CN106701785B - A kind of mango Ethylene receptor gene - Google Patents
A kind of mango Ethylene receptor gene Download PDFInfo
- Publication number
- CN106701785B CN106701785B CN201710120896.0A CN201710120896A CN106701785B CN 106701785 B CN106701785 B CN 106701785B CN 201710120896 A CN201710120896 A CN 201710120896A CN 106701785 B CN106701785 B CN 106701785B
- Authority
- CN
- China
- Prior art keywords
- mango
- leu
- ethylene
- gene
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23B—PRESERVING, e.g. BY CANNING, MEAT, FISH, EGGS, FRUIT, VEGETABLES, EDIBLE SEEDS; CHEMICAL RIPENING OF FRUIT OR VEGETABLES; THE PRESERVED, RIPENED, OR CANNED PRODUCTS
- A23B7/00—Preservation or chemical ripening of fruit or vegetables
- A23B7/14—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10
- A23B7/153—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10 in the form of liquids or solids
- A23B7/154—Organic compounds; Microorganisms; Enzymes
Abstract
The present invention relates to field of biotechnology, and in particular to a kind of mango Ethylene receptor gene.Gene Name of the present invention is MiETR1, and the base sequence of gene M iETR1 is as shown in SEQ ID NO:1 in sequence table；Totally 2570 base sequence, including one includes 113 3 ' untranslated regions, 1 polyadenylic acid tail and 1 have the opening area decoder of 2220 base sequences；Its amino acid sequence is as shown in sequence table SEQ ID NO:2.The present invention separates clone from mango and has obtained mango Ethylene receptor gene MiETR1, the expression of Ethylene receptor gene MiETR1 can be significantly inhibited by acting on Ethylene receptor gene MiETR1 by ethylene inhibitor, to reduce acetate releasing quantity and delay ethylene evolution peak, achieve the purpose that delay Ripening of Mango Fruit During Storage aging.
Description
[technical field]
The present invention relates to field of biotechnology, and in particular to a kind of mango Ethylene receptor gene.
[background technique]
Mango (Mangnifera indica L.) is famous tropical fruit (tree), and unique flavor, meat is soft, nutritive value
Height has the good reputation of " tropical fruit king ", is only second to banana in world's tropical fruit (tree) yield and occupies second, production and trade in the world
In occupy an important position.In recent years, global mango annual output reaches 27,000,000 tons.Mango belongs to typical climacteric type fruit
It is real, there is apparent climacteric in post-harvest fruits maturation, respiratory intensity is maximum when fruit reaches complete ripeness, later with fruit
Tissue aging gradually decreases.Mango is very sensitive to ethylene after adopting, and before transition starts, organizes interior ethylene concentration extremely low, shortly
Before transition occurring, ethylene obviously rises, and causing climacteric, (Zhang Jing, waiting, " 6 Different Cultivars of Mangifera indica quality characteristic evaluations are ground
Study carefully " food science and technology, 2011.).Mango harvesting positive value summer, perishable intolerant to storage after adopting, metabolism is vigorous, and fruit is easy after-ripening
And turn yellow, soften, it is highly prone to damage to plants caused by sudden drop in temperature in cryopreservation, leads to the quick brown stain of pericarp, disease easily occurs when temperature is higher again, from
And the edible value of mango is reduced, restrict mango production development.
Ethylene (Ethylene) is a kind of important plant hormone, almost all of higher plant can synthesizing ethylene, and
It works in the entire growth and development process of plant.Seed sprouts, organ senescence and falls off, fruit maturation, environment-stress and disease
The processes such as original reaction are all by the regulation of ethylene, and ethylene plays unique regulating and controlling effect especially in fruits and vegetables maturation and aging course,
But ethylene is needed through signal transduction pathway in conjunction with ethylene receptor, could be had an impact to many physiology courses of plant.Second
Alkene receptor is the key signal transmission factor in ethylene signaling approach, is that the response of ethylene goes on smoothly the required (Jiang of institute
And Fu, 2002；Li Lixiu and Lai Zhongxiong, 2013).Expression by controlling ethylene receptor can influence ethylene signaling way
Diameter enables plant maturation and adopts the associated changes such as rear service life and delay or interrupt.This kind of Ethylene Signal of Ethylene receptor gene family
The determination of the clone of key factor and expression characterization in transduction pathway has great significance to research Fruit development.Second
Alkene Receptor member may have a variety of regulation and control models, the table of the Ethylene receptor gene of different type fruit in ripening of fruits
Up to being complicated and diversified.
Ethylene receptor as coded by multigene family, encodes protein structure difference according to it, can be divided into ETR1 in plant
With ETR2 family two major classes.ETR1 family can be divided into ETR1 subclass and ERS1 subclass again, their main distinctions are whether there is
Response regulator structural domain.ETR1 is in the most upstream of other locus of Ethylene Signal Transduction.Studies have shown that ETR1 coding
ETR1 albumen has ascendancy in ethylene receptor family.Because at Ethylene Signal Transduction approach initial stage, only ETR1 albumen energy
Ethylene is enough combined, other receptors do not bind directly ethylene, only form receptor complex with ETR1 albumen.ETR1 albumen is deposited extensively
It is in various plant tissues, structure and function has very big conservative, at present successively successful gram of at least 37 kinds of plants
Grand ETR1 genetic fragment out, these plants are mostly based on fruit tree and ornamental plant.By the table for adjusting Ethylene receptor gene ETR1
It is to realize an important channel for utilizing biotechnology delayed fruit Ripening and softening up to level modulation fruit maturation ageing process.
Ethylene receptor is encoded by multigene family, they respectively have feature in structure and gene spatial and temporal expression.At present quasi-
5 Ethylene receptor genes have been separated in southern mustard and rice, on the basis of model plant, research of the ethylene receptor in fruit
Also it has made some progress.There are at least six ethylene receptor member, apples may have 5, contain in pear fruit for tamato fruit
4, researcher's isolated multiple ethylene receptor homologous genes from the fruits such as banana, winter jujube, citrus, persimmon in succession again.By
This, may each seed pod as it can be seen that may be simultaneously present multiple Ethylene receptor genes in each fruit, and go deep into research
More Ethylene receptor genes will be had in reality to be constantly cloned.And there may be not in different plants for Ethylene receptor gene
Same expression pattern.The function of regulating and controlling Ethylene receptor gene by technological means such as genetic engineerings, to reduce fruit to ethylene
Sensibility, be one of the effective way of delayed fruit ripening and senscence process, this is confirmed in tamato fruit.
