is prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611153752.7A CN106701804B (en) | 2016-12-14 | 2016-12-14 | It is suitable for multifunctional cellulase gene M fcsg and its application of Uricularia polytricha expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611153752.7A CN106701804B (en) | 2016-12-14 | 2016-12-14 | It is suitable for multifunctional cellulase gene M fcsg and its application of Uricularia polytricha expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701804A true CN106701804A (en) | 2017-05-24 |
| CN106701804B CN106701804B (en) | 2019-12-03 |
Family
ID=58937394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611153752.7A Active CN106701804B (en) | 2016-12-14 | 2016-12-14 | It is suitable for multifunctional cellulase gene M fcsg and its application of Uricularia polytricha expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701804B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102093959A (en) * | 2010-12-13 | 2011-06-15 | 华南农业大学 | Production method of recombinant multifunctional cellulase |
| CN102127532A (en) * | 2010-12-30 | 2011-07-20 | 华南农业大学 | Method for using transgenic Coprinus cinereus to efficiently express recombinant enzyme |
-
2016
- 2016-12-14 CN CN201611153752.7A patent/CN106701804B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102093959A (en) * | 2010-12-13 | 2011-06-15 | 华南农业大学 | Production method of recombinant multifunctional cellulase |
| CN102127532A (en) * | 2010-12-30 | 2011-07-20 | 华南农业大学 | Method for using transgenic Coprinus cinereus to efficiently express recombinant enzyme |
Non-Patent Citations (3)
| Title |
|---|
| 廖俊华: "优化设计的内切葡聚糖酶基因Ends在毕赤巴斯德酵母中的表达研究", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 杨培周等: "毛柄金钱菌gpd启动子驱动福寿螺纤维素酶基因在灰盖鬼伞菌中的表达", 《食品科学》 * |
| 贾定洪等: "基于毛木耳 CDS 的福寿螺多功能纤维素酶基因密码子优化分析", 《西南农业学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701804B (en) | 2019-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106978360A (en) | One plant height cellulase-producing trichoderma reesei recombinant bacterial strain and its application | |
| CN105143447B (en) | Protein and application thereof with xylose isomerase activity | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN103298942A (en) | Methods for transforming eukaryotic algae | |
| CN113604472B (en) | CRISPR/Cas gene editing system applied to Trichoderma reesei | |
| Yang et al. | Agrobacterium tumefaciens mediated transformation of ChiV gene to Trichoderma harzianum | |
| CN111394380A (en) | Method for improving resistance of formic acid and acetic acid in cellulose hydrolysate by using formate dehydrogenase | |
| CN109486688B (en) | Trichoderma reesei genetic engineering bacterium and preparation method and application thereof | |
| CN106479947A (en) | Fermenting and producing 3 hydracrylic acid genetic engineering bacterium and its construction method and application | |
| CN112921043A (en) | Mutant nucleic acid, expression vector, laccase mutant with high specific activity and preparation method thereof | |
| CN108866117A (en) | It is a kind of to utilize the method for photosynthetic bacteria synthesis 3- hydracrylic acid and its corresponding recombinant cell and application | |
| Keo-oudone et al. | Isolation and characterization of thermotolerant ethanol-fermenting yeasts from Laos and application of whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS) analysis for their quick identification | |
| CN104726388B (en) | A kind of Pullulanase bacterium producing multi enzyme preparation and the method for improving its enzymatic productivity | |
| CN114410562B (en) | Klebsiella engineering bacterium and application thereof in ethanol production | |
| CN106701804B (en) | It is suitable for multifunctional cellulase gene M fcsg and its application of Uricularia polytricha expression | |
| CN108220216B (en) | Ammonium-resistant nitrogen-fixing microorganism for over-expression of glnR gene and construction method and application thereof | |
| CN110862952B (en) | 5-aminolevulinic acid production strain and construction method and application thereof | |
| CN109401991B (en) | Recombinant saccharomyces cerevisiae and method for producing ethanol by fermenting raw materials | |
| CN109370969B (en) | Application of recombinant Klebsiella in preparation of 1, 3-propylene glycol | |
| CN106434700B (en) | A kind of saccharomyces cerevisiae spt15 fixed point saturation gene mutation method improving alcohol yied | |
| CN108048384B (en) | GlnA gene-deleted ammonium-resistant nitrogen-fixing microorganism and construction method and application thereof | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof | |
| CN111286481A (en) | Pseudomonas stutzeri mutant strain and construction method and application thereof | |
| CN110951665B (en) | Method for knocking out Klebsiella Zn transport protein and improving yield of 1, 3-propylene glycol | |
| CN114015634B (en) | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 610000 zone 2, Shizishan Road, waidong, Chengdu, Sichuan Province Patentee after: Institute of agricultural resources and environment, Sichuan Academy of Agricultural Sciences Address before: 610066 Institute of soil and fertilizer, Sichuan Academy of Agricultural Sciences, zone 2, Shizishan Road, waidong, Jinjiang District, Chengdu City, Sichuan Province Patentee before: SOIL AND FERTILIZER Research Institute SAAS |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220608 Address after: No.4 Shizishan Road, Jinjiang District, Chengdu, Sichuan 610066 Patentee after: Sichuan Edible Fungi Research Institute Address before: 610000 zone 2, Shizishan Road, waidong, Chengdu, Sichuan Province Patentee before: Institute of agricultural resources and environment, Sichuan Academy of Agricultural Sciences |