Although currently, having had many reports, related mango for Mango Fruit ethylene evolution and ethylene reaction
The expression of the research of ethylene signaling approach, especially ethylene receptor and regulatory mechanism are still unclear in fruit maturation ageing process
Chu does not clone Mango Fruit Ethylene Receptors also.
[summary of the invention]
Goal of the invention of the invention is: in view of the above-mentioned problems, providing a kind of mango Ethylene receptor gene and its coding
Protein.
To achieve the goals above, The technical solution adopted by the invention is as follows:
A kind of mango Ethylene receptor gene, the Gene Name are MiETR1, the nucleotide sequence of the MiETR1 such as sequence
In list shown in SEQ ID NO:1.
A kind of mango ethane cyclic amp receptor protein, the protein name MiETR1 albumen, the MiETR1 albumen be as it is following 1)
Or 2) described in protein:
1) its amino acid sequence is as shown in sequence table SEQ ID NO:2；
2) base sequence as described in sequence table SEQ ID NO:1 encodes.
A kind of expression vector includes gene M iETR1 described in claim 1.
The source mango Ethylene receptor gene MiETR1 of the invention is mango (Mangnifera indica L.), is lacquer tree
The cultivar platform agriculture 1 of section's Mangifera, place of production Baise of Guangxi.SEQ ID in the base sequence of gene M iETR1 such as sequence table
Shown in NO:1；Totally 2570 base sequence, including one includes 113 3 ' untranslated regions, 1 polyadenylic acid tail and 1 have
The opening area decoder of 2220 base sequences.
The protein of gene M iETR1 coding contains 739 amino acid, and amino acid sequence is by sequence table SEQ ID NO:2
It is shown.MiETRlb protein molecular total amount is 86385.1, isoelectric point pI9.09,5 ' untranslated regions and 3 ' untranslated region sequences difference
Positioned at 164 and 309 nucleotide of total length.The total amino acid residues of negative electrical charge and positive charge are respectively 75 and 88, molecule
Formula is C3891H6264N1064O1080S36, total atom number is 12335, fat coefficient 106.84, unstability index 39.39, hydrophily
It is 0.065, illustrates that it is a stable hydrophobin.Report that sequence does not find weight in gene M iETR1 and ncbi database
It closes.
Secondary structure through nnPredict software prediction analysis MiETRl albumen, structure are shown: being turned containing alpha-helix, β-
The 3 kinds of structures in angle and random coil, wherein ratio shared by MiETRl albumen alpha-helix be respectively 24.37%,；β-corner accounts for
9.97%；Random coil accounts for 42.93%.Therefore MiETRl Protein secondary structure is based on random coil.Through SWISS-MODEL
Tool predicts that prediction result is as shown in Figure 2 to the three-dimensional structure of MiETRl albumen.
Recombinant vector, transgenic cell line or recombinant bacterium containing said gene also belong to protection scope of the present invention it
It is interior.The primer pair of the overall length or its any segment that expand said gene also belongs within protection scope of the present invention.
A kind of application of mango Ethylene receptor gene described in claim 1 regulates and controls maturation in mango and/or extends awns
Application in the fruit shelf-life.
A kind of application of mango Ethylene receptor gene described in claim 1 is inhibiting answering in the expression of mango ethylene receptor
With.
A method of extending the mango shelf-life, acts on gene M iETR1 described in claim 1 with ethylene inhibitor.
Optimization, the ethylene inhibitor is selected from 1- methyl cyclopropene, 1- pentyl-cyclopropene, 1- cyclopropene, 1- third
Any one or more of cyclopropene and 1- Octylcyclopropene.
By targetedly acting on Ethylene receptor gene MiETR1 or gene M iETR1 of the present invention with ethylene inhibitor
The protein of coding may be implemented to block ethylene synthase, achieve the purpose that reduce ethylene volume in mango, to reach extension mango
The purpose of shelf-life.
Similarly, before Ripening of Mango Fruit During Storage, also can be used chemical substance or biological substance act on ethylene receptor of the present invention
The protein of gene M iETR1 or gene M iETR1 coding may be implemented to accelerate ethylene synthase, mango promoted to shift to an earlier date maturation, thus
Reach and adjusts Ripening of Mango Fruit During Storage process purpose.
In conclusion by adopting the above-described technical solution, the beneficial effects of the present invention are:
The present invention separates clone from mango and has obtained mango Ethylene receptor gene MiETR1, is acted on by ethylene inhibitor
The expression of Ethylene receptor gene MiETR1 can be significantly inhibited in Ethylene receptor gene MiETR1, thus reduce acetate releasing quantity and
Delay ethylene evolution peak.
The present invention is to keep quality after mango is adopted, and delays senescence and provides a kind of new means.Rear preservation is adopted for mango to mention
For a kind of new method.
Gene coded sequence of the present invention is short, is easy to clone and genetic engineering operation, material requested are easily obtained.
[Detailed description of the invention]
The extracting method RNA electrophoretogram of 1.1RNA in Fig. 1 embodiment 1；
The lower 1.6 semi-quantitative RT-PCR analysis RNA electrophoresis detection figures of Fig. 2 embodiment 1；Electrophoretogram sequence is successively are as follows: blank group
Processing group 0,2,4,6,8 day, 1-MCP processing group 0,2,4,6,8 day.
The GADPH amplification curve of the sample of sample in lower 2.3 fluorescence quantitative PCR detections of Fig. 3 embodiment 1；
The MiETR1 amplification curve of sample in lower 2.3 fluorescence quantitative PCR detections of Fig. 4 embodiment 1；
The GADPH solubility curve of the lower 2.3 fluorescent quantitation samples of Fig. 5 embodiment 1；
The MiETR1 solubility curve of the lower 2.3 fluorescent quantitation samples of Fig. 6 embodiment 1；
The Tertiary structure predictions figure of MiETRl in Fig. 7 embodiment 2；
The protein system chadogram structure figures of MiETRl in Fig. 8 embodiment 2；
1-MCP handles the influence result figure expressed MiETRl in Fig. 9 embodiment 3；
1-MCP processing generates the influence of rate to ethylene under 25 DEG C of holding conditions of mango in Figure 10 embodiment 3；
1-MCP processing generates the influence of rate to ethylene under 4 DEG C of holding conditions of mango in Figure 11 embodiment 3.
[specific embodiment]
Below with reference to embodiment, the invention will be further described.
It is conventional method unless otherwise specified in following embodiments.
The genetic resources that completion of the invention is relied on are as follows: mango (Mangnifera indica L.) is Anacardiaceae mango
The cultivar platform agriculture 1 of category, place of production Guangxi.
1 mango Ethylene receptor gene MiETR1 of embodiment is extracted
In the present invention, the extraction of total serum IgE and the extraction of cDNA synthesis total serum IgE are referring to Bioteke (hundred Tyke biology skill of Beijing
The production of art Co., Ltd) operation of generic plant total RNA extraction reagent box (centrifugal column type) specification, and it is stored in -80 DEG C of refrigerators.
The synthesis of the first chain of cDNA is operated referring to RevertAidTM First-Strand Synthesis System specification, synthesis
CDNA is for conserved region clone, 3 ' RACE and ORF clone.The synthesis of 5 ' the first chains of RACE cDNA is referring to TransScript II
First-Strand cDNA Synthesis SuperMix kit carries out, and 0.2 μ L is added in when synthesis of the first chain of cDNA
5 ' ETR special primer GSP:5 '-GCTGCCATCTTCAAGCCT-3 ' of 2pmol/0.2 μ L；The purifying of cDNA the first chain synthetic product,
Add the synthesis of the second chain of homopolymer tail and cDNA referring to 5 ' RACE System for Rapid Amplification of
The kit of cDNAEnds, Version 2.0.
The extracting method of 1.1RNA
1) homogenized: taking 100mg mango group to be woven in rapid grind into powder in liquid nitrogen, and 500 μ L Buffer are added
RLS, the acutely concussion that is vortexed immediately mix.
2) it is then centrifuged 2 minutes in 4 DEG C of 12,000rpm (~13,400 × g).
3) supernatant is transferred in the Filter column (Spin Columns FS) for having been charged into collecting pipe, 4 DEG C of 12,000rpm from
The heart 1 minute, the careful supernatant drawn in collecting pipe was simultaneously transferred in new RNase-Free centrifuge tube (providing for oneself), and pipette tips are kept away as far as possible
Pellet cell debris in contact-free collecting pipe.
4) it is slowly added to the dehydrated alcohol of 0.5 times of supernatant volume, is mixed (at this time it is possible that precipitating), it is molten by what is obtained
Liquid and precipitating are transferred to together in the adsorption column (Spin Columns RM) for having been charged into collecting pipe.4 DEG C of 12,000rpm are centrifuged 1 point
Clock abandons waste liquid, adsorption column is placed back in collecting pipe.
5) 350 μ L Buffer RW1 are added into adsorption column RM, 4 DEG C of 12,000rpm are centrifuged 1 minute, abandon waste liquid, will inhale
Attached column places back in collecting pipe.
6) prepare DNase I mixed liquor: taking 52 μ L RNase-Free Water, be added thereto 8 μ L 10 ×
Reaction Buffer and 20 μ L DNase I (1U/ μ L) is mixed, and is configured to the reaction solution that final volume is 80 μ L.
7) 80 μ L DNase I mixed liquors are directly added into adsorption column, 20-30 DEG C is incubated for 15 minutes.
8) 350 μ L Buffer RW1 are added into adsorption column RM, 4 DEG C of 12,000rpm are centrifuged 1 minute, abandon waste liquid, will inhale
Attached column places back in collecting pipe.
9) 500 μ L Buffer RW2 are added into adsorption column RM, 4 DEG C of 12,000rpm are centrifuged 1 minute, abandon waste liquid, will inhale
Attached column places back in collecting pipe.
10) step 9 is repeated.
11) 4 DEG C of 12,000rpm are centrifuged 2 minutes.
12) adsorption column RM is fitted into new RNase-Free Centrifuge Tubes (1.5mL), to adsorbed film
30-50 μ L RNase-Free Water is vacantly added dropwise in intermediate position, is placed at room temperature for 2 minutes, and 4 DEG C of 12,000rpm are centrifuged 1 minute,
Obtained RNA solution is stored in -70 DEG C.RNA electrophoretogram is detailed in Fig. 1.
1.2 design of primers
Based on the cDNA sequence of the 2570bp obtained by electronic cloning, 5.0 software of DNAMAN 6.0 and Primer is utilized
Design primer, by Shanghai, Sheng Gong biotechnology Co., Ltd is synthesized.
MiETRl gene cloning primer information
The amplification of 1.3 target fragments
Using the first chain of cDNA of synthesis as template, P1F, P1R are that primer carries out conserved region amplification, with 3 ' GSP and 3P, 3NP
3 ' RT-PCR 2 wheel amplification is carried out for upstream and downstream primer；It is upstream and downstream with 5 ' GSP and 3P, 3NP using 5 ' RACE cDNA as template
Primer carries out 5 ' RACE amplification.PCR reaction system are as follows: 1 μ L, 2 × Taq PCRMasterMix12.5 μ L of cDNA template, upstream is drawn
1 μ L of object, 1 μ L of downstream primer add ddH2O9.5 μ L to 25 μ L of total volume.PCR response procedures are as follows: 94 DEG C of initial denaturation 3min, and 94
DEG C denaturation 1min, TM DEG C of annealing 1min, extend t min, 72 DEG C re-extend 10min reaction was completed, and 35 recycle.
Recycling, connection conversion and the sequencing of 1.4 target fragments
Target fragment is recycled with DNA QIAquick Gel Extraction Kit, target fragment is connect with PMD18-T carrier and converts DH5 α impression
State cell, converted product are coated in the plate containing 1 μ L Amp:1mL LB and cultivate, single colonie is provoked after 12h and carries out recombination daughter bacteria
Liquid identification, positive clone molecule are sent to Beijing Liuhe Huada Genomics Technology Co., Ltd's sequencing.
The analysis of 1.5 sequences
Existing sequence is retrieved with the Blast on GenBank and analyzes its conserved domain, using 6.0 He of DNA MAN
5.0 software of primer carries out design of primers, sequence assembly and translated amino acid.With the ProtParam work in ExPASy database
Tool and the forecast analysis of ProtScale tool speculate protein physicochemical property, and the prediction of protein transmembrane structure is used with analysis
TMPRED (http://www.ch.embnet.org/software/TMPRED_form.html), phosphorylation site prediction are used
NetPhos2.0 (http://www.cbs.dtu.dk/services/NetPhos) constructs phyletic evolution using MEGA 5.0
Tree.(http://www.ncbi.nlm.nih.gov/Structure/cdd/ is serviced using the CD-Search of the website NCBI
Wrpsb.cgi the conserved domain of mango Ethylene receptor gene MiETR1 amino acid sequence) is analyzed.
1.6 semi-quantitative RT-PCR analysis
The mango for storing 0,2,4,6,8,10 day under the conditions of 25 DEG C respectively is sampled.Store 0 under the conditions of 4 DEG C respectively,
3,6,9,12,15,18 and 21 days mango is sampled.The extraction of total serum IgE and reverse transcription method are the same as 1.1.
1) key instrument and reagent
German AnalytikJena qTOWERE2.2 fluorescence quantitative PCR instrument
Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..
RNA extracts kit: health is the OminiPlant RNA Kit (DNase I) of century biotechnology company
(CW2598S)
Reverse Transcription: full formula gold TransScript One-Step gDNA Removal and cDNA Synthesis
SuperMix(#AT311)
Quantitative PCR reagent: AceQ qPCR SYBR Green Master Mix is only praised in promise
6 × DNA Loading Dye, 10 × TAE (400mM Tris-acetate and 10mM EDTA, pH8.0), etc.
Other reagents are purchased from Sangon Biotech (Shanghai) Co., Ltd..
2) reference gene details
| No. | Gene Symbol | Gene information (such as Accession#) | Whether primer designs synthesis |
| 1 | GADPH | It is |
3) target gene information
| No. | Gene Symbol | Gene information (such as Accession#) | Whether primer designs synthesis |
| 1 | ETRl | It is |
4) primer sequence
| Primer | Primer sequence (5 ' -3 ') | Primer size |
| ETRl-F | CCTACAACTTCAACTCGGAACTT | |
| ETRl-R | TTCATCACCAACAGCATACTCAG | 145bp |
| GADPH-F | GTGGCTGTTAACGATCCCTT | |
| GADPH-R | GTGACTGGCTTCTCATCGAA | 150bp |
5) RNA is extracted
5.1 experiment reagent
Health is the OminiPlant RNA Kit (DNase I) of century biotechnology company
5.2 Detailed operating procedures
Concrete operation step is detailed in specification.
5.3RNA electrophoresis detection result is shown in Fig. 2.In attached drawing, electrophoretogram sequence is successively are as follows: blank group processing group 0,2,4,6,8
It, 1-MCP processing group 0,2,4,6,8 day,
2.2. reverse transcription
2.2.1 experiment reagent
(Beijing is complete by TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix
Shi Jin Bioisystech Co., Ltd).
2.2.2cDNA the synthesis of the first chain and gDNA removal
1. by RNA template, Primer Mix, 2 × TS Reaction Mix, RT/RI Enzyme Mix, gDNA
Remover and RNase-Free Water dissolution is placed in spare on ice.
2. configuring reaction system according to below table, total volume is 20 μ L.
| Reagent | 20 μ l reaction systems | Final concentration |
| RNA Template | 4μL | 1μg-5μg |
| Primer Mix | 1μL | |
| 2×TS Reaction Mix | 10μL | |
| RT/RI Enzyme Mix | 1uL | |
| gDNA Remover | 1uL | |
| RNase-Free Water | To 20uL |
3. first by RNA template, primer and RNase-Free Water mix, 65 DEG C be incubated for 5 minutes, ice bath 2 minutes, then
Add other reactive components.
4. mix gently, 25 DEG C 10 minutes, 50 DEG C 15 minutes, 85 DEG C inactivate for 5 seconds.After reaction, of short duration centrifugation, is placed in
Cooled on ice.
5. reverse transcription product is directly used in quantitative fluorescent PCR reaction.
2.3. fluorescence quantitative PCR detection
2.3.1 experiment sample
CDNA sample is diluted 10 times as machine testing in template.
2.3.2 real-time quantitative PCR test material and instrument
Quantitative PCR reagent: AceQ qPCR SYBR Green Master Mix
Quantitative PCR apparatus: German AnalytikJena qTOWERE2.2
2.3.3PCR reaction step
Prepare reaction mixture
PCR cycle condition
The operation of instrument
After completing above-mentioned steps, 96 orifice plates for having added sample are placed on AnalytikJena qTOWERE2.2 fluorescent quantitation
It is reacted in PCR instrument.
Experimental result
Above-mentioned experimental result, the GADPH amplification curve of the sample of sample are shown in that Fig. 3, the MiETR1 amplification curve of sample are shown in figure
4, the GADPH solubility curve of sample is shown in that Fig. 5, the MiETR1 solubility curve of sample are shown in Fig. 6.
The verifying of 2 mango Ethylene receptor gene MiETR1 of embodiment or expression characterization analysis
The amino acid sequence derived with ProtParam tool analysis MiETRl nucleotide, the results showed that MiETRl albumen point
Sub- total amount is 86385.1, isoelectric point pI9.09, and the total amino acid residues of negative electrical charge and positive charge are respectively 75 and 88, point
Minor is C3891H6264N1064O1080S36, total atom number is 12335, fat coefficient 106.84, and unstability index 39.39 is hydrophilic
Property is 0.065, illustrates that it is a stable hydrophobin；
ProtScale analysis hydrophily and hydrophobicity prediction show: MiETRl maximum hydrophilicity value is+4.500, minimum parent
Aqueous value is -4.500, and has maximum hydrophobic peak at 20, is worth+2.000 or more；14 hydrophilic peaks are worth -2.000 or less.
Its hydrophobic amino acid is significantly more than hydrophilic amino acid, and software prediction result is hydrophobicity, therefore speculates the whole peptide chain of albumen
Hydrophobicity is presented.
MiETRl protein phosphorylation site is analyzed through NetPhos2.0 software, Ser, Thr and Tyr in MiETRl peptide chain are equal
Be likely to occur phosphorylation, point have 89 in 0.5 or more amino acid sites, wherein have 48 containing Ser phosphorylation site
It is a, be located at peptide chain the 7th, 32,45,67,80,122,138,166,186,211,217,231,236,243,250,256,
275、279、297、331、334、335、348、351、355、393、398、400、415、420、436、449、492、493、498、
502, at 520,533,599,605,609,634,652,664,669,670,685,718；Thr phosphorylation site has 29, point
Not Wei Yu peptide chain the 1st, 11,86,98,144,152,161,182,195,212,230,272,274,284,414,416,489,
508, at 516,555,573,590,591,657,694,697,705,719,782；Tyr phosphorylation site has 12, respectively position
At peptide chain the 100th, 131,136,225,399,433,463,524,556,675,691,774.
Speculate through TMPRED, MiETRl albumen is transmembrane protein, the N-terminal of albumen MiETRl in amino acid 1 19-139,
302-325 and 765-785 has trans-membrane region at 3.
MiETRl albumen is analyzed through 4.0 Serve of SignaIP, the results showed that is not contained signal peptide on entire peptide chain, is pushed away
Surveying albumen is non-secreted protein.
It is pressed using the coiled-coiled structure of COILS program analysis MiETRl albumen with window 14,21 and 28 for parameter
The principle of spiral can be formed according to probability > 50%, the results showed that MiETRl protein does not form coiled coil knot on whole peptide chain
Structure.
The conserved domain of albumen contains GAF structural domain, HisKA structural domain, HATPase_c structural domain and REC structural domain.
MiETRl Secondary structure is analyzed through nnPredict software prediction, structure is shown: MiETRlb albumen contains
There are 3 kinds of alpha-helix, β-corner and random coil structures, wherein ratio shared by MiETRl albumen alpha-helix is respectively
24.37%；β-corner accounts for 9.97%；Random coil accounts for 42.93%.Therefore MiETRl Protein secondary structure is with random coil
It is main.
Predict that prediction result is as shown in Figure 7 through three-dimensional structure of the SWISS-MODEL tool to MiETRl albumen.
The building of MiETRl protein system chadogram is as shown in Figure 8.MiETRl amino acid sequence and sweet orange Citrus
Sinensis (KDO50509.1) and 90% or more Ke Laimen shaddock Citrus clementina (XP006442239.1) similarity.
3 1- methyl cyclopropene suppressor MiETR1 of embodiment expression influences to study on mango aging
The influence that MiETRl is expressed in 1.1-MCP processing
1-MCP, that is, 1- methyl cyclopropene (1-methy lcyclopropene, 1-MCP) is a kind of New Type of Ethylene receptor suppression
Preparation, have it is non-toxic and tasteless, it is easy to use, it is low in cost, it is safe and efficient the advantages that.
Take 1-MCP to handle the mango sample newly picked, handled according to a conventional method, the processing time is respectively 0,2,4,6,
8,10,12,14,16 days, while blank control group is set.After each time point arrives, take mango sample by 1 He of embodiment respectively
2 methods extract MiETRl gene, detect the expression of MiETRl gene.The result shows that MiETRl is expressed after 1-MCP is handled
Level significantly reduces, and the most obvious in reduction in 4-10 days.As a result as shown in Figure 9.
Influence of the 2.1-MCP processing to acetate releasing quantity in mango
The Guangxi mango platform agriculture 1 newly picked is taken, is stored under the conditions of 25 DEG C and 4 DEG C, using the 1-MCP of 5 μ L/L
After processing mango 0-21 days, detects acetate releasing quantity in mango and detect MiETRl expression by 1 method of embodiment.It sets simultaneously
Set blank group.
The experimental results showed that 1-MCP processing is conducive to delay MiETRl in mango under 25 DEG C of storage and 4 DEG C of holding conditions
Expression delays and reduces ethylene evolution peak and respiratory rate, thus after to maintaining fruit quality and extending fruit to adopt
There is significant impact in service life.Wherein at 25 DEG C, the mango acetate releasing quantity handled through 1-MCP is below untreated, release
Also it delays on peak；And at 4 DEG C, through 1-MCP handle mango acetate releasing quantity be below before 16 days it is untreated, after 16 days
It is higher than untreated mango sample instead, and discharges peak and also delay up to 5 days or more.Result figure 10 is that 1-MCP is handled to mango
Ethylene generates the influence of rate under 25 DEG C of holding conditions；Figure 11 is that 1-MCP is handled to ethylene generation speed under 4 DEG C of holding conditions of mango
The influence of rate.
It is appreciated that because of 1- pentyl-cyclopropene, 1-, cyclopropene, 1- propyl cyclopropylene and 1- Octylcyclopropene have
There is the infrastructure cyclopropylene of 1- methyl cyclopropene, only substituent group changes, and belongs to analog, also belongs to knot in chemistry
The similar analog of structure, can often be replaced in chemical experiment, therefore in the present invention, can also using 1- pentyl-cyclopropene,
Any one of cyclopropene, 1- propyl cyclopropylene and 1- Octylcyclopropene replace 1- methyl cyclopropene to be tested to 1-,
It can simultaneous selection 1- pentyl-cyclopropene, 1- in cyclopropene, 1- propyl cyclopropylene, 1- Octylcyclopropene and 1- methyl cyclopropene
Two or more of mixed liquors tested, can reach the object of the invention, do not influence implementation of the invention.
Above description is the detailed description for the present invention preferably possible embodiments, but embodiment is not limited to this hair
Bright patent claim, it is all the present invention suggested by technical spirit under completed same changes or modifications change, should all belong to
In the covered the scope of the patents of the present invention.
SEQUENCE LISTING
<110>Institute of Agro-Products Processing Science and Technology, Guangxi Zhuang Autonomous Region Academy af Agricultural Sciences
<120>a kind of mango Ethylene receptor gene
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 2570
<212> DNA
<213> Mangifera indica
<400> 1
acatggggat agaagaaaga gagttgagtt gtagagaccc cccaaaatct caagtaaatc 60
gtcaaagtgg gtctcatgaa ttgttcacgg gcttaaaggt ggttcagtca acatggagtc 120
ttgcaactgc attgaaccac aatggccagc tgatgaattg ttgatgaagt atcaatatat 180
ttcagatttc ttcattgcac ttgcttactt ttcaattcct ctagagctga tctactttgt 240
gaagaaatct gccgtgtttc catatagatg ggtccttgta cagtttggcg ctttcattgt 300
tttgtgtggg gcgacacatc ttataaactt gtggactttt aatatgcatt caaggactgt 360
ggcaatagta atgaccaccg ctaaggtttt gacagctgcg gtttcttgtg caacggccct 420
tatgcttgta catattacac ctgatctgtt aagtgttaaa actagagaac tatttttaaa 480
aaacaaggct gcacagcttg atagagaaat gggcttgatc cgcacacagg aagaaaccgg 540
tcggcatgtt aggatgttga cgcatgagat cagaagcact ttggatagac ataccatact 600
aaagaccact cttgtcgaat tgggaagaac tttggcactg gaagagtgtg ccttatggat 660
gccgacgcaa actggtttag agcttcaact ctcatacaca cttcatcaac agaatcctgt 720
tgggtatact gtgcccatcc aacttcctgt gatcagtcaa gtattcacca gcaatcatgc 780
agtaaagata tcaccaaatt gtcatgtggc taggttaagg cctcttgcag gaaaatatat 840
gcctggcgag gtggttgctg ttcgtgttcc actcctacat ctattaaatt ttcaaattaa 900
tgattggcca gaactttcta caaaacgcta tgctttgatg gttttgatgc ttccctcaga 960
tagtgcaagg cagtggcatg tccatgagtt ggaacttgtt gaagtggttg ctgatcaggt 1020
ggctgttgct ctttcacatg ctgccatctt agaggagtca atgagagcaa gggatcttct 1080
tgtggtgcag aatatcgcgc ttgaccgtgc cagaagagaa gcagaaacag ccattcatgc 1140
tcgcaacgat ttcctggctg ttatgaacca tgagatgaga actccaatgc atgcaatcgt 1200
tgccctttct tctttactgc aagaaactga attgacactt gagcagcgac tgatggttga 1260
aacaattctt aagagcagta atctcttagc tactctaata aatgatgtat tagatctttc 1320
gaggcttgaa gatggtagcc tacaacttca actcggaact tttaatcttc atgctctatt 1380
caaggaggtc cttaatctga tcaagcctat tgcatcagtc aagaagttgc ggattgcatt 1440
gaatttggct cctgatcttc ctgagtatgc tgttggtgat gaaaagcgct taatgcaaac 1500
tctcctaaat attgttggca acgctgtaaa gttcacaaaa gaaggcaaca tctcaatcac 1560
tgcttttgtt gcaaaatcag agtccttacg agactatcga gccccagaat tttttccagt 1620
gccgagtgat aatcattttt acctgcgtgt acaggttaaa gatacaggat caggcattaa 1680
accccaagat attcccaagt tatttacaaa atttgcgcaa aatcaatcaa tagctaccag 1740
gaatttcaat ggcagtggac ttggccttgc aatttgtaag aggtttgtta atcttatgga 1800
gggacatata tggattgaaa gtgaaggtct tggcaagggt tccactgcta tcttcattgt 1860
gaaacttggg atccctgaga gctcaaatga atctaagctc tctttcatgc caaaaatatc 1920
aggaccacag gcaaatttta cagggctcaa agttcttgtc atggatgata atggagtcag 1980
cagatcagtc acaaaagggc ttttggtgca cctgggatgt gatgtaatga ccgttggctc 2040
aagtgaggac tgcttgcgcg tactatctca tgagcacaag gtggtcttca tggatgttgg 2100
gatgcctggt atagatggtt acgaagttgc tgtccttata caccaaaagt ttacaaggcg 2160
tcatgaaagg ccactgatag tagccctgac cggaaatact gacaaagtaa ccaaggagaa 2220
ctgcatgaga gttggaatgg atggtgttat attgaaacct gtttcactag aaaaaatgag 2280
gagcgtttta ctaggccttt tggagcatcg agttttcttt gaggccgtat aagcacagat 2340
gagccagctg ccagatgcca tttagcctgg aaaaagatgg tacaggtaat gcaagtttat 2400
ctctagagat gtatggtttt gtgtacatac ccagatggta ttagggcatt ggagtgactg 2460
agtgctgaca agagacaatt attttatcaa aattcatgtt tatgaatata tattttttta 2520
aattaagccc tattaaccat tgaagcaaaa agaaaaaaaa aaaaaaaaaa 2570
<210> 2
<211> 739
<212> PRT
<213> Mangifera indica
<400> 1
Met Glu Ser Cys Asn Cys Ile Glu Pro Gln Trp Pro Ala Asp Glu Leu
1 5 10 15
Leu Met Lys Tyr Gln Tyr Ile Ser Asp Phe Phe Ile Ala Leu Ala Tyr
20 25 30
Phe Ser Ile Pro Leu Glu Leu Ile Tyr Phe Val Lys Lys Ser Ala Val
35 40 45
Phe Pro Tyr Arg Trp Val Leu Val Gln Phe Gly Ala Phe Ile Val Leu
50 55 60
Cys Gly Ala Thr His Leu Ile Asn Leu Trp Thr Phe Asn Met His Ser
65 70 75 80
Arg Thr Val Ala Ile Val Met Thr Thr Ala Lys Val Leu Thr Ala Ala
85 90 95
Val Ser Cys Ala Thr Ala Leu Met Leu Val His Ile Thr Pro Asp Leu
100 105 110
Leu Ser Val Lys Thr Arg Glu Leu Phe Leu Lys Asn Lys Ala Ala Gln
115 120 125
Leu Asp Arg Glu Met Gly Leu Ile Arg Thr Gln Glu Glu Thr Gly Arg
130 135 140
His Val Arg Met Leu Thr His Glu Ile Arg Ser Thr Leu Asp Arg His
145 150 155 160
Thr Ile Leu Lys Thr Thr Leu Val Glu Leu Gly Arg Thr Leu Ala Leu
165 170 175
Glu Glu Cys Ala Leu Trp Met Pro Thr Gln Thr Gly Leu Glu Leu Gln
180 185 190
Leu Ser Tyr Thr Leu His Gln Gln Asn Pro Val Gly Tyr Thr Val Pro
195 200 205
Ile Gln Leu Pro Val Ile Ser Gln Val Phe Thr Ser Asn His Ala Val
210 215 220
Lys Ile Ser Pro Asn Cys His Val Ala Arg Leu Arg Pro Leu Ala Gly
225 230 235 240
Lys Tyr Met Pro Gly Glu Val Val Ala Val Arg Val Pro Leu Leu His
245 250 255
Leu Leu Asn Phe Gln Ile Asn Asp Trp Pro Glu Leu Ser Thr Lys Arg
260 265 270
Tyr Ala Leu Met Val Leu Met Leu Pro Ser Asp Ser Ala Arg Gln Trp
275 280 285
His Val His Glu Leu Glu Leu Val Glu Val Val Ala Asp Gln Val Ala
290 295 300
Val Ala Leu Ser His Ala Ala Ile Leu Glu Glu Ser Met Arg Ala Arg
305 310 315 320
Asp Leu Leu Val Val Gln Asn Ile Ala Leu Asp Arg Ala Arg Arg Glu
325 330 335
Ala Glu Thr Ala Ile His Ala Arg Asn Asp Phe Leu Ala Val Met Asn
340 345 350
His Glu Met Arg Thr Pro Met His Ala Ile Val Ala Leu Ser Ser Leu
355 360 365
Leu Gln Glu Thr Glu Leu Thr Leu Glu Gln Arg Leu Met Val Glu Thr
370 375 380
Ile Leu Lys Ser Ser Asn Leu Leu Ala Thr Leu Ile Asn Asp Val Leu
385 390 395 400
Asp Leu Ser Arg Leu Glu Asp Gly Ser Leu Gln Leu Gln Leu Gly Thr
405 410 415
Phe Asn Leu His Ala Leu Phe Lys Glu Val Leu Asn Leu Ile Lys Pro
420 425 430
Ile Ala Ser Val Lys Lys Leu Arg Ile Ala Leu Asn Leu Ala Pro Asp
435 440 445
Leu Pro Glu Tyr Ala Val Gly Asp Glu Lys Arg Leu Met Gln Thr Leu
450 455 460
Leu Asn Ile Val Gly Asn Ala Val Lys Phe Thr Lys Glu Gly Asn Ile
465 470 475 480
Ser Ile Thr Ala Phe Val Ala Lys Ser Glu Ser Leu Arg Asp Tyr Arg
485 490 495
Ala Pro Glu Phe Phe Pro Val Pro Ser Asp Asn His Phe Tyr Leu Arg
500 505 510
Val Gln Val Lys Asp Thr Gly Ser Gly Ile Lys Pro Gln Asp Ile Pro
515 520 525
Lys Leu Phe Thr Lys Phe Ala Gln Asn Gln Ser Ile Ala Thr Arg Asn
530 535 540
Phe Asn Gly Ser Gly Leu Gly Leu Ala Ile Cys Lys Arg Phe Val Asn
545 550 555 560
Leu Met Glu Gly His Ile Trp Ile Glu Ser Glu Gly Leu Gly Lys Gly
565 570 575
Ser Thr Ala Ile Phe Ile Val Lys Leu Gly Ile Pro Glu Ser Ser Asn
580 585 590
Glu Ser Lys Leu Ser Phe Met Pro Lys Ile Ser Gly Pro Gln Ala Asn
595 600 605
Phe Thr Gly Leu Lys Val Leu Val Met Asp Asp Asn Gly Val Ser Arg
610 615 620
Ser Val Thr Lys Gly Leu Leu Val His Leu Gly Cys Asp Val Met Thr
625 630 635 640
Val Gly Ser Ser Glu Asp Cys Leu Arg Val Leu Ser His Glu His Lys
645 650 655
Val Val Phe Met Asp Val Gly Met Pro Gly Ile Asp Gly Tyr Glu Val
660 665 670
Ala Val Leu Ile His Gln Lys Phe Thr Arg Arg His Glu Arg Pro Leu
675 680 685
Ile Val Ala Leu Thr Gly Asn Thr Asp Lys Val Thr Lys Glu Asn Cys
690 695 700
Met Arg Val Gly Met Asp Gly Val Ile Leu Lys Pro Val Ser Leu Glu
705 710 715 720
Lys Met Arg Ser Val Leu Leu Gly Leu Leu Glu His Arg Val Phe Phe
725 730 735
Glu Ala Val
Claims (4)
1. a kind of mango ethane cyclic amp receptor protein, which is characterized in that the base being made of the amino acid sequence of sequence table SEQ ID NO:2
Because of the protein of MiETR1 coding；
Ratio shared by the α-helixstructure of the protein of the gene M iETR1 coding is respectively 24.37%；β-corner structure accounts for
9.97%；Random coil structure accounts for 42.93%；
The phosphorylation site of the protein of gene M iETR1 coding, Ser, Thr and Tyr in MiETRl peptide chain have generation
Phosphorylation, wherein have 48 containing Ser phosphorylation site, be located at peptide chain the 7th, 32,45,67,80,122,
138、 166、 186、 211、 217、 231、 236、 243、 250、 256、 275、 279、 297、 331、 334、
335、 348、 351、 355、 393、 398、 400、 415、 420、 436、 449、 492、 493、 498、 502、
520, at 533,599,605,609,634,652,664,669,670,685,718；Thr phosphorylation site has
29, be located at peptide chain the 1st, 11,86,98,144,152,161,182,195,212,230,272,274,
284、 414、 416、 489、 508、 、516、 555、 573、 590、 591、 657、 694、 697、 705、 719、
At 782；Tyr phosphorylation site has 12, be located at peptide chain the 100th, 131,136,225,399,433,463,
524, at 556,675,691,774.
2. a kind of mango ethane cyclic amp receptor protein according to claim 1, which is characterized in that the gene M iETR1 is by sequence table
The coding of base sequence described in SEQ ID NO:1.
3. a kind of application of mango ethane cyclic amp receptor protein according to claim 1, which is characterized in that make with ethylene inhibitor
For the protein of gene M iETR1 coding, extend the platform agriculture No.1 mango shelf-life；
The ethylene inhibitor is selected from 1- methyl cyclopropene and its structure homologue 1- pentyl-cyclopropene, 1- cyclopropene, 1-
Any one or a few in propyl cyclopropylene and 1- Octylcyclopropene.
4. a kind of expression vector, which is characterized in that include the gene M iETR1 in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710120896.0A CN106701785B (en) | 2017-03-02 | 2017-03-02 | A kind of mango Ethylene receptor gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710120896.0A CN106701785B (en) | 2017-03-02 | 2017-03-02 | A kind of mango Ethylene receptor gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701785A CN106701785A (en) | 2017-05-24 |
| CN106701785B true CN106701785B (en) | 2019-01-08 |
Family
ID=58917508
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710120896.0A Active CN106701785B (en) | 2017-03-02 | 2017-03-02 | A kind of mango Ethylene receptor gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701785B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110627884B (en) * | 2019-10-31 | 2022-06-14 | 河南农业大学 | Agaricus bisporus ethylene receptor protein Ab143539 |
| CN110669118B (en) * | 2019-10-31 | 2022-06-14 | 河南农业大学 | Agaricus bisporus ethylene receptor protein |
| CN110669117B (en) * | 2019-10-31 | 2022-06-14 | 河南农业大学 | Volvariella volvacea ethylene receptor protein |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1232530C (en) * | 2002-09-04 | 2005-12-21 | 中国农业科学院原子能利用研究所 | Ethane cyclic amp receptor protein of wheat and its coding sequence |
| CN1218959C (en) * | 2002-10-11 | 2005-09-14 | 中国科学院遗传与发育生物学研究所 | Paddy rice ethylene receptor protein, coded gene and use thereof |
| CN102167706B (en) * | 2010-02-26 | 2014-12-24 | 青岛绿诺新能源有限公司 | Methods preparing lithium 1-methylcyclopropene |
| CN102827859A (en) * | 2011-06-16 | 2012-12-19 | 贵州师范大学 | Construction method of etr1 gene containing binary expression vector and application thereof |
| CN103999928A (en) * | 2014-05-05 | 2014-08-27 | 沈阳农业大学 | Fresh-keeping storage method for harvested fruits and vegetables |
| CN104855110B (en) * | 2015-05-27 | 2017-03-01 | 广西壮族自治区农业科学院农产品加工研究所 | A kind of method delaying the ripe listing of Fructus Musae |
-
2017
- 2017-03-02 CN CN201710120896.0A patent/CN106701785B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701785A (en) | 2017-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| De Paepe et al. | Transcriptional profiling by cDNA‐AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis | |
| Lund et al. | Gene expression analyses in individual grape (Vitis vinifera L.) berries during ripening initiation reveal that pigmentation intensity is a valid indicator of developmental staging within the cluster | |
| US7989676B2 (en) | Nucleotide sequences and corresponding polypeptides conferring modulated plant characteristics | |
| CN104093842B (en) | Improve drought resistance in plants, nitrogen use efficiency and yield | |
| Gainza-Cortés et al. | Characterization of a putative grapevine Zn transporter, VvZIP3, suggests its involvement in early reproductive development in Vitis vinifera L | |
| CN106701785B (en) | A kind of mango Ethylene receptor gene | |
| CN111778265B (en) | Mutant gene, mutant, expression vector and application of zearalenone oxidase | |
| US20060015970A1 (en) | Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics | |
| CN104004768B (en) | A kind of Fructus actinidiae chinensis gene that can improve tamato fruit nutritional quality and application thereof | |
| US8536429B2 (en) | Polynucleotides encoding a NAX2 polypeptide and methods for enhancing salinity tolerance in plants | |
| AU2007291889A1 (en) | Salt tolerant plants | |
| CN106591322A (en) | Gingko MADS-box transcription factor gene GbMADS9 for controlling blossoming of plants and encoding protein and application of Gingko MADS-box transcription factor gene GbMADS9 | |
| CN108699568A (en) | Increase content of vegetable oil by changing the negative regulatory factor of acetyl-COA carboxylases | |
| CN110229825A (en) | The brown Leaf color mutant GBL1 gene of rice ash and its application | |
| CN101981191A (en) | Nucleotide sequences and corresponding polypeptides conferring modulated growth rate and biomass in plants grown in saline and oxidative conditions | |
| Zhao et al. | Expression analysis of the DkNCED1, DkNCED2 and DkCYP707A1 genes that regulate homeostasis of abscisic acid during the maturation of persimmon fruit | |
| Wang et al. | Differential expression analysis by cDNA-AFLP of Solanum torvum upon Verticillium dahliae infection | |
| CN106929515B (en) | A kind of mango ethylene receptor MiERS1 gene | |
| US20120216317A1 (en) | Nucleotide sequences and polypeptides encoded thereby useful for increasing plant size and increasing the number and size of leaves | |
| CN102604963A (en) | Separation, cloning and application of Poncirus trifoliata EARLYFLOWERING 5 (PtELF5) gene | |
| Przybecki et al. | The isolation of cDNA clones from cucumber (Cucumis sativus L.) floral buds coming from plants differing in sex | |
| CN106146635A (en) | Semen Maydis ZmSTP1 albumen and encoding gene thereof and application | |
| CN108559752B (en) | MdMYB98 gene for regulating and controlling seed quantity in apple and application thereof | |
| CN110078805A (en) | The albumen and application of loquat EjAG gene and its coding | |
| JP3823137B2 (en) | Plant flowering promoting gene RFT1 and method for predicting plant flowering time |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |